OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

BACKGROUND: Based on the China-VHD database, this study sought to develop and validate a Valvular Heart Disease- specific Age-adjusted Comorbidity Index (VHD-ACI) for predicting mortality risk in patients with VHD. METHODS & RESULTS: The China-VHD study was a nationwide, multi-centre multi-centre cohort study enrolling 13,917 patients with moderate or severe VHD across 46 medical centres in China between April-June 2018. After excluding cases with missing key variables, 11,459 patients were retained for final analysis. The primary endpoint was 2-year all-cause mortality, with 941 deaths (10.0%) observed during follow-up. The VHD-ACI was derived after identifying 13 independent mortality predictors: cardiomyopathy, myocardial infarction, chronic obstructive pulmonary disease, pulmonary artery hypertension, low body weight, anaemia, hypoalbuminaemia, renal insufficiency, moderate/severe hepatic dysfunction, heart failure, cancer, NYHA functional class and age. The index exhibited good discrimination (AUC, 0.79) and calibration (Brier score, 0.062) in the total cohort, outperforming both EuroSCORE II and ACCI (P < 0.001 for comparison). Internal validation through 100 bootstrap iterations yielded a C statistic of 0.694 (95% CI: 0.665-0.723) for 2-year mortality prediction. VHD-ACI scores, as a continuous variable (VHD-ACI score: adjusted HR (95% CI): 1.263 (1.245-1.282), P < 0.001) or categorized using thresholds determined by the Yoden index (VHD-ACI ≥ 9 vs. < 9, adjusted HR (95% CI): 6.216 (5.378-7.184), P < 0.001), were independently associated with mortality. The prognostic performance remained consistent across all VHD subtypes (aortic stenosis, aortic regurgitation, mitral stenosis, mitral regurgitation, tricuspid valve disease, mixed aortic/mitral valve disease and multiple VHD), and clinical subgroups stratified by therapeutic strategy, LVEF status (preserved vs. reduced), disease severity and etiology. CONCLUSION The VHD-ACI is a simple 13-comorbidity algorithm for the prediction of mortality in VHD patients and providing a simple and rapid tool for risk stratification.

This consensus will introduce the characteristics of fillers used in the surgical cavities of domestic nasal surgery patients based on relevant literature and expert opinions. It will also provide recommendations for the selection of cavity fillers for different nasal diseases, with chronic sinusitis as a representative example.
Humans ; Nasal Cavity/surgery* ; Nasal Surgical Procedures ; China ; Consensus ; Sinusitis/surgery* ; Dermal Fillers

In recent decades, the prevalence of hyperuricemia and gout has increased dramatically due to lifestyle changes. The drugs currently recommended for hyperuricemia are associated with adverse reactions that limit their clinical use. In this study, we report that berberine (BBR) is an effective drug candidate for the treatment of hyperuricemia, with its mechanism potentially involving the modulation of gut microbiota and its metabolite, succinic acid. BBR has demonstrated good therapeutic effects in both acute and chronic animal models of hyperuricemia. In a clinical trial, oral administration of BBR for 6 months reduced blood uric acid levels in 22 participants by modulating the gut microbiota, which led to an increase in the abundance of Bacteroides and a decrease in Clostridium sensu stricto_1. Furthermore, Bacteroides fragilis was transplanted into ICR mice, and the results showed that Bacteroides fragilis exerted a therapeutic effect on uric acid similar to that of BBR. Notably, succinic acid, a metabolite of Bacteroides, significantly reduced uric acid levels. Subsequent cell and animal experiments revealed that the intestinal metabolite, succinic acid, regulated the upstream uric acid synthesis pathway in the liver by inhibiting adenosine monophosphate deaminase 2 (AMPD2), an enzyme responsible for converting adenosine monophosphate (AMP) to inosine monophosphate (IMP). This inhibition resulted in a decrease in IMP levels and an increase in phosphate levels. The reduction in IMP led to a decreased downstream production of hypoxanthine, xanthine, and uric acid. BBR also demonstrated excellent renoprotective effects, improving nephropathy associated with hyperuricemia. In summary, BBR has the potential to be an effective treatment for hyperuricemia through the gut-liver axis.

Occupational noise-induced hearing loss (NIHL) is an irreversible sensorineural hearing loss that severely endangers workers’ health, making early screening crucial. This article reviewed the research progress on early screening methods for occupational NIHL, introduced the testing mechanisms of three core screening methods—tympanometry, otoacoustic emissions, and extended high-frequency audiometry —and summarized their clinical application advantages and limitations. It is proposed that multimodal combined detection (e.g., the combination of tympanometry, otoacoustic emissions, and extended high-frequency audiometry) can significantly improve the accuracy and comprehensiveness of early screening. Meanwhile, future studies with prospective cohort design are encouraged to verify the long-term monitoring value of each method and to strengthen the joint development of screening technologies with cutting-edge approaches such as machine learning, in order to further improve screening efficiency and provide stronger protection for workers’ hearing health.

Tooth extraction is a common and widely employed therapeutic procedure in oral and maxillofacial surgery.Minimally invasive tooth extraction can reduce both physical and psychological trauma to the patients,and is widely recommended as a first-line clinical treatment.But currently no guidelines or consensus has been available to provide a systematic introduction of minimally invasive tooth extraction to guide the clinical practices.To address this issue,this consensus,based on a comprehensive literature review and clinical experiences of experts,systematically summarizes the indications,target patients,and contraindications of minimally invasive tooth extraction,the overall workflow of this procedure(preoperative preparation,surgical steps,postoperative management,postoperative instructions,medications,and follow-up),and its common postoperative complications to provide a comprehensive guidance for clinical application of this technique.

Objective To investigate disease characteristics and hospitalization costs of children with Mycoplasma Pneumoniae pneumonia(MPP)admitted to Shanghai municipal medical hospitals from 2019 to 2023.Methods Depending on the Shanghai Municipal Hospital Pediatric Alliance,we retrospectively investigated community acquired MPP pediatric patients hospitalized in 22 municipal hospitals with pediatric qualifications(including 4 children's hospitals)in Shanghai from Jan 2019 to Dec 2023.We collected the patients'diagnosis codes,gender,age,length of hospital stay,hospitalization costs,and whether they progressed to severe Mycoplasma pneumoniae pneumonia(SMPP).Results From 2019 to 2023,a total of 29 045 hospitalized children with MPP were treated,with 6 035 cases(20.8%)identified as SMPP in the 22 hospitals.Trend analysis revealed a rising trend with years in the proportion of SMPP patients(χ2trend=365.498,P<0.001).Among the 4 children's hospitals,there were 18 710 cases with MPP,including 4 078 cases(21.8%)of SMPP.The proportion of SMPP patients also showed an increasing trend with years(χ2trend=14.548,P<0.001),and the proportion in 2023(23.0%)was higher than that in previous years with statistical significance.There were statistical differences in the seasonal distribution of MPP cases between different years,with higher proportions in summer and autumn overall.The age distribution of hospitalized MPP children varied among different years,with school-age children accounting for the majority(56.8%)in 2023.There was no difference in the distribution of severe cases between different genders,but there were differences in the proportion of severe cases among different age groups in different years,with a gradual increase in severe cases among children aged 1 to 3 years(χ2trend=191.567,P<0.001).The average length of hospital stay for MPP during the epidemic was higher than that during non-epidemic periods,and there were statistically significant differences in the average length of hospital stay between different years(P<0.001).The individual hospitalization costs during the epidemic were higher than in other years,and there were statistically significant differences in individual hospitalization costs between different years(P<0.001).The total hospitalization costs were still higher in 2019 and 2023.The individual hospitalization costs for SMPP were higher than for non-SMPP cases.Conclusion MPP outbreaks occurred in Shanghai in 2019 and 2023,with the higher proportions in summer and autumn overall.Compared to previous years,the number of hospitalized MPP children in Shanghai was higher in 2023,with a higher proportion of SMPP cases,especially among children under 3 years old.The individual per capita hospitalization expenses for SMPP cases were higher than for non-SMPP cases.

Objective:To explore potential predictors of refractory Mycoplasma pneumoniae pneumonia (RMPP) in early stage. Methods:The prospective multicenter study was conducted in Zhejiang, China from May 1 st, 2019 to January 31 st, 2020. A total of 1 428 patients with fever >48 hours to <120 hours were studied. Their clinical data and oral pharyngeal swab samples were collected; Mycoplasma pneumoniae DNA in pharyngeal swab specimens was detected. Patients with positive Mycoplasma pneumoniae DNA results underwent a series of tests, including chest X-ray, complete blood count, C-reactive protein, lactate dehydrogenase (LDH), and procalcitonin. According to the occurrence of RMPP, the patients were divided into two groups, RMPP group and general Mycoplasma pneumoniae pneumonia (GMPP) group. Measurement data between the 2 groups were compared using Mann-Whitney U test. Logistic regression analyses were used to examine the associations between clinical data and RMPP. Receiver operating characteristic (ROC) curves were used to analyse the power of the markers for predicting RMPP. Results:A total of 1 428 patients finished the study, with 801 boys and 627 girls, aged 4.3 (2.7, 6.3) years. Mycoplasma pneumoniae DNA was positive in 534 cases (37.4%), of whom 446 cases (83.5%) were diagnosed with Mycoplasma pneumoniae pneumonia, including 251 boys and 195 girls, aged 5.2 (3.3, 6.9) years. Macrolides-resistant variation was positive in 410 cases (91.9%). Fifty-five cases were with RMPP, 391 cases with GMPP. The peak body temperature before the first visit and LDH levels in RMPP patients were higher than that in GMPP patients (39.6 (39.1, 40.0) vs. 39.2 (38.9, 39.7) ℃, 333 (279, 392) vs. 311 (259, 359) U/L, both P<0.05). Logistic regression showed the prediction probability π=exp (-29.7+0.667×Peak body temperature (℃)+0.004×LDH (U/L))/(1+exp (-29.7+0.667×Peak body temperature (℃)+0.004 × LDH (U/L))), the cut-off value to predict RMPP was 0.12, with a consensus of probability forecast of 0.89, sensitivity of 0.89, and specificity of 0.67; and the area under ROC curve was 0.682 (95% CI 0.593-0.771, P<0.01). Conclusion:In MPP patients with fever over 48 to <120 hours, a prediction probability π of RMPP can be calculated based on the peak body temperature and LDH level before the first visit, which can facilitate early identification of RMPP.

Tooth extraction is a common and widely employed therapeutic procedure in oral and maxillofacial surgery.Minimally invasive tooth extraction can reduce both physical and psychological trauma to the patients,and is widely recommended as a first-line clinical treatment.But currently no guidelines or consensus has been available to provide a systematic introduction of minimally invasive tooth extraction to guide the clinical practices.To address this issue,this consensus,based on a comprehensive literature review and clinical experiences of experts,systematically summarizes the indications,target patients,and contraindications of minimally invasive tooth extraction,the overall workflow of this procedure(preoperative preparation,surgical steps,postoperative management,postoperative instructions,medications,and follow-up),and its common postoperative complications to provide a comprehensive guidance for clinical application of this technique.

Objective To investigate the characteristics of gut flora related to dampness syndrome in the population at risk of cerebrovascular disease and to explore their influencing factors.Methods Based on the results of epidemiological investigation of damp syndrome in at-risk population of cerebrovascular disease in Guangdong from October 2021 to February 2023,60 subjects(including 41 at-risk cases of cerebrovascular disease and 19 healthy controls)were included in the study.The identification of dampness syndrome and the risk rating of stroke were carried out for the subjects,and fecal samples were collected.High-throughput 16S rRNA sequencing technology and bioinformatics methods were used to analyze the characteristics of gut flora.Results(1)A total of 53 cases(88.33％)were identified as dampness syndrome.There was significant difference in the quantitative score of dampness syndrome between the risk group and the healthy group,and between the low-,medium-and high-risk groups(P=0.016;P=0.041).(2)There was no statistical difference in the species and abundance of gut flora between the dampness syndrome group and the non-dampness syndrome group.(3)In the population identified as dampness syndrome,there was no significant difference in Alpha diversity between the healthy group and the risk group,but there was significant difference in Beta diversity analysis;LEfSe analysis found that Fusobacterium and Lactobacillus were enriched in the risk group;correlation analysis showed that the differential bacteria were related to the three risk factors of diabetes,dyslipidemia and obesity and carotid intima-media thickness(IMT).(4)In the population identified as dampness syndrome and having the risk of cerebrovascular disease,there was no significant difference in Alpha diversity among three groups with different levels of risks,while significant difference in Beta diversity was observed;LEfSe analysis showed that Acidaminococcaceae,Phascolarctobacterium and Butyricimonas were enriched in the low-risk group,Veillonellaceae was enriched in the medium-risk group,and Ruminococcus 2 and Alloprevotella were enriched in the high-risk group;correlation analysis showed that the differential bacteria were associated with high-density lipoprotein cholesterol(HDL-C),low-density lipoprotein cholesterol(LDL-C),white blood cell count(WBC),and neutrophil count(NEUT).Conclusion In the Guangdong population predominated by dampness syndrome,the severity of dampness syndrome is related to the risk of stroke,and the specific flora associated with sub-clinical atherosclerosis,inflammatory response and lipid metabolism are presented.