1.Effects of different storage temperatures and durations on the activity of coagulation factor Ⅷ and Ⅸ in whole blood
Hehe WANG ; Tiantian WANG ; Jie WANG ; Cuicui QIAO ; Wei LIU ; Xueqin ZHANG ; Yan CHENG ; Yunhai FANG ; Xinsheng ZHANG
Chinese Journal of Blood Transfusion 2025;38(6):824-827
		                        		
		                        			
		                        			Objective: To investigate the effects of different storage temperatures and durations on the activities of coagulation factor Ⅷ (Factor Ⅷ, FⅧ) and coagulation factor Ⅸ (Factor Ⅸ, FⅨ) after whole blood collection, so as to provide data support for the optimal storage conditions. Methods: A total of 16 mL of whole blood was collected from each of the 20 healthy volunteers at our blood center and aliquoted into 8 sodium citrate anticoagulant tubes. Two tubes were immediately centrifuged for the measurement of FⅧ and FⅨ activity levels. The remaining 6 tubes of whole blood were respectively stored under room temperature and low-temperature conditions. At 2, 4, and 6 h, the whole blood samples were centrifuged and analyzed for FⅧ and FⅨ activity levels. The mean values of the two immediately tested tubes were used as the control group, while other tubes were designated as the experimental groups for comparison. Statistical analysis was performed using SPSS 26.0. Results: The activity of FⅧ in whole blood remained stable after 4 hours of storage at both room temperature and low temperature (116.53±25.95 vs 125.22±27.33, 109.77±23.23 vs 125.22±27.33) (P>0.05 for both). However, by 6 hours, FⅧ activity showed a statistically significant decline compared to the control group (108.65±22.92 vs 125.22±27.33, 100.46±20.19 vs 125.22±27.33) (P<0.05 for both), though the room temperature group results were closer to the control values. The activity of FⅨ in whole blood remained stable after 6 hours of storage under both conditions (97.14±19.48 vs 96.76±19.67, 97.10±17.45 vs 96.76±19.6) (P>0.05 for all comparisons). Conclusion: For whole blood samples after collection, storage at either room temperature or low temperature for up to 4 hours does not compromise the accuracy of test results. When stored for 6 hours, FⅨ activity remains stable, whereas FⅧ activity decreases significantly. Notably, FⅧ activity demonstrates better stability at room temperature than under low-temperature conditions within the 6-hour storage.
		                        		
		                        		
		                        		
		                        	
2.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
		                        		
		                        			
		                        			Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
		                        		
		                        		
		                        		
		                        	
3.Iodine nutritional status of children aged 8-10 in Wuhan from 2019 to 2023
WANG Shuai, CHEN Fang, YANG Yan, LUO Huatang, LIU Cong, XU Wenxiu
Chinese Journal of School Health 2025;46(6):792-796
		                        		
		                        			Objective:
		                        			To explore the iodine nutrition status of children in Wuhan from 2019 to 2023, and to evaluate the effect of iodine deficiency disorders control in focus groups in Wuhan, so as to provide a basis for consolidating elimination of iodine deficiency disorders.
		                        		
		                        			Methods:
		                        			A total of 13 000 non boarding primary school students aged 8-10 were selected from 13 districts of Wuhan by stratified random sampling method.Household salt samples were collected to measure salt iodine content, random urine samples were analyzed for urinary iodine concentration. And  B ultrasound was used to measure thyroid volume in students. The median of salt iodine, coverage rate of iodized salt, consumption rate of qualified iodized salt, median of urinary iodine, and the goiter rate were calculated. And Mann-Whitney  U- test, Kruskal-Wallis  H- test and  Chi-square test were applied to compare between groups.  Chi-square trend test was used to analyze the changing trends of coverage rate of iodized salt, consumption rate of qualified iodized salt and goiter rate among children in Wuhan.
		                        		
		                        			Results:
		                        			The median of iodine content of children s household salt was 23.8 (21.7, 26.1) mg/kg, and the coverage rate of iodized salt was 98.7%, and the consumption rate of qualified iodized salt was  94.5 %. The consumption rates of qualified iodized salt showed an overall upward trend from 2019 to 2023 ( χ 2 trend =5.57, P <0.05). The median of urinary iodine of children was 220.1 (136.7, 326.0) μg/L,and boys had higher median of urinary iodine than girls [228.3(143.2, 336.0),210.2(129.1, 315.7) μg/L] ( Z =6.60,  P <0.01). The median of urinary iodine of children in suburbs was higher than those in urban areas [236.3 (150.7, 342.2) , 207.1 (124.5, 309.8) μg/L]( Z =11.00,  P <0.01). A total of 4 600 children were examined for thyroid volume, and the range of goiter rates were 1.1% to 3.4%, with an average goiter rate of 2.5%, which showed an overall downward trend from 2019 to 2023 ( χ 2 trend =5.11,  P <0.05).
		                        		
		                        			Conclusions
		                        			The iodine nutrition is sufficient and iodine nutrition status is good among children in Wuhan. It should continue to carry out monitoring and evaluation of children s iodine nutrition, guide the public to supplement iodine scientifically,so as to maintain the appropriate level of iodine for children.
		                        		
		                        		
		                        		
		                        	
4.Predicting model for the impact of Internet usage characteristics on suicidal ideation among vocational high school students
YU Bin, YAN Jingyan, ZHANG Liqun, XIAO Chenchang, LI Fang, GUO Yan, YAN Hong
Chinese Journal of School Health 2025;46(8):1175-1179
		                        		
		                        			Objective:
		                        			To explore the association between the Internet usage characteristics and suicidal ideation among vocational high school students, so as to provide a theoretical basis for precise intervention of suicide among vocational high school students. 
		                        		
		                        			Methods:
		                        			A total of 1 781 students were recruited from three vocational high schools in Wuhan and Xianning in March 2023 by using the cluster random sampling method. The Columbia-Suicide Severity Rating Scale and Revised Chen Internet Addiction Scale were used to measure suicidal ideation and Internet addiction, respectively. LASSO regression model was used to select influential factors related to suicidal ideation, and the gradient boosting decision tree algorithm XGBoost was used to develop prediction models and evaluate predictive performance. By calculating the  SHAP  values, the contribution of each influential factor was quantified. 
		                        		
		                        			Results:
		                        			The prevalence of suicidal ideation among vocational high school students was 42.22% and prevalence of Internet addiction was 26.39%. LASSO regression results indicated that age, gender, experience of being left behind, parental relationship, holding a class cadre position, using the Internet for learning, Internet use during dawn, morning and late night, Internet addiction, and depressive symptoms were all the influential factors of suicidal ideation among vocational high school students ( β= -0.05 , 0.29, 0.09, 0.27, 0.10, -0.01, 0.09, 0.05, 0.24, 0.28,  0.78,  all  P <0.05). The AUC of the prediction model was 0.75. The results based on  SHAP  values indicated that all influential factors identified through multivariate analysis contributed positively to the model predictions ( SHAP >0). Among these, depressive symptoms and parental relationship had the greatest impact on suicidal ideation ( SHAP =0.77, 0.26), and the joint effect of features with higher contribution could improve the prediction probability.
		                        		
		                        			Conclusions
		                        			Depressive symptoms, parental relationships, Internet addiction, and time of Internet use are most important risk factors of suicidal behaviors for vocational high school students. Thus, effective interventions should be conducted to reduce their suicidal ideation.
		                        		
		                        		
		                        		
		                        	
5.Mechanism of Pharmacological Liver and Kidney Injuries of Dictamni Cortex Based on UPLC-Q-TOF-MS
Jiahe YAN ; Sujie LIU ; Xiaofan WANG ; Chen WANG ; Jiaxin RUAN ; Fang LU ; Shumin LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(20):48-56
		                        		
		                        			
		                        			ObjectiveThis study aims to reveal the mechanism of liver and kidney injuries caused by Dictamni Cortex and its interrelationship by metabonomics analysis of liver and kidney via ultra-performance liquid chromatography-quadrupole-time-of-flight mass spectrometry (UPLC-Q-TOF-MS). MethodsThe content of the marker compounds of Dictamni Cortex was measured by high-performance liquid chromatography (HPLC) to carry out quality control. Sprague Dawley (SD) rats were randomly divided into a blank group (normal saline), an administration group (0.9, 2.7, 8.1 g·kg-1), and a high-dose withdrawal control group, with eight rats in each group. Continuous administration was performed once daily for 28 days. The liver and kidney injuries caused by each administration group were assessed by organ indices, pathological observations, and serum and plasma biochemical indices measured by enzyme-linked immunosorbent assay (ELISA). The potential biomarkers of liver and kidney injuries caused by Dictamni Cortex were screened, and pathway enrichment analysis and correlation analysis were performed based on UPLC-Q-TOF-MS. ResultsCompared with the blank group, both the medium- and low-dose groups showed insignificant damage to the liver and kidney of rats. The high-dose group exhibited the most serious damage, and the level of liver and kidney function indices [alanine aminotransferase (ALT), aspartate aminotransferase (AST), creatinine (Cr), and blood urea nitrogen (BUN)] and serum inflammatory indices ([interleukin 1β (IL-1β), IL-6, and tumor necrosis factor-α (TNF-α)] in the serum were significantly changed (P<0.01). The liver and kidney metabolism pathways and differential metabolites were quite different. Among them, phenylalanine metabolism, niacin and nicotinamide metabolism, and glycerophospholipid metabolism were common pathways. Correlation analysis of differential metabolites showed that there were significant correlations among disorders of 4′-Phosphopantothenoylcysteine, PC (16∶0/15∶0), phenylethylamine, arachidonic acid, and linoleic acid in liver and kidney tissue. ConclusionThe decoction of Dictamni Cortex can cause liver and kidney injuries, and its mechanism may be related to oxidative stress and lipid metabolism disorders. The correlation of differential metabolites indicates the interaction between liver and kidney injuries. 
		                        		
		                        		
		                        		
		                        	
6.Metabolomics Reveals Immune System Domage of Dictamnine
Xiaocan GAI ; Jiaxin RUAN ; Sujie LIU ; Chen WANG ; Xiaofan WANG ; Jiahe YAN ; Yu WANG ; Fang LU ; Shumin LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(20):57-65
		                        		
		                        			
		                        			ObjectiveTo explore the mechanism of the immunotoxicity induced by dictamnine (DIC) in rats and the recovery effect after drug withdrawal by ultra-performance liquid chromatography-quadrupole-time-of-flight mass spectrometry, thereby providing a theoretical basis for elucidating the toxic mechanism of DIC. MethodsSD rats were randomized into blank (normal saline), DIC (10 mg·kg-1), and DIC withdrawal (recovery period) groups (n=8). The rats were continuously treated for 7 days, once a day, and the body weight and organ weight were recorded. The levels of interleukin-1 (IL-1), IL-6, and tumor necrosis factor-α (TNF-α) in the serum and immunoglobulin A (IgA), immunoglobulin G (IgG), and immunoglobulin M (IgM) in the spleen were determined by enzyme-linked immunosorbent assay. Hematoxylin-eosin staining was used to observe the pathological changes in the spleen. ultra performance liquid chromatography quadrupole time-of-flight mass spectrometry (UPLC-Q-TOF-MS) was employed to screen the potential biomarkers of immune inflammation caused by DIC, and pathway enrichment analysis and correlation analysis were performed. The mRNA levels of IL-1β, TNF-α, lysophosphatidylcholine acyltransferase 2 (LPCAT2), and farnesoid X receptor (FXR) in the serum were determined by Real-time fluorescence quantitative polymerase chain reaction (Real-time PCR). ResultsCompared with the blank group, the DIC group showed elevated levels of IL-1β, IL-6, and TNF-α in the serum (P<0.01), and the DIC withdrawal group showcased lowered levels of IL-1β, IL-6, and TNF-α in the serum (P<0.01). The levels of IgA, IgG, and IgM in the spleen of rats in the DIC group were decreased (P<0.01), while those in the DIC withdrawal group were recovered (P<0.05, P<0.01). Untargeted metabolomics of the serum and spleen screened out 14 common differential metabolites and 14 common metabolic pathways. The Spearman correlation analysis between differential metabolites and inflammatory factors identified PC (32∶0), LysoPC (20∶4/0∶0), LysoPC (P-18∶0/0∶0), taurochenodeoxycholic acid, taurocholic acid, LysoPC [20∶5(5Z,8Z,11Z,14Z,17Z)/0∶0], chenodeoxycholic acid, arachidonic acid, LysoPC (18∶0/0∶0), LysoPC (15∶0/0∶0), LysoPC (16∶0/0∶0), and LysoPC (17∶0/0∶0) as the biomarkers of immunotoxicity induced by DIC in SD rats. In the process of immunotoxicity caused by DIC, lipid metabolism disorders such as glycerophospholipid metabolism, primary bile acid metabolism, and arachidonic acid metabolism were enriched, which was consistent with the DIC-induced inflammatory factors and pathological characteristics of the spleen. Compared with the blank group, the DIC group exhibited up-regulated mRNA levels of IL-1β, TNF-α, LPCAT2, and FXR (P<0.01), and the up-regulation was decreased in the withdrawal group (P<0.01). ConclusionDIC can lead to immune and inflammatory disorders. DIC withdrawal can regulate the expression of biomarkers related to serum and spleen metabolites, regulate the inflammatory metabolic pathway, reduce the inflammation level, and alleviate the metabolic disorders, thus attenuating the potential toxicity induced by DIC. 
		                        		
		                        		
		                        		
		                        	
7.Relationship between Helicobacter pylori infection and disease severity and pathological type of inpatients with intestinal polyps
Wei YOU ; Dalin LU ; Yan CHEN ; Xin WANG ; Yizheng FANG ; Lunshan WANG
Journal of Public Health and Preventive Medicine 2025;36(5):85-88
		                        		
		                        			
		                        			Objective  To investigate the relationship between Helicobacter pylori (Hp) infection and disease severity and pathological type of intestinal polyps in inpatients.  Methods  The data of 303 inpatients with intestinal polyps in the hospital from August 2022 to February 2025 were collected and analyzed. The clinical characteristics of patients were analyzed, and the influencing factors of pathological types of polyps were explored.  Results  Among the 303 inpatients with intestinal polyps, there were 135 Hp positive cases and 168 Hp negative cases. The number of polyps, maximum polyp diameter, number of ileocecus/ascending colon/transverse colon polyps, number of descending colon/sigmoid colon/rectal polyps and adenomatous polyps in the Hp-positive group were higher than those in the Hp-negative group (P<0.05). Multivariate logistic regression analysis indicated that age [OR (95%CI)=1.03 (1.01-1.05)] and positive Hp[OR (95%CI)=2.61 (1.62-4.20)] were independent risk factors of occurrence of adenomatous polyps (P<0.05). ROC curve results revealed that the AUCs of age, positive HP and combination in the diagnosis of adenomatous polyps were 0.574, 0.608 and 0.646, and the 95%CI values were 0.509-0.638, 0.545-0.672 and 0.584-0.708 respectively. The efficiency of combination of the two indexes was higher than that of single diagnosis.  Conclusion  Hp infection is associated with disease severity in inpatients with intestinal polyps, and it may be involved in the occurrence and development of adenomatous polyps.
		                        		
		                        		
		                        		
		                        	
8.Relationship between Helicobacter pylori infection and disease severity and pathological type of inpatients with intestinal polyps
Wei YOU ; Dalin LU ; Yan CHEN ; Xin WANG ; Yizheng FANG ; Lunshan WANG
Journal of Public Health and Preventive Medicine 2025;36(5):85-88
		                        		
		                        			
		                        			Objective  To investigate the relationship between Helicobacter pylori (Hp) infection and disease severity and pathological type of intestinal polyps in inpatients.  Methods  The data of 303 inpatients with intestinal polyps in the hospital from August 2022 to February 2025 were collected and analyzed. The clinical characteristics of patients were analyzed, and the influencing factors of pathological types of polyps were explored.  Results  Among the 303 inpatients with intestinal polyps, there were 135 Hp positive cases and 168 Hp negative cases. The number of polyps, maximum polyp diameter, number of ileocecus/ascending colon/transverse colon polyps, number of descending colon/sigmoid colon/rectal polyps and adenomatous polyps in the Hp-positive group were higher than those in the Hp-negative group (P<0.05). Multivariate logistic regression analysis indicated that age [OR (95%CI)=1.03 (1.01-1.05)] and positive Hp[OR (95%CI)=2.61 (1.62-4.20)] were independent risk factors of occurrence of adenomatous polyps (P<0.05). ROC curve results revealed that the AUCs of age, positive HP and combination in the diagnosis of adenomatous polyps were 0.574, 0.608 and 0.646, and the 95%CI values were 0.509-0.638, 0.545-0.672 and 0.584-0.708 respectively. The efficiency of combination of the two indexes was higher than that of single diagnosis.  Conclusion  Hp infection is associated with disease severity in inpatients with intestinal polyps, and it may be involved in the occurrence and development of adenomatous polyps.
		                        		
		                        		
		                        		
		                        	
9.Correlation between APTT mixing test results and inhibitor titers in patients with hemophilia A inhibitor
Tiantian WANG ; Yan CHENG ; Hehe WANG ; Cuicui QIAO ; Jie WANG ; Guangshang ZHONG ; Xiyuan WANG ; Xueqin ZHANG ; Yunhai FANG
Chinese Journal of Blood Transfusion 2025;38(9):1172-1176
		                        		
		                        			
		                        			Objective: To study the correlation between activated partial thromboplastin time (APTT) mixing test results and the inhibitor titers in hemophilia A inhibitor-positive patients. Methods: In this cross-sectional study, 41 patients with severe hemophilia A and inhibitors (and negative for lupus anticoagulant) were included from the hemophilia clinic of Shandong Blood Center from February 2022 to February 2024. All patients underwent APTT mixing test. The Rosner's index (RI, including the immediate RI and the RI after 2-hour water bath incubation [water bath 2h RI]), the time-dependent difference (Δ value), and the corrected percentage were calculated based on results of APTT mixing test. The median (interquartile range) of the corresponding indexes were calculated, and the ROC curves for identification of high inhibitor titers using the four indexes (the immediate RI, the water bath 2h RI, the Δ value, and the corrected percentage) were plotted, The correlations between APTT mixing test and inhibitor titers for coagulation factor Ⅷ (Factor Ⅷ, FⅧ) were investigated. Results: The median (lower quartile, upper quartile) of immediate RI, water bath 2h RI, Δ-value and corrected percentage for FⅧ inhibitor positive patients were 11.0 (5.4, 29.3)%, 45.0 (25.7, 75.0)%, 26.2 (7.6, 41.8) s, and 82.2 (58.5, 91.6)%, respectively. The median (lower quartile, upper quartile) of the immediate RI, water bath 2h RI, Δ-value and corrected percentage were 25.2 (13.0, 37.5)%, 64.1 (44.6, 72.6)%, 38.0 (14.3, 38.3) s, and 66.5 (50.1, 82.1)% for the high-titer inhibitor group, and 5.2 (4.2, 9.4)%, 17.9 (8.8, 28.0)%, 13.0 (7.6, 25.4) s, and 92.3 (88.0, 94.3)% for the low-titer inhibitor group. The AUCs of the ROC curves for discrimination between high and low titer inhibitor were: 0.9105 for immediate RI, 0.9118 for water bath 2h RI, 0.8873 for correcter percentage, and 0.6532 for Δ-value. Conclusion: High-titer inhibitors can be highly suspected in hemophiliac patients with an immediate RI >10% and a water bath 2h RI >45%, and the presence of low-titer inhibitors is suspected in patients with a 4-second < immediate RI <10% and a 13% < water bath 2h RI <45%.
		                        		
		                        		
		                        		
		                        	
10.Gualou Xiebai Banxiatang in Treatment of Cardiovascular Diseases: A Review
Yalong KANG ; Bo NING ; Juanjuan TAN ; Hongfei QI ; Yan SHI ; Fang GUAN ; Haifang WANG
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(2):256-267
		                        		
		                        			
		                        			Cardiovascular diseases (CVD),a group of common diseases in clinical practice,are witnessing a steady rise in both incidence and mortality rates,posing a challenge to public health. Gualou Xiebai Banxiatang,originating from Synopsis of the Golden Chamber (《金匮要略》),was initially used to treat severe cases of chest impediment. The formula consists of Trichosanthis Fructus,Allii Macrostemonis Bulbus,Pinelliae Rhizoma,and Baijiu. It has a wide range of clinical applications,with therapeutic effects including moving Qi to relieve depression,activating Yang to dissipate mass,and expelling phlegm to alleviate chest congestion. In recent years,clinical research has confirmed that Gualou Xiebai Banxiatang,with or without modification,used alone or in combination with Western medicine,has definite effects in the treatment of CVD such as hyperlipidemia,coronary atherosclerotic heart disease,hypertension,heart failure,and arrhythmia. It can alleviate disease symptoms and reduce the risk of re-hospitalization. Basic research indicates that the mechanisms of Gualou Xiebai Banxiatang include improving endothelial functions,exhibiting anti-inflammatory properties,countering oxidative stress,preventing apoptosis,inhibiting ventricular remodeling,regulating mitochondrial functions,improving hemorheology,and modulating autophagy and neurotransmitters. This article reviews relevant articles in recent years with focuses on the compatibility,clinical application,and mechanism of Gualou Xiebai Banxiatang. This review is expected to provide a theoretical basis for the mechanism research and clinical application of this formula in treating CVD and to offer ideas and reference for in-depth research. 
		                        		
		                        		
		                        		
		                        	
            

Result Analysis
Print
Save
E-mail