Yttrium-90 selective internal radiation therapy (⁹⁰Y-SIRT) is a treatment technique that delivers radioactive microspheres precisely to the arterial vascular bed of neoplasms, utilizing beta radiation to administer a high local dose of radiation to the neoplasm tissues. This technology has demonstrated significant efficacy in patients with unresectable pirmary liver cancers and liver metastases. This article systematically reviews the development history and clinical application status of ⁹⁰Y-SIRT in the treatment of liver cancer, and looks forward to future development directions.

Objective: To investigate the association between childhood obesity and type 2 diabetes mellitus (T2DM) as well as coronary artery heart disease (CHD). Methods: Genome-wide association study (GWAS) data for childhood obesity were collected from the ECG consortium, encompassing information on children aged 2 to 18 years, including 18 613 cases and 12 696 controls. GWAS data for T2DM were collected from the DIAGRAM consortium, including 242 283 cases and 1 569 734 controls. GWAS data for CHD were collected from the CARDIoGRAMplusC4D consortium, including 10 801 cases and 137 371 controls. Pleiotropic genes associated with both T2DM and CHD were analyzed using the MAGMA, PLACO and conditional false discovery rate (cFDR) methods. Mendelian randomization (MR) analysis was performed using inverse variance weighted (IVW) method, exploring the causal relationships among childhood obesity, T2DM and CHD. Heterogeneity was evaluated using Cochran's Q test, horizontal pleiotropy and exclude outliers were tested using MR-Egger regression and MR-PRESSO test. The mediating variables among the three diseases were investigated by using a mediation analysis. Results: The results of MAGMA, PLACO and cFDR analyses identified 80 pleiotropic genes associated with both T2DM and CHD, primarily distributed on chromosomes 3, 17 and 19. The MR analysis revealed that childhood obesity increased the risk of T2DM (OR=1.151, 95%CI: 1.033-1.283) and CHD (OR=1.158, 95%CI: 1.068-1.255), T2DM increased the risk of CHD (OR=1.182, 95%CI: 1.139-1.227), and CHD increased the risk of T2DM (OR=1.124, 95%CI: 1.055-1.198). The MR-Egger regression analysis showed no horizontal pleiotropy, and the MR-PRESSO test did not identify any outliers (all P>0.05). Mediation analysis indicated that childhood obesity directly increased the risk of CHD (effect value=0.096, 95%CI: 0.012-0.180) and indirectly increased the risk of CHD through T2DM (effect value=0.023, 95%CI: 0.005-0.041), with the mediation effect accounting for 15.65% of the total effect. Conclusions There are potential causal associations between childhood obesity and T2DM as well as CHD, with a bidirectional causal relationship between T2DM and CHD. T2DM also plays a mediating role in the association between childhood obesity and CHD.

Purpose: To investigate the therapeutic potential of eliminating insulin-like growth factor-binding protein 5 (IGFBP5) expression in improving erectile function in mice with cavernous nerve injury (CNI)-induced erectile dysfunction (ED). Materials and Methods: Eight-week-old male C57BL/6 mice were divided into four groups: a sham-operated group and three CNI-induced ED groups. The CNI-induced ED groups were treated with intracavernous injections 3 days before the CNI procedure.These injections included phosphate-buffered saline, scrambled control short hairpin RNA (shRNA), or shRNA targeting mouse IGFBP5 lentiviral particles. One week after CNI, erectile function was evaluated and the penile tissue was then harvested for histological examination and western blot analysis. Additionally, the major pelvic ganglia (MPG) and dorsal root ganglia (DRG) were cultured for ex vivo neurite outgrowth assays. Results: Following CNI, IGFBP5 expression in the cavernous tissues significantly increased, reaching its peak at day 7. First, ablation of IGFBP5 expression promotes neurite sprouting in MPG and DRG when exposed to lipopolysaccharide. Second, ablating IGFBP5 expression in CNI-induced ED mice improved erectile function, likely owing to increased neurovascular contents, including endothelial cells, pericytes, and neuronal processes. Third, ablating IGFBP5 expression in CNI-induced ED mice promoted neurovascular regeneration by increasing cell proliferation, reducing apoptosis, and decreasing Reactive oxygen species production. Finally, western blot analysis demonstrated that IGFBP5 ablation attenuated the JNK/c-Jun signaling pathway, activated the PI3K/AKT signaling pathway, and increased vascular endothelial growth factor and neurotrophic factor expression. Conclusions Ablating IGFBP5 expression enhanced neurovascular regeneration and ultimately improved erectile function in CNI-induced ED mice.

Objective: To investigate the effects of different storage temperatures and durations on the activities of coagulation factor Ⅷ (Factor Ⅷ, FⅧ) and coagulation factor Ⅸ (Factor Ⅸ, FⅨ) after whole blood collection, so as to provide data support for the optimal storage conditions. Methods: A total of 16 mL of whole blood was collected from each of the 20 healthy volunteers at our blood center and aliquoted into 8 sodium citrate anticoagulant tubes. Two tubes were immediately centrifuged for the measurement of FⅧ and FⅨ activity levels. The remaining 6 tubes of whole blood were respectively stored under room temperature and low-temperature conditions. At 2, 4, and 6 h, the whole blood samples were centrifuged and analyzed for FⅧ and FⅨ activity levels. The mean values of the two immediately tested tubes were used as the control group, while other tubes were designated as the experimental groups for comparison. Statistical analysis was performed using SPSS 26.0. Results: The activity of FⅧ in whole blood remained stable after 4 hours of storage at both room temperature and low temperature (116.53±25.95 vs 125.22±27.33, 109.77±23.23 vs 125.22±27.33) (P>0.05 for both). However, by 6 hours, FⅧ activity showed a statistically significant decline compared to the control group (108.65±22.92 vs 125.22±27.33, 100.46±20.19 vs 125.22±27.33) (P<0.05 for both), though the room temperature group results were closer to the control values. The activity of FⅨ in whole blood remained stable after 6 hours of storage under both conditions (97.14±19.48 vs 96.76±19.67, 97.10±17.45 vs 96.76±19.6) (P>0.05 for all comparisons). Conclusion: For whole blood samples after collection, storage at either room temperature or low temperature for up to 4 hours does not compromise the accuracy of test results. When stored for 6 hours, FⅨ activity remains stable, whereas FⅧ activity decreases significantly. Notably, FⅧ activity demonstrates better stability at room temperature than under low-temperature conditions within the 6-hour storage.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Objective: To explore the iodine nutrition status of children in Wuhan from 2019 to 2023, and to evaluate the effect of iodine deficiency disorders control in focus groups in Wuhan, so as to provide a basis for consolidating elimination of iodine deficiency disorders. Methods: A total of 13 000 non boarding primary school students aged 8-10 were selected from 13 districts of Wuhan by stratified random sampling method.Household salt samples were collected to measure salt iodine content, random urine samples were analyzed for urinary iodine concentration. And B ultrasound was used to measure thyroid volume in students. The median of salt iodine, coverage rate of iodized salt, consumption rate of qualified iodized salt, median of urinary iodine, and the goiter rate were calculated. And Mann-Whitney U- test, Kruskal-Wallis H- test and Chi-square test were applied to compare between groups. Chi-square trend test was used to analyze the changing trends of coverage rate of iodized salt, consumption rate of qualified iodized salt and goiter rate among children in Wuhan. Results: The median of iodine content of children s household salt was 23.8 (21.7, 26.1) mg/kg, and the coverage rate of iodized salt was 98.7%, and the consumption rate of qualified iodized salt was 94.5 %. The consumption rates of qualified iodized salt showed an overall upward trend from 2019 to 2023 ( χ 2 trend =5.57， P <0.05). The median of urinary iodine of children was 220.1 (136.7, 326.0) μg/L,and boys had higher median of urinary iodine than girls [228.3(143.2, 336.0),210.2(129.1, 315.7) μg/L] ( Z =6.60, P <0.01). The median of urinary iodine of children in suburbs was higher than those in urban areas [236.3 (150.7, 342.2) , 207.1 (124.5, 309.8) μg/L]( Z =11.00, P <0.01). A total of 4 600 children were examined for thyroid volume, and the range of goiter rates were 1.1% to 3.4%, with an average goiter rate of 2.5%, which showed an overall downward trend from 2019 to 2023 ( χ 2 trend =5.11, P <0.05). Conclusions The iodine nutrition is sufficient and iodine nutrition status is good among children in Wuhan. It should continue to carry out monitoring and evaluation of children s iodine nutrition, guide the public to supplement iodine scientifically,so as to maintain the appropriate level of iodine for children.

ObjectiveThis study aims to reveal the mechanism of liver and kidney injuries caused by Dictamni Cortex and its interrelationship by metabonomics analysis of liver and kidney via ultra-performance liquid chromatography-quadrupole-time-of-flight mass spectrometry （UPLC-Q-TOF-MS）. MethodsThe content of the marker compounds of Dictamni Cortex was measured by high-performance liquid chromatography （HPLC） to carry out quality control. Sprague Dawley （SD） rats were randomly divided into a blank group （normal saline）， an administration group （0.9， 2.7， 8.1 g·kg^-1）， and a high-dose withdrawal control group， with eight rats in each group. Continuous administration was performed once daily for 28 days. The liver and kidney injuries caused by each administration group were assessed by organ indices， pathological observations， and serum and plasma biochemical indices measured by enzyme-linked immunosorbent assay （ELISA）. The potential biomarkers of liver and kidney injuries caused by Dictamni Cortex were screened， and pathway enrichment analysis and correlation analysis were performed based on UPLC-Q-TOF-MS. ResultsCompared with the blank group， both the medium- and low-dose groups showed insignificant damage to the liver and kidney of rats. The high-dose group exhibited the most serious damage， and the level of liver and kidney function indices ［alanine aminotransferase （ALT）， aspartate aminotransferase （AST）， creatinine （Cr）， and blood urea nitrogen （BUN）］ and serum inflammatory indices （［interleukin 1β （IL-1β）， IL-6， and tumor necrosis factor-α （TNF-α）］ in the serum were significantly changed （P<0.01）. The liver and kidney metabolism pathways and differential metabolites were quite different. Among them， phenylalanine metabolism， niacin and nicotinamide metabolism， and glycerophospholipid metabolism were common pathways. Correlation analysis of differential metabolites showed that there were significant correlations among disorders of 4′-Phosphopantothenoylcysteine， PC （16∶0/15∶0）， phenylethylamine， arachidonic acid， and linoleic acid in liver and kidney tissue. ConclusionThe decoction of Dictamni Cortex can cause liver and kidney injuries， and its mechanism may be related to oxidative stress and lipid metabolism disorders. The correlation of differential metabolites indicates the interaction between liver and kidney injuries.

ObjectiveTo explore the mechanism of the immunotoxicity induced by dictamnine （DIC） in rats and the recovery effect after drug withdrawal by ultra-performance liquid chromatography-quadrupole-time-of-flight mass spectrometry， thereby providing a theoretical basis for elucidating the toxic mechanism of DIC. MethodsSD rats were randomized into blank （normal saline）， DIC （10 mg·kg^-1）， and DIC withdrawal （recovery period） groups （n=8）. The rats were continuously treated for 7 days， once a day， and the body weight and organ weight were recorded. The levels of interleukin-1 （IL-1）， IL-6， and tumor necrosis factor-α （TNF-α） in the serum and immunoglobulin A （IgA）， immunoglobulin G （IgG）， and immunoglobulin M （IgM） in the spleen were determined by enzyme-linked immunosorbent assay. Hematoxylin-eosin staining was used to observe the pathological changes in the spleen. ultra performance liquid chromatography quadrupole time-of-flight mass spectrometry （UPLC-Q-TOF-MS） was employed to screen the potential biomarkers of immune inflammation caused by DIC， and pathway enrichment analysis and correlation analysis were performed. The mRNA levels of IL-1β， TNF-α， lysophosphatidylcholine acyltransferase 2 （LPCAT2）， and farnesoid X receptor （FXR） in the serum were determined by Real-time fluorescence quantitative polymerase chain reaction （Real-time PCR）. ResultsCompared with the blank group， the DIC group showed elevated levels of IL-1β， IL-6， and TNF-α in the serum （P<0.01）， and the DIC withdrawal group showcased lowered levels of IL-1β， IL-6， and TNF-α in the serum （P<0.01）. The levels of IgA， IgG， and IgM in the spleen of rats in the DIC group were decreased （P<0.01）， while those in the DIC withdrawal group were recovered （P<0.05， P<0.01）. Untargeted metabolomics of the serum and spleen screened out 14 common differential metabolites and 14 common metabolic pathways. The Spearman correlation analysis between differential metabolites and inflammatory factors identified PC （32∶0）， LysoPC （20∶4/0∶0）， LysoPC （P-18∶0/0∶0）， taurochenodeoxycholic acid， taurocholic acid， LysoPC ［20∶5（5Z，8Z，11Z，14Z，17Z）/0∶0］， chenodeoxycholic acid， arachidonic acid， LysoPC （18∶0/0∶0）， LysoPC （15∶0/0∶0）， LysoPC （16∶0/0∶0）， and LysoPC （17∶0/0∶0） as the biomarkers of immunotoxicity induced by DIC in SD rats. In the process of immunotoxicity caused by DIC， lipid metabolism disorders such as glycerophospholipid metabolism， primary bile acid metabolism， and arachidonic acid metabolism were enriched， which was consistent with the DIC-induced inflammatory factors and pathological characteristics of the spleen. Compared with the blank group， the DIC group exhibited up-regulated mRNA levels of IL-1β， TNF-α， LPCAT2， and FXR （P<0.01）， and the up-regulation was decreased in the withdrawal group （P<0.01）. ConclusionDIC can lead to immune and inflammatory disorders. DIC withdrawal can regulate the expression of biomarkers related to serum and spleen metabolites， regulate the inflammatory metabolic pathway， reduce the inflammation level， and alleviate the metabolic disorders， thus attenuating the potential toxicity induced by DIC.

Hypoxia-inducible factor (HIF-1α), a core transcription factor responding to changes in cellular oxygen levels, is closely associated with a wide range of physiological and pathological conditions. However, its differential impacts on vascular cell types and molecular programs modulating human vascular homeostasis and regeneration remain largely elusive. Here, we applied CRISPR/Cas9-mediated gene editing of human embryonic stem cells and directed differentiation to generate HIF-1α-deficient human vascular cells including vascular endothelial cells, vascular smooth muscle cells, and mesenchymal stem cells (MSCs), as a platform for discovering cell type-specific hypoxia-induced response mechanisms. Through comparative molecular profiling across cell types under normoxic and hypoxic conditions, we provide insight into the indispensable role of HIF-1α in the promotion of ischemic vascular regeneration. We found human MSCs to be the vascular cell type most susceptible to HIF-1α deficiency, and that transcriptional inactivation of ANKZF1, an effector of HIF-1α, impaired pro-angiogenic processes. Altogether, our findings deepen the understanding of HIF-1α in human angiogenesis and support further explorations of novel therapeutic strategies of vascular regeneration against ischemic damage.
Humans ; Vascular Endothelial Growth Factor A/metabolism* ; Endothelial Cells/metabolism* ; Transcription Factors/metabolism* ; Gene Expression Regulation ; Hypoxia/metabolism* ; Cell Hypoxia/physiology*

Aim To analyze the anti-A549 and HI299 lung ade-nocarcinoma activities via using examples of baicalin, astragalo-side, hesperidin and cisplatin based on real time cellular analysis (RTCA) technology, and to build a new strategy for EC50 e-valuation reflecting the time-dimensional characteristic. Methods Using RTCA Software Pro for data analysis and GraphPad Prism and Origin Pro plotting, the in vitro anti-A549 and H1299 lung adenocarcinoma activities of baicalin, astragaloside, hesperidin, and cisplatin were characterized using the endpoint method and time dimension, respectively. Results (X) There were significant differences in EC50 values of A549 and H1299 cells at 24 h and 48 h endpoint methods. (2) The correlation coefficient of the curve fitted with the four-parameter equation was > 0. 9, and the dynamic change of EC50 remained relatively stable (the linear fitting of EC50 at adjacent 4 points I slope 1^1) used to calculate the EC50 value within this time dimension. The EC50 of baicalin, astragaloside, hesperidin and cisplatin on A549 cells was 52. 97 ±1.75 плпо! • L~1(16~48 h) , 62.88 ± 2.91 ijunol • L"1 (32.25 -48 h) , 78.84 ±0.33 плпо1 • L"1 (21.5 -29.75 h), 13.57 ±1.54 плпо1 • L_1(27.5 -48 h), respectively; the EC50 of baicalin, astragaloside, hesperidin and cisplatin on H1299 cells was 43. 71 ± 1. 26 |лто1 • L_1 ( 19. 5 -48 h), 47.23 ±1. 19 |лто1 • L_1(14 -48 h) , 39.45 ±0.24 плпо1 • L"1 (12.75 -46.25 h), 25.97 ±4.76 плпо1 • L"1 (10. 25 -48 h) , respectively. The results showed that the time window for the anti-tumor effect of the test solution/drug was different. Conclusions Based on RTCA technology, it is more accurate and reasonable to select EC50 data that exhibit better fitting, stable changes, and time-dimensional characteristics for the evaluation of anti-tumor activity. In addition, this method of distinguishing different effective time of antitumor drugs can provide a reference for the timing of clinical combination drugs, and this approach will also provide a reference for further related studies.