Objective: To evaluate the comprehensive intervention effect of lunch for primary and secondary school students in Minhang District, so as to provide a theoretical and practical basis for lunch intervention in school. Methods: From October to December 2023, a convenience sampling method was used to select 1 937 students from one primary and secondary school in Minhang District.A comprehensive intervention measure focusing on "reducing oil and salt" for lunch recipe optimization and nutrition education was carried out, and a questionnaire survey was conducted to evaluate the intervention effect three months later. Chi square test and Wilcoxon rank test were used to compare the data before and after the intervention. Results: After intervention, the use of cooking oil and salt, the supply of protein and fat in primary and secondary school lunches were reduced, and had no obvious impact on energy and other major nutrients. After intervention, compared to before intervention, the proportion of primary school students who felt that lunch was greasy decreased (8.9%, 6.2%, χ 2=4.35), and the proportion of primary and secondary school students who felt that lunch were delicious decreased significantly (33.2%, 23.2%; 63.9%, 53.5%, χ 2=26.39, 17.52) ( P < 0.05 ). Secondary school students also felt reduced variety of food ingredients (46.9%, 38.3%, χ 2=16.05, P <0.05). In addition, after intervention, the total surplus rate of primary school students meals decreased (7.4%, 4.4%, χ 2=5.73), mainly reflected in the decrease of the surplus rate of staple foods (7.1%, 2.4%, χ 2=17.39), while the surplus rate of vegetable dishes increased ( 16.0 %, 21.2%, χ 2=6.01) ( P <0.05). Although there was no significant change in the total surplus rate of meals for secondary school students, the surplus rate of staple foods decreased (12.9%, 5.4%, χ 2=33.52), while the surplus rates of meat and vegetable dishes increased (11.2%, 26.9%; 17.5%, 33.2%, χ 2=74.26, 61.88) ( P <0.05). After intervention, there was no statistically significant difference in the overweight and obesity rates of primary school students ( χ 2=0.11,0.43) and secondary school students ( χ 2=0.01,0.00) compared to before intervention( P >0.05). After intervention, the lung capacity of primary school students [1 564 (1 269,1 890) mL] and sitting forward flexion [11.3 (7.6, 15.2) cm] increased compared to before intervention [1 522 (1 259, 1 819 ) mL, 10.5 (6.3, 13.5) cm] ( Z =2.20, 4.68, P <0.01), but there was no statistically significant difference in lung capacity and sitting forward flexion of secondary school students before and after intervention ( Z =-0.46, -0.08, P >0.05). Conclusion The comprehensive intervention of school lunch has promoted a significant decrease in the use of oil and salt in lunch and improved the quality of recipes, and has a positive impact on the situation of leftover lunch and the health of students to a certain extent.

Exercise-induced metabolic remodeling is a fundamental adaptive process whereby the body reorganizes systemic and cellular metabolism to meet the dynamic energy demands posed by physical activity. Emerging evidence reveals that such remodeling not only enhances energy homeostasis but also profoundly influences immune function through complex molecular interactions involving glucose, lipid, and protein metabolism. This review presents an in-depth synthesis of recent advances, elucidating how exercise modulates immune regulation via metabolic reprogramming, highlighting key molecular mechanisms, immune-metabolic signaling axes, and the authors’ academic perspective on the integrated “exercise-metabolism-immunity” network. In the domain of glucose metabolism, regular exercise improves insulin sensitivity and reduces hyperglycemia, thereby attenuating glucose toxicity-induced immune dysfunction. It suppresses the formation of advanced glycation end-products (AGEs) and interrupts the AGEs-RAGE-inflammation positive feedback loop in innate and adaptive immune cells. Importantly, exercise-induced lactate, traditionally viewed as a metabolic byproduct, is now recognized as an active immunomodulatory molecule. At high concentrations, lactate can suppress immune function through pH-mediated effects and GPR81 receptor activation. At physiological levels, it supports regulatory T cell survival, promotes macrophage M2 polarization, and modulates gene expression via histone lactylation. Additionally, key metabolic regulators such as AMPK and mTOR coordinate immune cell energy balance and phenotype; exercise activates the AMPK-mTOR axis to favor anti-inflammatory immune cell profiles. Simultaneously, hypoxia-inducible factor-1α (HIF-1α) is transiently activated during exercise, driving glycolytic reprogramming in T cells and macrophages, and shaping the immune landscape. In lipid metabolism, exercise alleviates adipose tissue inflammation by reducing fat mass and reshaping the immune microenvironment. It promotes the polarization of adipose tissue macrophages from a pro-inflammatory M1 phenotype to an anti-inflammatory M2 phenotype. Moreover, exercise alters the secretion profile of adipokines—raising adiponectin levels while reducing leptin and resistin—thereby influencing systemic immune balance. At the circulatory level, exercise improves lipid profiles by lowering pro-inflammatory free fatty acids (particularly saturated fatty acids) and triglycerides, while enhancing high-density lipoprotein (HDL) function, which has immunoregulatory properties such as endotoxin neutralization and macrophage cholesterol efflux. Regarding protein metabolism, exercise triggers the expression of heat shock proteins (HSPs) that act as intracellular chaperones and extracellular immune signals. Exercise also promotes the secretion of myokines (e.g., IL-6, IL-15, irisin, FGF21) from skeletal muscle, which modulate immune responses, facilitate T cell and macrophage function, and support immunological memory. Furthermore, exercise reshapes amino acid metabolism, particularly of glutamine, arginine, and branched-chain amino acids (BCAAs), thereby influencing immune cell proliferation, biosynthesis, and signaling. Leucine-mTORC1 signaling plays a key role in T cell fate, while arginine metabolism governs macrophage polarization and T cell activation. In summary, this review underscores the complex, bidirectional relationship between exercise and immune function, orchestrated through metabolic remodeling. Future research should focus on causative links among specific metabolites, signaling pathways, and immune phenotypes, as well as explore the epigenetic consequences of exercise-induced metabolic shifts. This integrated perspective advances understanding of exercise as a non-pharmacological intervention for immune regulation and offers theoretical foundations for individualized exercise prescriptions in health and disease contexts.

Abstract： ObjectiveThe study aims to explore the effects and regulatory roles of glucose transporter 1 （GLUT1） on the proliferation， migration， adhesion， and angiogenesis of human umbilical vein endothelial cells （HUVECs） under ischemia-hypoxic conditions. MethodsIn vitro experiments were conducted to subject HUVECs to an ischemia-hypoxic-mimicking environment （1% O₂， 5% CO₂， 94% N₂）. The biological characteristics of HUVECs under normoxic and ischemia-hypoxic conditions were compared by assessing cell viability， proliferation capacity， and examining the expression changes of GLUT1， HIF-1α， and VEGFA proteins under ischemia-hypoxia using Western blot technology. Further， GLUT1 was overexpressed using plasmid transfection and the proliferation， migration， adhesion， and angiogenic capabilities of HUVECs were evaluated through scratch assays， cell adhesion assays， and tube formation assays. Mitochondrial morphological changes were observed by transmission electron microscopy，and oxygen consumption rate （OCR） was detected by Seahorse metabolic analyzer to evaluate mitochondrial function. ResultsCompared with normoxic conditions， the ischemia-hypoxic environment significantly inhibited the proliferation， cell viability， migration， and adhesion capabilities of HUVECs and impaired their angiogenic potential. The expression levels of GLUT1， HIF-1α and VEGFA proteins were also markedly reduced. However， when GLUT1 expression was upregulated， the migration， adhesion， and angiogenic capabilities of HUVECs were significantly improved， and the protein expression levels of HIF-1α， VEGFA and VEGFR were increased. Transmission electron microscopy revealed that ischemic-hypoxia leads to mitochondrial swelling and matrix damage， while GLUT1 overexpression significantly alleviates mitochondrial morphology abnormalities. OCR results suggest that GLUT1 overexpression may enhance oxidative phosphorylation of endothelial cells in ischemic-hypoxic environments to improve energy metabolism. These results suggest that GLUT1 may influence the function and angiogenic potential of HUVECs by regulating glucose metabolism and energy supply. ConclusionsThis study reveals the significant regulatory role of GLUT1 in the function of HUVECs under ischemia-hypoxic conditions， potentially through modulating cellular energy metabolism and signal transduction pathways， thereby affecting cell proliferation， migration， adhesion， and angiogenesis. These findings provide a new perspective on the role of GLUT1 in cardiovascular diseases and may offer potential targets for the development of new therapeutic strategies.

ObjectiveTo observe the antidepressant effect of Chaihu Shugansan combined with ferulic acid on the rat model of chronic unpredictable mild stress （CUMS） and explore the mechanism from the histomorphology of frontal cortex， expression of key molecules in the brain-derived neurotrophic factor （BDNF）/tyrosine kinase receptor B （TrkB） signaling pathway， and changes in monoamine neurotransmitter levels. MethodsSixty adult male SD rats were randomized into six groups （n=10）： blank control， depression model， Chaihu Shugansan （3.3 g·kg^-1·d^-1）， ferulic acid （50 mg·kg^-1·d^-1）， Chaihu Shugansan （3.3 g·kg^-1·d^-1） + ferulic acid （50 mg·kg^-1·d^-1）， and fluoxetine （2.1 mg·kg^-1·d^-1）. Rats in other groups except the blank control group were subjected to a mild chronic unpredictable stress stimulus every day. Seven stimuli were used， including fasting with free access to water for 24 h， water deprivation with free access to food for 24 h， wetting the bedding with water in the cage， restraint for 3 h， tail clamping for 1 min， swimming in ice water at 4 ℃， and day and night reversal. Each stimulus was used 1 to 3 times， and the modeling lasted for a total of 21 days. At the same time of stimulation， rats in each medication group were treated with corresponding agents by gavage， while those in the blank control group and the depression model group received equal volumes of normal saline by gavage. The open field test， sucrose preference test， and forced swimming test were conducted before and after modeling. The rats were anesthetized by intraperitoneal injection of 3% pentobarbital sodium， and the frontal cortex was isolated on ice. The mRNA and protein levels of BDNF， TrkB， and cyclic adenosine monophosphate-responsive element-binding protein （CREB） in the frontal cortex were determined by Real-time fluorescence quantitative polymerase chain reaction （Real-time PCR） and Western blot， respectively. The levels of monoamine neurotransmitters 5-hydroxytryptamine （5-HT）， dopamine （DA）， and norepinephrine （NE） in the frontal cortex were determined by enzyme-linked immunosorbent assay. Light microscopy was employed to observe the histopathological changes in the frontal cortex. ResultsCompared with the blank control group， the depression model group showed reduced body mass （P<0.05， P<0.01）， decreased number of crossings and rearings in the open field test and sucrose preference （P<0.01）， prolonged time of immobility in the forced swimming test （P<0.01）， reduced neuronal cells， increased necrotic cells， and darkening cell staining in the frontal cortex， down-regulated mRNA and protein levels of BDNF， TrkB， CREB， and lowered levels of 5-HT， NE， and DA in the frontal cortex （P<0.01）. Compared with the depression model group， each intervention group showed improved general state， increased body mass （P<0.05）， increased number of crossings （P<0.05）， shortened immobility time in the forced swimming test （P<0.01）， increased neuronal cells， reduced necrotic cells， and lightened cellular staining in the frontal cortex， up-regulated mRNA and protein levels of BDNF， TrkB and CREB， and elevated levels of 5-HT， NE， and DA in the frontal cortex （P<0.01）. Moreover， the Chaihu Shugansan + ferulic acid group outperformed the Chaihu Shugansan group and the ferulic acid group in increasing the body mass and the 5-HT content in the frontal cortex （P<0.05）. The combination group outperformed the Chaihu Shugansan group regarding the number of rearings and up-regulation in the mRNA level of BDNF in the frontal cortex （P<0.05）， and it was superior to the ferulic acid group in terms of shortening the immobility time in the forced swimming test， up-regulating the mRNA levels of BDNF， TrkB， and CREB and the protein levels of BDNF and CREB in the frontal cortex， and increasing the DA content in the frontal cortex （P<0.05）. ConclusionChaihu Shugansan combined with ferulic acid can exert antidepressant effect on the rat model of CUMS by regulating the BDNF/TrkB signaling pathway and monoamine neurotransmitter content in the frontal cortex. Moreover， the antidepressant effect of Chaihu Shugansan combined with ferulic acid was more significant than that of Chaihu Shugansan and ferulic acid used alone.

Objective: o develop an onset risk prediction nomogram for patients with homocysteine-type (H-type) hypertension (HTH) based on pulse diagram parameters to assist early clinical prediction and diagnosis of HTH. Methods: Patients diagnosed with essential hypertension and admitted to Shanghai Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine, Shanghai Hospital of Traditional Chinese Medicine, and Shanghai Hospital of Integrated Traditional Chinese and Western Medicine from July 6th 2020 to June 16th 2021, and from August 11th 2023 to January 22nd 2024, were enrolled in this retrospective research. The baselines and clinical biochemical indicators of patients were collected. The SMART-I TCM pulse instrument was applied to gather pulse diagram parameters. Multivariate logistic regression was adopted to analyze the risk factors for HTH. RStudio was employed to construct the nomogram model, receiver operating characteristic (ROC) curve, and calibration curve (bootstrap self-sampling 200 times), and clinical decision curve were drawn to evaluate the model’s discrimination and clinical effectiveness. Results: A total of 168 hospitalized patients with essential hypertension were selected and divided into non-HTH group (n = 29) and HTH group (n = 139). Compared with non-HTH group, HTH group had a lower body mass index (BMI), and higher proportions of male patients and drinkers (P < 0.05). The ventricular wall thickening (VWT) could not be determined. The proportions of left common carotid intima-media wall thickness (LCCIMWT) and serum creatinine (SCR) were higher in HTH group (P < 0.05). The pulse diagram parameter As was significantly higher, and H4/H1 and T1/T were lower in HTH group (P < 0.05). Gender, alcohol consumption, serum creatinine, and the pulse diagram parameter H4/H1 were identified as independent risk factors for HTH (P < 0.05). The nomogram’s area under the ROC curve (AUC) was 0.795 [95% confidence interval (CI): (0.706 6, 0.882 8)], with a specificity of 0.724 and sensitivity of 0.799. After 200 times repeated bootstrap self-samplings, the calibration curve showed that the simulated curve fits well with the actual curve (x2 = 9.5002, P = 0.301 9). The clinical decision curve indicated that the nomogram’s applicability was optimal when the threshold for predicting HTH was between 0.38 and 1.00. Conclusion The nomogram model could be valuable for predicting the onset risk of HTH and pulse diagram parameters can facilitate early screening and prevention of HTH.

Objective To explore the construction of α-1,3-galactosyltransferase (GGTA1) gene-knockout (GTKO) Diannan miniature pigs and the kidney xenotransplantation from pigs to rhesus macaques, and to assess the effectiveness of GTKO pigs. Methods The GTKO Diannan miniature pigs were constructed using the CRISPR/Cas9 gene-editing system and somatic cell cloning technology. The phenotype of GTKO pigs was verified through polymerase chain reaction, Sanger sequencing and immunofluorescence staining. Flow cytometry was used to detect antigen-antibody (IgM) binding and complement-dependent cytotoxicity. Kidney xenotransplantation was performed from GTKO pigs to rhesus macaques. The humoral immunity, cellular immunity, coagulation and physiological indicators of the recipient monkeys were monitored. The function and pathological changes of the transplanted kidneys were analyzed using ultrasonography, hematoxylin-eosin staining, immunohistochemical staining and immunofluorescence staining. Results Single-guide RNA (sgRNA) targeting exon 4 of the GGTA1 gene in Diannan miniature pigs was designed. The pGL3-GGTA1-sgRNA1-GFP vector was transfected into fetal fibroblasts of Diannan miniature pigs. After puromycin selection, two cell clones, C59# and C89#, were identified as GGTA1 gene-knockout clones. These clones were expanded to form cell lines, which were used as donor cells for somatic cell nuclear transfer. The reconstructed embryos were transferred into the oviducts of trihybrid surrogate sows, resulting in 13 fetal pigs. Among them, fetuses F04 and F11 exhibited biallelic mutations in the GGTA1 gene, and F04 had a normal karyotype. Using this GTKO fetal pig for recloning and transferring the reconstructed embryos into the oviducts of trihybrid surrogate sows, seven surviving piglets were obtained, all of which did not express α-Gal epitope. The binding of IgM from the serum of rhesus monkey 20# to GTKO pig PBMC was reduced, and the survival rate of GTKO pig PBMC in the complement-dependent cytotoxicity assay was higher than that of wild-type pig. GTKO pig kidneys were harvested and perfused until completely white. After the left kidney of the recipient monkey was removed, the pig kidney was heterotopically transplanted. Following vascular anastomosis and blood flow restoration, the pig kidney rapidly turned pink without hyperacute rejection (HAR). Urine appeared in the ureter 6 minutes later, indicating successful kidney transplantation. The right kidney of the recipient was then removed. Seven days after transplantation, the transplanted kidney had good blood flow, the recipient monkey's serum creatinine level was stable, and serum potassium and cystatin C levels were effectively controlled, although they increased 10 days after transplantation. Seven days after transplantation, the levels of white blood cells, lymphocytes, monocytes and eosinophils in the recipient monkey increased, while platelet count and fibrinogen levels decreased. The activated partial thromboplastin time, thrombin time and prothrombin time remained relatively stable but later showed an upward trend. The recipient monkey survived for 10 days. At autopsy, the transplanted kidney was found to be congested, swollen and necrotic, with a small amount of IgG deposition in the renal tissue, and a large amount of IgM, complement C3c and C4d deposition, as well as CD68⁺ macrophage infiltration. Conclusions The kidneys of GTKO Diannan miniature pigs may maintain normal renal function for a certain period in rhesus macaques and effectively overcome HAR, confirming the effectiveness of GTKO pigs for xenotransplantation.

Approximately 10% of the global adult population has diabetes, with accumulating evidence linking suboptimal vitamin D levels to an increased risk of type 2 diabetes and its complications. Current clinical studies suggest that vitamin D supplementation may enhance insulin sensitivity and improve glycemic control, prompting significant interest in its potential as a therapeutic intervention. However, further high-quality, large-scale randomized controlled trials are required to validate its efficacy in glucose metabolism regulation and clarify the underlying molecular mechanisms. These investigations will provide critical evidence to inform precision medicine approaches for diabetes prevention and management.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Objective: To explore the relationship between sleep quality and executive function among middle school students, so as to provide theoretical support for the promotion of adolescents physical and mental health development. Methods: From September to December 2023, 5 713 junior and senior high school students aged 13 to 18 were selected by stratified cluster random sampling method from Shanghai, Suzhou, Taiyuan, Wuyuan, Xingyi, and Urumqi. Pittsburgh Sleep Quality Index was used to conduct sleep quality survey. And conduct executive function was tested on middle school students, including inhibitory function, refresh function and conversion function tests. Spearman correlation and linear regression were used to analyze the relationship between sleep quality and executive function of middle school students. Results: The total Pittsburgh Sleep Quality Index (PSQI) score of boys was [4.0(2.0,6.0)] and that of girls was [5.0(3.0,6.0)], and the difference was statistically significant ( Z=-10.90, P < 0.01 ). The total PSQI score of boys was positively correlated with both 2-back reaction time and conversion function of executive function ( r =0.04, 0.04); the total PSQI score of girls was negatively correlated with 2-back reaction time ( r =-0.04) ( P <0.05). After controlling for variables such as mental health, physical activity and nutritional status,linear regression analyses showed that PSQI total score of middle school students was positively correlated with the inhibitory function and the conversion function response time [ B (95% CI )=1.28(0.21-2.34), 7.62(2.34-12.90), P <0.05]; the associations of total PSQI scores among middle school students with both 2-back and 1-back response time were not statistically significant [ B (95% CI )=-5.88(-16.14-4.37), 8.05( -3.39 -19.50), P >0.05]. Conclusion Positive correlations are observed on sleep quality with inhibitory and conversion functions of executive function among middle school students.

ObjectiveTo investigate the risk factors for pyogenic liver abscess （PLA） comorbid with sepsis by analyzing clinical features， and to construct a predictive model. MethodsA retrospective analysis was performed for 489 patients who were hospitalized and diagnosed with PLA in The Affiliated Hospital of Xuzhou Medical University from January 2019 to December 2023， and according to the presence or absence of sepsis， they were divided into sepsis group with 306 patients and non-sepsis group with 183 patients. Related data were collected， including general information， laboratory markers， and outcome measures. The patients were further divided into a training set of 342 patients and a validation set of 147 patients at a ratio of 7∶3， and the training set was used for screening of variables and construction of a predictive model， while the validation set was used to test the performance of the model. An LASSO regression analysis was used for the screening of variables， and a multivariate Logistic regression analysis was used to construct the predictive model and plot a nomogram. The calibration curve， the receiver operating characteristic （ROC） curve， and the decision curve analysis were used for the validation of the model， and internal validation was performed for assessment. The independent-samples t test was used for comparison of normally distributed continuous data between two groups， and the Mann-Whitney U test was used for comparison of non-normally distributed continuous data between two groups； the chi-square test was used for comparison of categorical variables between groups. ResultsThere were significant differences between the sepsis group and the non-sepsis group in pulse rate， mean arterial pressure， duration pf symptoms， comorbidity of liver cirrhosis or malignant tumor， leukocyte count， neutrophil count， lymphocyte count， platelet count （PLT）， activated partial thromboplastin time， fibrinogen， C-reactive protein， aspartate aminotransferase， alanine aminotransferase， albumin， total bilirubin （TBil）， creatinine， potassium， and prognostic nutritional index （PNI） （all P<0.05）. In the training set， the LASSO regression analysis identified four predictive factors of pulse rate， PLT， TBil and PNI， and the multivariate Logistic regression analysis showed that pulse rate （odds ratio ［OR］=1.033， 95% confidence interval ［CI］： 1.006‍ ‍—‍ ‍1.061， P=0.018）， PLT （OR=0.981， 95%CI： 0.975‍ ‍—‍ ‍0.987， P<0.001）， TBil （OR=1.086， 95%CI： 1.053‍ ‍—‍ ‍1.125， P<0.001）， and PNI （OR=0.935， 95%CI： 0.882‍ ‍—‍ ‍0.988， P=0.019） were independent influencing factors for the risk of sepsis in patients with PLA. The model constructed based on these factors showed a good predictive ability， with an area under the ROC curve of 0.948 （95%CI： 0.923‍ ‍—‍ ‍0.973） in the training set and 0.912 （95%CI： 0.848‍ ‍—‍ ‍0.976） in the validation set. The decision curve analysis showed that the model has a good net benefit within the range of 0.3‍ ‍—‍ ‍0.9 for threshold probability. ConclusionThe nomogram prediction model constructed based on pulse rate， PLT， TBil， and PNI has a certain clinical value and can well predict the risk of sepsis in patients with PLA.