OBJECTIVE To explore the association between the use of oral progesterone drugs in early pregnancy and gestational diabetes mellitus （GDM）. METHODS Through real-world retrospective cohort research method， pregnant women who underwent the oral glucose tolerance test （OGTT） at the Affiliated Maternal and Child Health Hospital of Nantong University between January 2022 and January 2023 were enrolled. Based on whether oral progesterone drugs were used in early pregnancy， they were divided into treatment group and control group； propensity score matching （PSM） with a 1∶1 ratio was employed to control for confounding factors； Logistic regression and linear regression were employed to analyze the association between drug factors （whether use of oral progesterone drug， duration of medication， dosage， and drug type） and outcome indicators （occurrence of GDM， fasting blood glucose levels， and OGTT 1 and 2 h blood glucose levels in late pregnancy）. RESULTS A total of 709 pregnant women were enrolled in the two groups before PSM； after PSM， 256 cases were included in both the treatment group and the control group. The results of association analysis indicated that there was no significant association between the use of oral progesterone drugs and GDM （P＞0.05）； but a significant correlation was found with OGTT 1 h blood glucose levels [β＝0.965， 95%CI （0.007，1.922）， P＜0.05]， specifically with Dydrogesterone tablets [β＝0.977， 95%CI （0.009， 1.944）， P＜0.05] and Progesterone soft capsules [β ＝1.089， 95%CI （0.077， 2.102）， P＜0.05]. There was no significant correlation between other drug factors and outcome indicators （P＞0.05）. CONCLUSIONS The use of oral progestogen drugs in early pregnancy is not significantly associated with GDM. The blood glucose levels in late pregnancy， especially OGTT 1 h blood glucose levels， have a certain correlation with Progesterone soft capsules and Dydrogesterone tablets.

Panax species are mostly valuable medicinal plants. While some species' seeds are sensitive to dehydration, the dehydration tolerance of seeds from other Panax species remains unclear. The phospholipase D(PLD) gene plays an important role in plant responses to dehydration stress. However, the characteristics of the PLD gene family and their mechanisms of response to dehydration stress in seeds of Panax species with different dehydration tolerances are not well understood. This study used seeds from eight Panax species to measure the germination rates and PLD activity after dehydration and to analyze the correlation between dehydration tolerance and seed traits. Bioinformatics analysis was also conducted to characterize the PnPLD and PvPLD gene families and to evaluate their expression patterns under dehydration stress. The dehydration tolerance of Panax seeds was ranked from high to low as follows: P. ginseng, P. zingiberensis, P. quinquefolius, P. vietnamensis var. fuscidiscus, P. japonicus var. angustifolius, P. japonicus, P. notoginseng, and P. stipuleanatus. A significant negative correlation was found between dehydration tolerance and seed shape(three-dimensional variance), with flatter seeds exhibiting stronger dehydration tolerance(r=-0.792). Eighteen and nineteen PLD members were identified in P. notoginseng and P. vietnamensis var. fuscidiscus, respectively. These members were classified into five isoforms: α, β, γ, δ, and ζ. The gene structures, subcellular localization, physicochemical properties, and other characteristics of PnPLD and PvPLD were similar. Both promoters contained regulatory elements associated with plant growth and development, hormone responses, and both abiotic and biotic stress. During dehydration, the PLD enzyme activity in P. notoginseng seeds gradually increased as the water content decreased, whereas in P. vietnamensis var. fuscidiscus, PLD activity first decreased and then increased. The expression of PLDα and PLDδ in P. notoginseng seeds initially increased and then decreased, whereas in P. vietnamensis var. fuscidiscus, the expression of PLDα and PLDδ consistently decreased. In conclusion, the dehydration tolerance of Panax seeds showed a significant negative correlation with seed shape. The dehydration tolerance in P. vietnamensis var. fuscidiscus and dehydration sensitivity of P. notoginseng seeds may be related to differences in PLD enzyme activity and the expression of PLDα and PLDδ genes. This study provided the first systematic comparison of dehydration tolerance in Panax seeds and analyzed the causes of tolerance differences and the optimal water content for long-term storage at ultra-low temperatures, thus providing a theoretical basis for the short-term and ultra-low temperature long-term storage of medicinal plant seeds with varying dehydration tolerances.
Seeds/metabolism* ; Panax/physiology* ; Plant Proteins/metabolism* ; Gene Expression Regulation, Plant ; Phospholipase D/metabolism* ; Plants, Medicinal/enzymology* ; Germination ; Multigene Family ; Water/metabolism* ; Dehydration ; Phylogeny

In recent years, the study of single-cell transcriptome sequencing technology in the heterogeneity of astrocytes (astrocytes) after spinal cord injury (SCI) has provided new perspectives on post-traumatic nerve regeneration and repair. To provide a review on the research progress of single-cell sequencing technology in astrocytes after spinal cord injury (SCI), and to more comprehensively and deeply elaborate the application of single-cell sequencing technology in the field of astrocytes after SCI. Single-cell sequencing technology can analyse the transcriptomes of individual cells in a high-throughput manner, thus revealing fine differences in cell types and states. By using single-cell sequencing technology, the heterogeneity of astrocytes after SCI and their association with nerve regeneration and repair were revealed. In conclusion, the application of single-cell sequencing technology provides an important tool to reveal the heterogeneity of astrocytes after SCI, to further explore the mechanisms of astrocytes in SCI, and to develop intervention strategies targeting their regulatory mechanisms in order to improve the therapeutic efficacy of SCI. The discovery of changes in astrocyte transcriptome dynamics has improved researchers' understanding of spinal cord injury lesion progression and provided new insights into the treatment of spinal cord injury at different time points. To date, all of these findings need to be validated by more basic research and sufficient clinical trials. In the future, single-cell sequencing technology, through interdisciplinary collaboration with bioinformatics, computer science, tissue engineering, and clinical medicine, is expected to open a new window for the treatment of spinal cord injury.
Spinal Cord Injuries/metabolism* ; Astrocytes/cytology* ; Single-Cell Analysis/methods* ; Humans ; Animals ; Transcriptome ; Nerve Regeneration

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Schizophrenia (SZ) stands as a severe psychiatric disorder. This study applied diffusion tensor imaging (DTI) data in conjunction with graph neural networks to distinguish SZ patients from normal controls (NCs) and showcases the superior performance of a graph neural network integrating combined fractional anisotropy and fiber number brain network features, achieving an accuracy of 73.79% in distinguishing SZ patients from NCs. Beyond mere discrimination, our study delved deeper into the advantages of utilizing white matter brain network features for identifying SZ patients through interpretable model analysis and gene expression analysis. These analyses uncovered intricate interrelationships between brain imaging markers and genetic biomarkers, providing novel insights into the neuropathological basis of SZ. In summary, our findings underscore the potential of graph neural networks applied to multimodal DTI data for enhancing SZ detection through an integrated analysis of neuroimaging and genetic features.
Humans ; Schizophrenia/pathology* ; Diffusion Tensor Imaging/methods* ; Male ; Female ; Adult ; Brain/metabolism* ; Young Adult ; Middle Aged ; White Matter/pathology* ; Gene Expression ; Nerve Net/diagnostic imaging* ; Graph Neural Networks

Objective:To investigate the concern about pollen broadcasting in Chinese population from multiple dimensions and to understand the information about allergic rhinitis (AR) in China by analyzing related factors.Methods:From March 1 to September 30, 2022, a large-scale multi-center cross-sectional survey was conducted based on the Questionnaire Star platform in 21 Chinese hospitals. A total of 7 056 subjects from 7 regions in China: Northeast, North, East, Central, South, Southwest, and Northwest China were included. Basic characteristics (including social demographic characteristics and disease characteristics of AR patients), concern about pollen broadcasting, the willingness of pollen-induced AR (PiAR) patients to receive pollen broadcasting, and the treatment satisfaction rate of AR patients were collected. The chi-square test, multivariate linear regression model, and Logistic regression analysis were used to analyze the concern about pollen broadcasting in the Chinese population and related factors from multiple dimensions.Results:Among 7 056 subjects, 23.02% were concerned about pollen broadcasting. Among 3 176 self-reported AR and 1 019 PiAR patients, 25.60% and 39.16% were concerned about pollen broadcasting, respectively, which was higher than that of non-AR or non-PiAR subjects ( χ2 value was 21.74 and 175.11, respectively, both P<0.001). Among AR patients, the proportion of spring and autumn allergen-positive patients concerned about pollen broadcasting was higher than that in perennial allergen-positive patients ( χ2 value was 20.90 and 19.51, respectively, both P<0.001). The proportion of AR patients with asthma, sinusitis, allergic conjunctivitis, and cardiovascular and cerebrovascular diseases was higher than those without complications ( χ2 value was 50.83, 21.97, 56.78, 7.62, respectively, all P<0.05). The proportion of AR patients in North China who could find pollen broadcasting locally was 31.01%, significantly higher than those in other regions (all P<0.05). Multivariate linear regression model analysis showed that among PiAR patients, those with higher per capita household income and higher AR disease cognition levels had been concerned about pollen broadcasting in the past, and those complicated with allergic conjunctivitis had stronger intention to receive pollen broadcasting (B value was 0.24, 0.13, 0.66, 0.47, respectively, all P<0.05). The higher the disease cognition level of PiAR patients, the stronger their willingness to actively participate in treatment ( R2=0.72, P<0.001). Only 18.89% of AR patients felt satisfied with the treatment effect. Logistic regression analysis showed that in AR patients, the treatment satisfaction rate was significantly higher among those concerned about pollen broadcasting compared to those who were not ( OR=1.83, P<0.001). Conclusions:Currently, the dissemination of pollen broadcasting in China is hindered by various factors such as disease cognition level. The treatment satisfaction among AR patients remains unsatisfactory.

Patients with severe trauma require an extremely timely treatment and transfusion plays an irreplaceable role in the emergency treatment of such patients. An increasing number of evidence-based medicinal evidences and clinical practices suggest that patients with severe traumatic bleeding benefit from early transfusion of low-titer group O whole blood or hemostatic resuscitation with red blood cells, plasma and platelet of a balanced ratio. However, the current domestic mode of blood supply cannot fully meet the requirements of timely and effective blood transfusion for emergency treatment of patients with severe trauma in clinical practice. In order to solve the key problems in blood supply and blood transfusion strategies for emergency treatment of severe trauma, Branch of Clinical Transfusion Medicine of Chinese Medical Association, Group for Trauma Emergency Care and Multiple Injuries of Trauma Branch of Chinese Medical Association, Young Scholar Group of Disaster Medicine Branch of Chinese Medical Association organized domestic experts of blood transfusion medicine and trauma treatment to jointly formulate Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients ( version 2024). Based on the evidence-based medical evidence and Delphi method of expert consultation and voting, 10 recommendations were put forward from two aspects of blood support mode and transfusion strategies, aiming to provide a reference for transfusion resuscitation in the emergency treatment of severe trauma and further improve the success rate of treatment of patients with severe trauma.

Objective:To study the mechanism of icariin inhibiting the proliferation of human PCa PC-3 cells based on cell metabolomics technology.Methods:We determined the proliferation activity of human PC-3 cells by methyl thiazolyl tetrazolium(MTT)assay,and compared the proliferation of the PC-3 cells among the control,5-fluorouracil and icariin intervention groups.Using the Bligh Dyer method,we extracted endogenous metabolites from the cells,analyzed the metabolic profile by ultra-high pressure liquid chromatography tandem quadrupole time-of-flight mass spectrometry,identified the differential metabolites by principal component anal-ysis and orthogonal partial least-squares discrimination analysis,and enriched the metabolic pathways based on the MetaboAnalyst data-base.Results:Icariin significantly inhibited the proliferation of human PCa PC-3 cells.A total of 89 differential metabolites were i-dentified,mainly including amino acids,phosphatidylcholine,phosphatidylethanolamine,lysophosphatidylcholine,and lysophosphati-dylethanolamine,all with the tendency to return to the normal level after icariin intervention.Icariin significantly downregulated the metabolic levels of the glycerophospholipid metabolites phosphatidylcholine,phosphatidylethanolamine,lysophosphatidylcholine and ly-sophosphatidylethanolamine,and upregulated those of amino acid metabolites tryptophan,leucine,and proline in the PC-3 cells.Conclusion:Icariin inhibits the proliferation of human PCa PC-3 cells,which may be closely related to its regulatory effect on lipid metabolism(glycerophospholipid metabolism)and amino acid metabolism.

Objective:To analyze the clinical characteristics,treatment,and prognosis of adult patients with early T-cell precursor acute lymphoblastic leukemia/lymphoma(ETP-ALL/LBL).Methods:Clinical data of 113 T lymphoblastic leukemia/lymphoma(T-ALL/LBL)patients from January 2006 to January 2019 were collected from three hematology research centers,including Peking University Third Hospital,the First Medical Center of Chinese PLA General Hospital and Institute of Hematology and Blood Diseases Hospital,Chinese Medical University.The clinical characteristics and prognosis of ETP-ALL/LBL patients were analyzed compared with non-ETP-ALL/LBL patients.Results:In 113 T-ALL/LBL patients,13 cases(11.5％)were diagnosed as ETP-ALL/LBL,including 11 males,with a median age of 28(18-53)years.Compared with non-ETP-ALL/LBL patients,there were no significant differences in age,sex,incidence of large mediastinal mass,clinical stage,international prognostic index(IPI)score,white blood cell(WBC)count and lactate dehydrogenase(LDH)level among ETP-ALL/LBL patients.Among 13 ETP-ALL/LBL patients,9 cases(69.2％)achieved complete remission(CR),and there was no statistically significant difference in response rate induced by chemotherapy between ETP-ALL/LBL patients and non-ETP-ALL/LBL patients.Among patients who received chemotherapy without allogeneic hematopoietic stem cell transplantation(allo-HSCT),ETP-ALL/LBL group had a worse 5-year overall survival(OS)rate compared with non-ETP-ALL/LBL group(0 vs 7.1％,P=0.008),while in patients with allo-HSCT,there was no significant difference for 5-year OS rate between the two group(37.5％vs 40.2％,P＞0.05).Multivariate Cox regression analysis showed that CR after induction therapy,allo-HSCT,and LDH level were independent prognostic factors affecting T-ALL/LBL patients.Conclusion:No significant difference in response rate induced by chemotherapy is observed between ETP-ALL/LBL and non-ETP-ALL/LBL patients.Allo-HSCT consolidation after induction of remission therapy may have significant favorable influence on OS for patients with ETP-ALL/LBL.