Journal Detail Information

1

Cite

Share

Comparison of oligonucleotide-microarray and serial analysis of gene expression (SAGE) in transcript profiling analysis of megakaryocytes derived from CD34+ cells.

Hyung Lae KIM

Experimental & Molecular Medicine.2003;35(5):460-466.

For the comprehensive analysis of transcript expression, the array-based hybridization analysis and the serial analysis of gene expression (SAGE) are commonly used platforms. The SAGE is based on a high-throughput sequencing of ditags derived from the transcript. DNA microarrays are a powerful tool for monitoring thousands of transcripts simultaneously, whereas the Genechip (Affimatrix microarray) technology is based on the hybridization of a single probe or other manufacturer's microarrays (cDNA- or oligonucleotide-microarray) procedures include the competitive hybridization of two probes. In this study, the quantitative accuracy of expression using oligonucleotide-microarray was determined by comparing data set from the SAGE. In previous study the microSAGE was performed for the megakaryocytes and non- megakaryocytes derived from human cord blood CD34(+)cells by ex vivo expansion using thrombopoietin, and a total of 38,909 tags representing 8,976 unique genes were obtained. On the identical RNA, expression profiling was also carried out using oligonucleotide-microarray (MAGIC II 10K chip, Macrogen). The most frequently expressed genes in human megakaryocytes were identified as platelet factor 1 followed by annexin A1, ribosomal protein S23. The majority of the 50 most highly expressed genes in the CD34(+)-derived megakaryocytes were those involved in protein synthesis, e.g., ribosomal proteins. The expression level through the single channel of oligonucleotide-microarray and SAGE have a fairly good correlation in terms of absolute analyses and that the correlation is higher for the genes with higher expression levels.
Antigens, CD34/*metabolism ; Comparative Study ; Fetal Blood ; Gene Expression Profiling/*methods ; Human ; Megakaryocytes/*metabolism ; Oligonucleotide Array Sequence Analysis/*methods ; RNA, Messenger/analysis/genetics ; Reproducibility of Results ; Support, Non-U.S. Gov't ; Transcription, Genetic/*genetics

2

Cite

Share

Real-time PCR analysis of the apoptosis related genes in ATRA treated APL t(15;17) patients.

Hakan SAVLI ; Sema SIRMA ; Balint NAGY ; Melih AKTAN ; Guncag DINCOL ; Ugur OZBEK

Experimental & Molecular Medicine.2003;35(5):454-459.

All-trans retinoic acid (ATRA) treatment of the acute promyelocytic leukemia (APL) have subsequently resulted in cell apoptosis, but the molecular mechanism of this effect remains elusive. In order to understand a possible involvement of genes regulating apoptotic signal pathways, expression levels of bcl2, bax, dapk1, myc, bad, wt1, and mcl genes were analyzed during ATRA treatment in five APL patients with t (15;17) using Real- time PCR (LightCycler). Two samples from each patient were compared to each other: primary diagnostic sample and a sample taken at remission. Effect of the ATRA treatment was demonstrated by the concomitant induction of cd14 and il1beta genes in four patients. Also other apoptosis related genes were found down-regulated in general but especially the down regulated levels of wt1 and bax attract attention. Result suggested that ATRA dependent apoptosis of APL was under the control of both internal and external pathways without relationships to the amount of the blast populations. Ratio of bcl2 to bax may be more important for this regulation than the ratio of bcl2 to bad. Either bcl2 family or less known apoptosis related genes as wt1 will still be required to further studies in this setting.
Apoptosis/drug effects/*genetics ; Chromosomes, Human, Pair 15/genetics ; Chromosomes, Human, Pair 17/genetics ; Gene Expression Profiling ; Gene Expression Regulation, Neoplastic/*drug effects ; HL-60 Cells ; Human ; Leukemia, Promyelocytic, Acute/*genetics ; Polymerase Chain Reaction/*methods ; Support, Non-U.S. Gov't ; Time Factors ; Translocation (Genetics)/*genetics ; Tretinoin/*pharmacology

3

Cite

Share

Impaired phosphorylation and mis-localization of Bub1 and BubR1 are responsible for the defective mitotic checkpoint function in Brca2-mutant thymic lymphomas.

Hyunsook LEE

Experimental & Molecular Medicine.2003;35(5):448-453.

Breast cancer susceptibility gene, BRCA2, is a tumor suppressor and individuals who inherit one defected copy of BRCA2 allele experience early onset breast cancer or ovarian cancer accompanied by the loss of the wild type allele. Mouse model for Brca2 mutation shows growth retardation and paradoxical occurrence of thymic lymphomas. Thymic lymphomas from Brca2-mutant mice harbor mutations in p53, Bub1, and BubR1, which function as mitotic checkpoint proteins. Therefore, interplay between Brca2 and mitotic checkpoint has been suggested in the maintenance of genetic fidelity, although it has not been assessed whether the unique mutations in Bub1 and BubR1 found in Brca2-mutant mice are responsible for the abolishment of mitotic checkpoint function. This report demonstrates that Bub1 and BubR1 mutant proteins from Brca2(-/-)thymic lymphomas have defects in the phosphorylation and kinetochore localization after spindle damage. Thus, the mutations of Bub1 and BubR1 found in Brca2- mutant mice indeed are responsible for the chromosome instability in Brca2-mutated tumors.
Animals ; BRCA2 Protein/*genetics/*metabolism ; Cell Cycle Proteins ; Cell Transformation, Neoplastic/metabolism ; Mice ; *Mitosis ; Mutation/*genetics ; Phosphorylation ; Protein Kinases/*metabolism ; Protein Transport ; Support, Non-U.S. Gov't ; T-Lymphocytes/metabolism ; Thymus Neoplasms/genetics/*pathology

4

Cite

Share

CD99 type II is a determining factor for the differentiation of primitive neuroectodermal cells.

Eun Jung LEE ; Hyun Gyu LEE ; Sung Hye PARK ; Eun Young CHOI ; Seong Hoe PARK

Experimental & Molecular Medicine.2003;35(5):438-447.

CD99 is a 32-kDa cell surface molecule present on thymocytes, peripheral T cells, many other hematopoietic stem cells and somatic cells were implicated in cell-cell adhesion and cell-activation phenomena. Two major subtypes have been identified so far, designated CD99 type I and type II. We have investigated the correlation between the degree of neural differentiation and the expression of CD99 subtypes in three differentially differentiated cell lines such as CADO-ES1, RD-ES, and SH-N-SY5Y, in order of differentiation. In addition, we induced differentiation of the RD-ES cell line by N(6),2'-dibutyryl-cAMP (db-cAMP). Six days after treatment with db-cAMP, RD-ES cell line has changed its morphology from uniform round cells to cells with neurites, and initially CD99 type II-overexpressed RD-ES cells showed significant down-regulation of CD99 type II, whereas CD99 type I expression remained constant. When RD- ES cells were transfected with the cDNA encoding for CD99 type I-green fluorescence protein (GFP) and type II-GFP, CD99 type II transfected RD-ES cell line remained unchanged with morphology of undifferentiated form. Our data suggest that CD99 type II acts as a negative regulator in the neural differentiation of precursor cells that might occur during nerve system development.
Antigens, CD/genetics/*metabolism ; Bucladesine/pharmacology ; Cell Adhesion Molecules/genetics/*metabolism ; *Cell Differentiation/drug effects ; Cell Line ; Cell Size/drug effects ; Ectoderm/*cytology/drug effects/*metabolism ; Human ; Neurites/drug effects ; Neurons/*cytology/drug effects/*metabolism ; Protein Isoforms/genetics/metabolism ; Support, Non-U.S. Gov't ; Transfection

5

Cite

Share

NF-kappaB is involved in the TNF-alpha induced inhibition of the differentiation of 3T3-L1 cells by reducing PPARg expression.

Gi Nam CHAE ; Sahng June KWAK

Experimental & Molecular Medicine.2003;35(5):431-437.

TNF-alpha, a trimeric cytokine, was known to inhibit differention of preadipocytes to adipocytes. In the present study, we investigated signal mediators working downstream of TNF-alpha using murine 3T3-L1 cells. TNF-alpha induced activation of both c-jun NH2-terminal kinase (JNK) and nuclear transcription factor-kappaB (NF-kappaB) in 3T3-L1 cells. Blockage of these two mediators activities by specific inhibitors, SP600125 and Ad-IkappaBalpha-SR restored adipogenesis differentiation suggesting their involvement in the inhibited differentiation of 3T3-L1 cells by TNF-alpha. Consistent with previous studies, peroxisome proliferator-activated receptor gamma (PPARgamma) a key transcriptional regulator was remarkably reduced by TNF-alpha treatment. Compared with adipogenesis, however, SP600125, a chemical JNK inhibitor hardly relieved TNF-alpha effect on PPARgamma expression whereas S32A/S36A mutant of IkappaBalpha considerably recovered PPARgamma expression, indicating that two signal mediators exploit separable main routes to achieve reduced adipogenesis. These results suggest that inhibition of 3T3-L1 cells differentiation by TNF-alpha is partly implemented through NF-kappaB and one of its downstream effectors be PPARgamma.
3T3-L1 Cells ; Adipocytes/cytology/drug effects ; Animals ; Cell Differentiation/*drug effects ; Gene Expression Regulation/*drug effects ; Mice ; NF-kappa B/*metabolism ; Promoter Regions (Genetics)/genetics ; RNA, Messenger/genetics/metabolism ; Receptors, Cytoplasmic and Nuclear/*genetics ; Support, Non-U.S. Gov't ; Transcription Factors/*genetics ; Tumor Necrosis Factor/*pharmacology

6

Cite

Share

Biochemical characterizations reveal different properties between CDK4/cyclin D1 and CDK2/cyclin A.

Dong Myung KIM ; Kyungmi YANG ; Beom Seok YANG

Experimental & Molecular Medicine.2003;35(5):421-430.

CDK2 and CDK4 known promoter of cell cycling catalyze phosphorylation of RB protein. Enzyme specificity between two CDKs that work at a different cell cycle phase is not clearly understood. In order to define kinase properties of CDK2 and CDK4 in complex with cycline A or cycline D1 in relation to their respective role in cell cycling regulation, we examined enzymatic properties of both CDK4/cycline D1 and CDK2/cycline A in vitro. Association constant, Km for ATP in CDK4/cyclin D1 was found as 418 micrometer, a value unusually high whereas CDK2/cyclin A was 23 micrometer, a value close to most of other regulatory protein kinases. Turnover value for both CDK4/cyclin D1 and CDK2/cyclin A were estimated as 3.4 and 3.9 min(-1)respectively. Kinetic efficiency estimation indicates far over one order magnitude less efficiency for CDK4/cyclin D1 than the value of CDK2/cycline A (9.3 pM(-1)min(-1)and 170 pM(-1)min(-1)respectively). In addition, inhibition of cellular CDK4 caused increase of cellular levels of ATP, even though inhibition of CDK2 did not change it noticeably. These data suggest cellular CDK4/cyclin D1 activity is tightly associated with cellular ATP concentration. Also, analysis of phosphorylated serine/threonine sites on RB catalyzed by CDK4/cyclin D1 and CDK2/cyclin A showed significant differences in their preference of phosphorylation sites in RB C-terminal domain. Since RB is known to regulate various cellular proteins by binding and this binding is controlled by its phosphorylation, these data shown here clearly indicate significant difference in their biochemical properties between CDK4/cyclin D1 and CDK2/cyclin A affecting regulation of cellular RB function.
Adenosine Triphosphate/metabolism ; Amino Acid Sequence ; Baculoviridae/genetics ; CDC2-CDC28 Kinases/genetics/isolation&purification/*metabolism ; Cyclin A/genetics/isolation&purification/*metabolism ; Cyclin D1/genetics/isolation&purification/*metabolism ; Cyclin-Dependent Kinases/antagonists&inhibitors/genetics/isolation&purification/*metabolism ; Human ; Kinetics ; Molecular Sequence Data ; Phosphorylation ; Protein Conformation ; Protein p16/metabolism ; Recombinant Proteins/genetics/isolation&purification/metabolism

7

Cite

Share

High efficiency transduction of human VEGF(165)into human skeletal myoblasts: in vitro studies.

Lei YE ; Husnain Kh HAIDER ; Shujia JIANG ; Ruowen GE ; Peter K LAW ; Eugene KW SIM

Experimental & Molecular Medicine.2003;35(5):412-420.

We report the transduction of human VEGF(165)gene into human myoblast and characterization of the transduced myoblasts for transduction and expression efficiency. Human myoblasts were assessed by immunostaining for desmin expression. A replication incompetent adenoviral vector carrying human VEGF(165)was constructed and used for transduction of myoblasts. Immunostaining of transduced myoblasts was used to determine transduction efficiency. Expression efficiency was confirmed by immunoblotting, ELISA and reverse transcription (RT)-PCR analysis using human VEGF(165)specific primers (5'-3' = 5'ATGAACTTTCTGCTGTCTTGGGTG and 3'-5' = ACACCGCCTCGGCTTGTCACA3'. Biological activity of the secreted VEGF(165)was determined by human umbilical vein endothelial cell proliferation and [H(3)] thymidine incorporation assays. Human myoblast preparation was >95% pure with 99% viability after transduction. Immunostaining showed >95% VEGF(165)positive myoblasts. Western blotting and ELISA revealed high VEGF(165)expression in the transduced myoblasts. Maximum transduction efficiency was achieved by 8 h exposure of myoblasts to virus at 1:1,000 ratio on three consecutive days. Concentration of VEGF(165)released in the culture medium peaked (37+/-3 ng/ml) at 8 days post-transduction. Cell proliferation assay on human umbilical vein endothelial cells using supernatant from VEGF(165)transduced myoblasts revealed extensive proliferation of cells which was suppressed in the presence of anti-human VEGF(165)antibody in culture medium and was further confirmed by thymidine incorporation assay. The untransduced myoblasts secreted VEGF165 in vitro (300+/-50 pg/ml) that is enhanced many folds (37+/-3 ng/ml) in VEGF(165)transduced myoblast as determined by ELISA. These studies suggest that human myoblast are potential carriers of human VEGF(165)to achieve concurrent angiomyogenesis for cardiac repair.

8

Cite

Share

Identification of amyloid beta-peptide responsive genes by cDNA microarray technology: Involvement of RTP801 in amyloid beta-peptide toxicity.

Jae Ryong KIM ; Seung Rock LEE ; Hyun Jin CHUNG ; Seongyong KIM ; Suk Hwan BAEK ; Jung Hye KIM ; Yong Sun KIM

Experimental & Molecular Medicine.2003;35(5):403-411.

Amyloid beta-peptide (Abeta), a causative molecule in the pathogenesis of Alzheimer's disease and the main component of senile plaques, is known to be neurotoxic in vitro and in vivo. The mechanisms involved in this Ab-mediated neurotoxicity are not fully understood, although there is evidence to suggest the involvement of oxidative stress, alterations in calcium homeostasis, and/or of CDK activators. Many studies have suggested that Ab may exert its toxic effect via the activation of transcription factors. Therefore, we investigated Ab- responsive genes in human neuroblastoma CHP134 cells using 3.1K human DNA microarrays. Among the several genes overexpressed or repressed by Ab, RTP801, Hi95/sestrin 2, and stanniocalcin 2 were confirmed to be Ab-mediated overexpression in the cells by semiquantitative RT-PCR. Transient expression of the sense RTP801 gene in CHP134 cells increased sensitivity to Abeta cytotoxicity and the expression of the antisense RTP801 gene protected the cells from the Abeta toxicity. These results suggest that RTP801 might play important roles in Abeta toxicity and the pathogenesis of Alzheimer's disease.
Alzheimer Disease/genetics/pathology ; Amyloid beta-Protein/analysis/*toxicity ; Base Sequence ; Cell Line, Tumor ; DNA, Complementary/analysis/genetics ; *Gene Expression Profiling ; Gene Expression Regulation/*drug effects ; Glycoproteins/genetics ; Human ; Molecular Sequence Data ; Nuclear Proteins/genetics ; *Oligonucleotide Array Sequence Analysis ; RNA, Messenger/genetics/metabolism ; Reverse Transcriptase Polymerase Chain Reaction ; Support, Non-U.S. Gov't ; Transcription Factors/*genetics/*metabolism

9

Cite

Share

Genomic organization and expression of parkin in Drosophila melanogaster.

Young Joo BAE ; Kwang Sook PARK ; Soon Ja KANG

Experimental & Molecular Medicine.2003;35(5):393-402.

We report here the isolation, characterization on genomic structure and expression of the D. melanogaster homolog of human parkin. The 2,122 bp parkin gene sequence contains six exons that form a 1,449 bp transcript encoding a protein of 482 amino acids. 151 bp of 5' and 112 bp of 3' untranslated regions were identified by a combination of 5'-RACE/primer extension and 3'-RACE, respectively. The 5' UTR contains three transcription initiation sites. Neither a classical TATA nor a CAAT box was found in the putative promoter sequence. However, binding sites for AhR-Arnt, AP4, NF1 and GATA transcription factors were identified. Transient transfection analysis of the 5' UTR confirmed its promoter activity in HEK 293 cells and SH-SY5Y neuronal cells using a dual luciferase reporting system. The amino acid sequence of D. melanogaster Parkin exhibits 42%, 43% and 43% identity to that of human, mouse and rat, respectively, representing a 54 kDa protein band via western blot analysis. It shows a high degree of conservation in the Ubiquitin-like domain at the N-terminus (34%), the In-Between RING finger domains (IBR, 65-69%), and the RING finger domains at the C-terminus (56-57%). The expression pattern of D. melanogaster parkin varies during the developmental stages, with the highest expression in the adult stage as measured by competitive RT-PCR. From immunostainings of the embryo, D. melanogaster parkin was expressed slightly higher in the central nervous system (brain and nerve cord) during the late embryonic stage.
Amino Acid Sequence ; Animals ; Base Sequence ; Cell Line ; Cloning, Molecular ; Conserved Sequence/genetics ; Drosophila Proteins/*biosynthesis/*genetics ; Drosophila melanogaster/*genetics ; Exons/genetics ; *Gene Expression Regulation, Developmental ; Genomics ; Human ; Introns/genetics ; Molecular Sequence Data ; Promoter Regions (Genetics)/genetics ; RNA, Messenger/genetics/metabolism ; Reverse Transcriptase Polymerase Chain Reaction ; Sequence Alignment ; Sequence Homology, Amino Acid ; Support, Non-U.S. Gov't ; Transcription Initiation Site

10

Cite

Share

B cells activated in the presence of Th1 cytokines inhibit osteoclastogenesis.

Youngnim CHOI ; Jeong Jae KIM

Experimental & Molecular Medicine.2003;35(5):385-392.

Host immune response has been considered as an important disease-modifying factor of periodontitis, however, which immune cell(s) or factor(s) are involved in the destruction of periodontium remains unclear. Previously, we reported that osteoclastogenesis is enhanced by activated B cells but suppressed by activated CD8(+)T cells. We present new data that B cells activated in the presence of Th1 cytokines inhibit osteoclastogenesis. Purified murine B cells were activated with anti-IgD mAb, IL-4, and anti-CD40 mAb, in the absence (B(Th2)) or presence of Th1 cytokines, either IL-2 (B(IL-2)) or IFN-gamma (B(IFN-gamma)). Each activated B cell population was co-cultured with RAW264.7 cells in the presence of soluble receptor activator of NF-kappaB ligand (sRANKL), and the effect on osteoclastic differentiation was evaluated. While B(Th2)increased osteoclastogenesis, B(IL-2)and B(IFN-gamma)suppressed it profoundly. To verify the mediating molecule(s), we analyzed cytokine profiles of the activated B cells. Compared to B(Th2), B(IL-2)expressed increased amount of IFN-gamma and B(IFN-gamma)expressed decreased amounts of IL-4, IL-5, and IL-10. IFN-gamma was a key negative regulator of osteoclastic differentiation, and mediated the inhibition by B(IL-2). These results suggest that Th1 cytokines may have new important roles in resistance to periodontitis, acting directly on osteoclasts or indirectly through B cells.
Animals ; B-Lymphocytes/cytology/*drug effects/immunology ; Base Sequence ; Cell Differentiation/*drug effects ; Cytokines/*pharmacology ; Female ; Giant Cells/cytology/drug effects ; Interferon Type II/immunology/metabolism ; Lymphocyte Activation/*drug effects ; Mice ; Molecular Sequence Data ; Osteoclasts/*cytology/*drug effects ; Phenotype ; Support, Non-U.S. Gov't ; Th1 Cells/*immunology ; Tumor Necrosis Factor/pharmacology

DISPLAY OPTIONS

Cite

Share

Cite

Share

Cite

Share

Cite

Share

Cite

Share

Cite

Share

Cite

Share

Cite

Share

Cite

Share

Cite

Share