This paper summarizes Professor SHI Zaixiang's clinical experience in treating high fever caused by sepsis using Chaihu Guizhi Ganjiang Decoction （柴胡桂枝干姜汤）. He holds that the key pathogenesis of sepsis involves constrained heat in the shaoyang and internal accumulation of water and fluids. The clinical manifestations such as high fever， chills， and alternating sensations of cold and heat are attributed to pathogenic heat constrained in the shaoyang. Meanwhile， soft tissue edema and serous cavity effusions are due to shaoyang dysfunction and internal water retention. In clinical practice， treating sepsis-related high fever requires addressing both the shaoyang-constrained heat and the associated edema and effusions. The therapeutic approach focuses on harmonizing the shaoyang and resolving internal fluids， using Chaihu Guizhi Ganjiang Decoction as the base formula with flexible modifications. Professor SHI emphasizes that this formula shows a rapid antipyretic effect， particularly in cases where multiple anti-infective treatments have failed.

Glutamate-ammonia ligase (GLUL, also known as glutamine synthetase) is a crucial enzyme that catalyzes ammonium and glutamate into glutamine in the ATP-dependent condensation. Although GLUL plays a critical role in multiple cancers, the expression and function of GLUL in gastric cancer remain unclear. In the present study, we have found that the expression level of GLUL was significantly lower in gastric cancer tissues compared with adjacent normal tissues, and correlated with N stage and TNM stage, and low GLUL expression predicted poor survival for gastric cancer patients. Knockdown of GLUL promoted the growth, migration, invasion and metastasis of gastric cancer cells in vitro and in vivo, and vice versa, which was independent of its enzyme activity. Mechanistically, GLUL competed with β-Catenin to bind to N-Cadherin, increased the stability of N-Cadherin and decreased the stability of β-Catenin by alerting their ubiquitination. Furthermore, there were lower N-Cadherin and higher β-Catenin expression levels in gastric cancer tissues compared with adjacent normal tissues. GLUL protein expression was correlated with that of N-Cadherin, and could be the independent prognostic factor in gastric cancer. Our findings reveal that GLUL stabilizes N-Cadherin by antagonizing β-Catenin to inhibit the progress of gastric cancer.

Objective To establish the UPLC fingerprint chromatogram combined with chemometric analysis for the quality evaluation of classical formula Linggui Zhugan Decoction.Methods SHIMADZU Shim-Pack GIST C18 column(100 mm×2.1 mm,2.0 μm)was used with acetonitrile-0.1%phosphoric acid aqueous solution as mobile phase,gradient elution;flow rate was 0.2 mL/min;the detection wavelength was 266 nm for the first 30 minutes and 235 nm for the last 36 minutes;the column temperature was 30℃.The UPLC fingerprint of Linggui Zhugan Decoction was established by Similarity Evaluation System for Chromatographic Fingerprint of TCM(2012.130723 version),and the common peak was determined and the similarity evaluation was carried out.Based on the peak area determination results of the common peak of the fingerprint,the quality of different batches of Linggui Zhugan Decoction was evaluated by chemometrics such as clustering analysis and principal component analysis.Results A total of 24 common peaks were confirmed and 14 components were identified by using reference substances.The similarity of 10 batches of Linggui Zhugan Decoction samples was greater than 0.950,which could be divided into two categories by chemometrics,and the principal component 1-4 were the main factors affecting its quality evaluation.OPLS-DA identified 6 differential markers.Conclusion The fingerprint research method established in the study is simple,reliable and reproducible.Through the method of fingerprint combined with chemometrics analysis,the differences between Linggui Zhugan Decoction from different origins of medicinal materials are identified,which provides a reference for the internal quality evaluation of Linggui Zhugan Decoction.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

In recent years, exosomes had been recognized as a potential cell-free therapeutic tool in the field of regenerative medicine due to their easy accessibility, low immunogenicity, and good therapeutic effect. As paracrine products of cells, exosomes not only have the functions of their donor cells but also involve fewer ethical disputes. They are more stable than traditional stem cell therapy, and easy to store, transport and sterilize, which are gradually applied in the field of oral regenerative medicine. This article provides a review of the general properties of exosomes and their application in the field of oral regeneration, with a view to exploring new pathways for functional regeneration of the stomatognathic system.

Objective By observing the effects of"three methods and three points"tuina technique on the expression of interleukin-17F(IL-17F),interleukin-17 receptor C(IL-17RC),activator 1 of nuclear transcription factor-κB(Act1),tumour necrosis factor receptor-associated factor 6(TRAF6)and M1 microglial cell expression in the spinal dorsal horn of rats with mild chronic compressive injury(minor CCI)model,we explored the immediate analgesic mechanism of tuina on peripheral neuropathic pain(pNP).Methods Thirty-six SD rats were divided into the sham group,the model group and the tuina group according to the random number method,twelve rats in each group,and the minor CCI model was replicated by ligating the right sciatic nerve.The rats in the tuina group were subjected to pointing,plucking and kneading at the BL37,BL57 and GB34 points on the affected side using a tuina simulator,while the sham group and the model group were only grasped and restrained,and were intervened for one time.The mechanical pain test and cold plate test were used to evaluate the response of rats to mechanical stimulation and cold stimulation after immediate intervention.The protein expression of IL-17F and TRAF6 in the spinal dorsal horn of rats in each group was detected by Western blotting.The mRNA expression of IL-17F,IL-17RC,Act1 and TRAF6 in the spinal dorsal horn of rats in each group was detected by real-time PCR.The average fluorescence intensity of M1 microglia in the spinal dorsal horn of rats in each group was detected by immunofluorescence.Results Behavioral results showed that before intervention,compared with the sham group,paw mechanical withdraw threshold(PMWT)decreased and cold sensitivity threshold(CST)increased in the model group and the tuina group;after tuina intervention,PMWT in the tuina group was increased,and CST was decreased compared with the model group;after intervention,PMWT in the tuina group was increased,while CST was decreased(P＜0.05).RT-PCR results showed that compared with the sham group,mRNA expression levels of IL-17F,IL-17RC,TRAF6 and Act1 in the spinal dorsal horn of the model group were increased;compared with model group,the mRNA expression levels of above indexes in the tuina group were decreased(P＜0.05).Western boltting results showed that compared with the sham group,the expression levels of IL-17F and TRAF6 protein in the spinal dorsal horn of the model group were increased;compared with the model group,the expression levels of IL-17F and TRAF6 protein in the tuina group decreased(P＜O.05).Immunofluorescence results showed that the mean fluorescence intensity of CD40 in the spinal dorsal horn of model group was enhanced compared with the sham group;compared with the model group,the mean fluorescence intensity of CD40 in the tuina group was decreased(P＜0.05).Conclusion The"three methods and three points"tuina technique can produce immediate analgesia by inhibiting the expression of IL-17F,IL-17RC,Act1,TRAF6 and the activation of M1 microglia in the dorsal horn of the spinal cord after one intervention.

Objective:To compare the therapeutic effects of partial nephrectomy (PN) and cryoablation (CA) in patients with stage cT 1N 0M 0 renal cell carcinoma (RCC). Methods:A retrospective analysis was conducted on clinical data of patients with stage cT 1N 0M 0 RCC who underwent CA and PN treatment at The First Affiliated Hospital of Naval Medical University and Shanghai Ninth People's Hospital between March 2011 and December 2019. There were 50 cases in the CA group (36 from The First Affiliated Hospital of Naval Medical University and 14 from the Shanghai Ninth People's Hospital), and 1 323 cases in the PN group (all from The First Affiliated Hospital of Naval Medical University). PN included open surgery, laparoscopic surgery, or robotic surgery performed under general anesthesia through the abdominal or retroperitoneal approach. CA included laparoscopic surgery under general anesthesia and percutaneous treatment guided by CT or ultrasound under local anesthesia. Propensity score matching was performed based on baseline data of the patients to obtain balanced samples between the two groups using a 1∶2 nearest-neighbor matching method. After matching, comparisons were made between the two groups in terms of perioperative conditions, overall survival (OS), and recurrence-free survival (RFS). Results:After PSM, patient distributions were closely balanced in baseline data such as gender (male/female: 28/19 cases in CA group and 58/36 cases in PN group), age [66.0(53.0, 75.0) years vs. 59.5(50.0, 69.3) years], body mass index[ (24.1 ± 6.4) kg/m 2 vs. (24.1 ± 3.1) kg/m 2], Charlson comorbidity index [1(0, 2) vs. 1(0, 2)], history of malignant tumors [19.1% (9/47) vs. 17.0% (16/94)], preoperative estimated glomerular filtration rate (eGFR) [85.2(65.5, 97.1) ml/(min·1.73m 2) vs. 87.0(73.4, 100.4) ml/(min·1.73m 2)], and R. E.N.A.L. score [6(5, 7) vs. 7(6, 8)] between CA(n=47) and PN(n=94) group. There were significant differences in operative time [97.5(81.2, 117.5) min vs. 145.0(110.2, 185.0) min, P<0.001], estimated blood loss [85.0(50.0, 100.0) ml vs. 100.0(75.0, 200.0)ml, P=0.021], length of hospital stay [3.0(2.0, 4.0) days vs. 7.6(5.0, 9.0) days, P<0.001] between the CA and the PN group. No significant differences were observed in the incidence of postoperative complications [4.3% (2/47) vs. 5.3% (5/94), P=0.784], the eGFR within one week after surgery [83.7(65.6, 106.6) ml/(min·1.73m 2) vs. 83.2(66.7, 97.7) ml/(min·1.73m 2), P=0.645], the median follow-up time [ 93 (67, 126) months vs. 85 (68, 139) months, P=0.955], the RFS rate[81.8% vs. 96.8%, P=0.074], or the OS rate [85.7% vs. 97.8%, P=0.190] between the CA and the PN group. Conclusions:For patients with cT 1N 0M 0 stage RCC, CA and PN demonstrate comparable oncologic treatment efficacy, while CA offering the advantages of shorter surgical time, shorter hospital stay, and less blood loss.

Focal therapy for renal cell carcinoma is a precision treatment technique that directly targets and destroys cancerous lesions while preserving the maximum amount of surrounding healthy kidney tissue through localized intervention. It is primarily indicated for early-stage renal cell carcinoma in patients with tumors ≤4 cm in diameter (T 1a), particularly for those at higher surgical risk. Compared to traditional radical nephrectomy and partial nephrectomy, focal therapy offers several advantages, including lower physical demands on the patient, minimally invasive nature, reduced risk of complications, and faster recovery. The focal therapy techniques currently utilized in clinical practice include cryoablation, radiofrequency ablation, microwave ablation, irreversible electroporation, high-intensity focused ultrasound, and stereotactic body radiotherapy. This article reviews the principles of various focal therapy techniques, patient selection, and the oncological outcomes, complications, and renal function preservation associated with these focal therapies.

In order to study the biological characteristics and whole-genome sequence of Streptococ-cus equi,a sheep-derived Streptococcus equi preserved in our laboratory was subjected to recovery,biochemical experiments,drug susceptibility tests and animal experiments,and followed by whole genome sequencing and annotation of the gene functions of the genome by using the biogenetic da-tabase.The biochemical identification results showed that this strain could ferment sugars,but the results of nitrate,catalase,V-P test,and M-R test were negative;the drug susceptibility test results showed that this strain was highly sensitive to most antibiotics and was resistant to kanaphylaxis.It was resistant to amikacin and amikacin;animal experiments showed that the lethality rate of this strain to mice was 100％,and the median lethal dose of this strain was measured to be 4.86X 106 CFU/kg.According to the pathological section results of mice,it showed that the lungs,liver,kidneys,and spleen all had varying degrees of lesions.The whole genome sequencing results showed that the total genome length of this strain is 2 272 497 bp,the G+C content was 41.1％,and it was predicted to contain 2 124 CDS regions.The RNA prediction results showed that the number of rRNA and tRNA was 15,and the number of tRNA was 57.There were four prophages and gene islands,and there were 362 pathogenicity-related genes in the VFDB database without CRISPR sequences.This study analyzed the complete genome of Streptococcus equi derived from sheep,and also provided a theoretical basis for the treatment,prevention and control of the disease.

Objective:To explore the regulatory mechanism of α-synuclein in the degradation of autophagy-lysosome pathway(ALP) in Parkinson disease(PD) model cells after interference or overexpression of dynein heavy chain(Dynhc) gene.Methods:SH-SY5Y cells were divided into control group, PD group, Dynhc interference group, Dynhc overexpression group, and Dynhc interference+ rapamycin group according to experimental requirements.Using Western blot to detect Dynhc, α-synuclein, microtubule-associated protein l light chain 3 (LC3), lysosome-associated membrane protein 2 (LAMP2), tubulin, dynein activator protein p150, and kinesin KIF5B.Flow cytometry was used to detect the level of cell apoptosis.Immunoconfocal microscopy was used to observe the structure of tubulin and the co-localization of LC3 and LAMP.SPSS 23.0 software was used for statistical analysis.One-way ANOVA was used for inter group comparisons, and further pairwise comparisons were conducted by LSD- t test. Results:There were statistically significant differences in the expression of α-synuclein, autophagy-related proteins, microtubules, and microtubule-related proteins among cells in the 5 groups(all P<0.001). The protein expression levels of Dynhc, α-synuclein, LC3, LAMP2, p150, and KIF5B in the PD group were higher than those in the control group (all P<0.05). The protein levels of Dynhc, LAMP2, tubulin and p150 in the Dynhc interference group were lower than those in the PD group (all P<0.05), while the protein levels of α-synuclein, LC3 and KIF5B were higher than those in the PD group (all P<0.05). The protein levels of α-synuclein, LC3, and KIF5B in the Dynhc overexpression group were lower than those in the PD group (all P<0.05), while the protein levels of Dynhc, LAMP2 and p150 were higher than those in the PD group (all P<0.05). The protein level of LC3 in the Dynhc interference+ rapamycin group was higher than that in the Dynhc interference group ( P<0.05). There were no statistically significant differences in the protein levels of Dynhc, α-synuclein, LAMP2, microtubule protein, p150 and KIF5B compared to the Dynhc interference group (all P>0.05). Compared with the control group, the cell apoptosis rate in PD group increased((12.77±1.66)%, (7.64±1.45)%), the microtubule morphology remained unchanged, and autophagosomes fused more with lysosomes. Compared with the PD group, the cell apoptosis rate of Dynhc overexpression group decreased, and there was no significant change in microtubule structure, and there was more fusion between autophagosomes and lysosomes.Compared with the PD group, the cell apoptosis rat of Dynhc interference group increased((18.45±1.91)%), and the microtubule morphology was sparse, and there was less fusion between autophagosomes and lysosomes. Compared with the PD group, the Dynhc overexpression group showed a decrease in cell apoptosis rate ((9.95±1.56)%), no significant changes in microtubule structure, and more fusion between autophagosomes and lysosomes.Compared with the Dynhc interference group, the Dynhc interference+ rapamycin group showed no significant changes in cell apoptosis rate ((19.05±2.46)%), microtubule morphology, and fusion of autophagosomes and lysosomes. Conclusion:Dynhc can reduce cell apoptosis by enhancing cell ALP function, increasing the degradation of α-synuclein and maintaining of microtubule structure integrity.