This experiment aims to study the taste-masking effects of different kinds of corrigent used individually and in combination on ibuprofen oral solution, in order to optimize the taste-masking formulation. Firstly, a wide range of corrigent and the mass fractions were extensively screened using electronic tongue technology. Subsequently, a combination of sensory evaluation, analytic hierarchy process (AHP)-fuzzy mathematics evaluation, and Box-Behnken experimental design were employed to comprehensively assess the taste-masking effects of different combinations of corrigent on ibuprofen oral solution, optimize the taste-masking formulation, and validate the results. The study received ethical approval from the Review Committee of the Beijing University of Chinese Medicine (ethical code: 2024BZYLL0102). The results showed that corrigent fractions and types were screened separately through single-factor experiments. Subsequently, a Box-Behnken response surface design combined with AHP and fuzzy mathematics evaluation was used to fit a functional model: Z = 688.310 11 - 3 023.722 22X₁ - 11.477 00X₂ + 62.721 67X₃ + 14.600 00X₁X₂ - 179.666 67X₁X₃ - 3.152 00X₂X₃ + 4 031.111 11X₁² + 0.525 28X₂² + 9.772 00X₃². This model is stable and reliable, determining the optimal taste-masking formulation to be 3.9 g·L^-1 of stevioside, 100 g L^-1 of xylitol, and 30 g L^-1 of methyl-β-cyclodextrin. The comprehensive score of the verification test is 88.14, with a relative RSD of 0.39%, indicating the feasibility of this model. This study achieved the improvement of the taste of ibuprofen oral solution through a combination of objective and subjective methods. Three types of corrigent were identified for enhancing drug taste, leading to the selection of the optimal taste-masking formulation for ibuprofen oral solution. This significantly enhanced the taste of the original formulation, improved patient compliance, and offered a new approach to mitigating the undesirable taste of formulations.

Objective To explore the relevant risk factors of H.pylori infection,and provide reference for prevention and treatment of H.pylori in this area,and further provide theoretical basis for the prevention and treatment of gastric cancer.Methods A total of 1200 residents in four districts of Haikou city were investigated by questionnaire and urea 14 C breath test by holistic stratified random sampling to calculate the population infection rate and analyze the risk factors of infection.Results The total infection rate was 32.5％,which was lower than the national H.pylori infection rate.No consumption of fruits and vegetables,no habit of washing hands before meals,and people with gastrointestinal symptoms,are independent risk factors of H.pylori infection.No consumption of pickled products is of great significance to prevent H.pylori infection.Conclusion The prevalence of H.pylori infection in the population of Haikou is lower than the national average,and H.pylori infection is closely related to the poor living habits of residents.

The objective of this study was to determine the frequency and resistance patterns of ESBL-producing E.coli in lambs with diarrhea in the Kashi area,Xinjiang.The findings may provide guidance for the prevention and control of clinical E.coli disease.We collected 385 samples of perianal feces from lambs with diarrhea in the Kashgar area.From these samples,we isolated 371 strains of E.coli.We then used the double-paper-sheet synergistic method to screen for ESBL-producing E.coli.Additionally,we conducted analyses to identify drug-resistance genes,analyze drug resistance,and study the phylo-typing of the screened strains.Of 371 E.coli strains,204 were identified as ESBL-producing strains.The prevalence rates of blaCTX-M,blaCTX-M-1G,blaCTX-M-9G,and bla TEM resistance genes was 67.65％,69.12％,30.39％,and 63.73％,respectively.All ESBL-pro-ducing strains were resistant to multiple drugs,with resistance rates ranging from 90.69％to 100％for eight specific drugs:ampicillin,cefotaxime,gentamicin,enrofloxacin,azithromy-cin,tetracycline,chloramphenicol,methotrexate,and amitrazine.The phylogenetic subgroups of the strains were distributed primarily in groups A and D.Among group A strains,41.11％exhibited resistance to ten drugs,whereas among group D strains,40％exhibited resistance to 11 drugs.ESBL-pro-ducing strains of Escherichia coli are the main pathogens cau-sing diarrhea in lambs in the Kashgar region;group A is the main group,and all groups are multi-drug resistant.

Aim To investigate the effect and role of neuronal restriction silencing factor(REST/NRSF)in epilepsy disorder.Methods Immunohistochemistry,immunofluorescence,Western blot and qPCR tech-niques were used to detect REST/NRSF expression levels in hippocampal tissues of mice induced by kainic acid and human brain tissue.Viral injections,EEG re-cordings and behavioral methods were used to test the effects on epileptic mice after knockdown and overex-pression of REST/NRSF in the hippocampal CA1 re-gion,respectively.Results The positive rate of REST/NRSF in the lesions of epileptic patients was significantly higher compared with that in the control group.The levels of REST/NRSF protein and mRNA in the CA1 region of the hippocampus of mice in the KA model group were significantly higher.Kv7.2 and Kv7.3 potassium channel mRNA expression levels were significantly down-regulated.Significant up-regu-lation of REST/NRSF expression levels was observed in mouse hippocampus after NMDA injection.Knock-down of REST/NRSF in the CA1 region of hippocam-pus significantly elevated the expression levels of Kv7.2 and Kv7.3 potassium channel mRNAs.The fre-quency of EEG spiking and sharp-wave issuance and epileptic seizure grade were significantly lower.Over-expression of REST/NRSF in the CA1 region of hippo-campus significantly reduced the mRNA expression lev-els of Kv7.2 and Kv7.3 potassium channels.The fre-quency of EEG spiking and sharp-wave issuance was significantly higher and epileptic symptoms were exac-erbated.Conclusion REST/NRSF in mouse hipp-ocampal brain regions is involved in epileptic disease development through transcriptional regulation of Kv7.2 and Kv7.3 potassium channels.

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Humans ; Factor XIII/genetics* ; Factor XIII Deficiency/genetics* ; Mutation ; Pedigree

Bupleuri Radix is commonly used in the traditional Chinese medicine, and saikosaponins are the important active ingredients. In this study, we first established a relative quantitative method for 25 saikosaponins using ultra high performance liquid chromatography-triple quadrupole mass spectrometry (UHPLC-QTrap-MS) in the scheduled multiple reaction monitoring (sMRM) mode. The established method showed good intra-day and intra-day precision, linearity, repeatability and stability. Then the method was applied to compare 37 batches of Bupleuri Radix from different planting areas. The results showed that there was no significant difference in the saikosaponins composition of Bupleuri Radix from different planting areas in Shanxi Province, which indicating that Bupleuri Radix is well adapted to the environment, so it is suitable for widely planting. However, Bupleuri Radix harvested at spring and autumn were differed from those harvested at summer, which indicated that the traditional harvesting experience was reasonable. Correlation analysis showed that saikosaponins a and d were positively correlated with some saponins, and 4 saponins (such as clinoposaponin XII) showed bigger content variation were identified by coefficient of variation analysis. The LC-MS based pseudotargeted metabonomic method established in this study can be applied to the comprehensive detection of saikosaponins, which providing new method for the quality evaluation of Bupleuri Radix.

Humans ; Treatment Outcome ; Antibodies, Bispecific/adverse effects* ; Precursor Cell Lymphoblastic Leukemia-Lymphoma/drug therapy* ; Antineoplastic Agents/adverse effects* ; Precursor B-Cell Lymphoblastic Leukemia-Lymphoma

Objective: To analyze the clinical epidemiological characteristics including composition of pathogens , clinical characteristics, and disease prognosis acute bacterial meningitis (ABM) in Chinese children. Methods: A retrospective analysis was performed on the clinical and laboratory data of 1 610 children <15 years of age with ABM in 33 tertiary hospitals in China from January 2019 to December 2020. Patients were divided into different groups according to age,<28 days group, 28 days to <3 months group, 3 months to <1 year group, 1-<5 years of age group, 5-<15 years of age group; etiology confirmed group and clinically diagnosed group according to etiology diagnosis. Non-numeric variables were analyzed with the Chi-square test or Fisher's exact test, while non-normal distrituction numeric variables were compared with nonparametric test. Results: Among 1 610 children with ABM, 955 were male and 650 were female (5 cases were not provided with gender information), and the age of onset was 1.5 (0.5, 5.5) months. There were 588 cases age from <28 days, 462 cases age from 28 days to <3 months, 302 cases age from 3 months to <1 year of age group, 156 cases in the 1-<5 years of age and 101 cases in the 5-<15 years of age. The detection rates were 38.8% (95/245) and 31.5% (70/222) of Escherichia coli and 27.8% (68/245) and 35.1% (78/222) of Streptococcus agalactiae in infants younger than 28 days of age and 28 days to 3 months of age; the detection rates of Streptococcus pneumonia, Escherichia coli, and Streptococcus agalactiae were 34.3% (61/178), 14.0% (25/178) and 13.5% (24/178) in the 3 months of age to <1 year of age group; the dominant pathogens were Streptococcus pneumoniae and the detection rate were 67.9% (74/109) and 44.4% (16/36) in the 1-<5 years of age and 5-<15 years of age . There were 9.7% (19/195) strains of Escherichia coli producing ultra-broad-spectrum β-lactamases. The positive rates of cerebrospinal fluid (CSF) culture and blood culture were 32.2% (515/1 598) and 25.0% (400/1 598), while 38.2% (126/330)and 25.3% (21/83) in CSF metagenomics next generation sequencing and Streptococcus pneumoniae antigen detection. There were 4.3% (32/790) cases of which CSF white blood cell counts were normal in etiology confirmed group. Among 1 610 children with ABM, main intracranial imaging complications were subdural effusion and (or) empyema in 349 cases (21.7%), hydrocephalus in 233 cases (14.5%), brain abscess in 178 cases (11.1%), and other cerebrovascular diseases, including encephalomalacia, cerebral infarction, and encephalatrophy, in 174 cases (10.8%). Among the 166 cases (10.3%) with unfavorable outcome, 32 cases (2.0%) died among whom 24 cases died before 1 year of age, and 37 cases (2.3%) had recurrence among whom 25 cases had recurrence within 3 weeks. The incidences of subdural effusion and (or) empyema, brain abscess and ependymitis in the etiology confirmed group were significantly higher than those in the clinically diagnosed group (26.2% (207/790) vs. 17.3% (142/820), 13.0% (103/790) vs. 9.1% (75/820), 4.6% (36/790) vs. 2.7% (22/820), χ²=18.71, 6.20, 4.07, all P<0.05), but there was no significant difference in the unfavorable outcomes, mortility, and recurrence between these 2 groups (all P>0.05). Conclusions: The onset age of ABM in children is usually within 1 year of age, especially <3 months. The common pathogens in infants <3 months of age are Escherichia coli and Streptococcus agalactiae, and the dominant pathogen in infant ≥3 months is Streptococcus pneumoniae. Subdural effusion and (or) empyema and hydrocephalus are common complications. ABM should not be excluded even if CSF white blood cell counts is within normal range. Standardized bacteriological examination should be paid more attention to increase the pathogenic detection rate. Non-culture CSF detection methods may facilitate the pathogenic diagnosis.
Adolescent ; Brain Abscess ; Child ; Child, Preschool ; Escherichia coli ; Female ; Humans ; Hydrocephalus ; Infant ; Infant, Newborn ; Male ; Meningitis, Bacterial/epidemiology* ; Retrospective Studies ; Streptococcus agalactiae ; Streptococcus pneumoniae ; Subdural Effusion ; beta-Lactamases

OBJECTIVES: To investigate the clinical treatment outcomes and the changes of the outcomes over time in extremely preterm twins in Guangdong Province, China. METHODS: A retrospective analysis was performed for 269 pairs of extremely preterm twins with a gestational age of <28 weeks who were admitted to the department of neonatology in 26 grade A tertiary hospitals in Guangdong Province from January 2008 to December 2017. According to the admission time, they were divided into two groups: 2008-2012 and 2013-2017. Besides, each pair of twins was divided into the heavier infant and the lighter infant subgroups according to birth weight. The perinatal data of mothers and hospitalization data of neonates were collected. The survival rate of twins and the incidence rate of complications were compared between the 2008-2012 and 2013-2017 groups. RESULTS: Compared with the 2008-2012 group, the 2013-2017 group (both the heavier infant and lighter infant subgroups) had lower incidence rates of severe asphyxia and smaller head circumference at birth (P<0.05). The mortality rates of both of the twins, the heavier infant of the twins, and the lighter infant of the twins were lower in the 2013-2017 group compared with the 2008-2012 group (P<0.05). Compared with the 2008-2012 group, the 2013-2017 group (both the heavier infant and lighter infant subgroups) had lower incidence rates of pulmonary hemorrhage, patent ductus arteriosus (PDA), periventricular-intraventricular hemorrhage (P-IVH), and neonatal respiratory distress syndrome (NRDS) and a higher incidence rate of bronchopulmonary dysplasia (P<0.05). CONCLUSIONS There is a significant increase in the survival rate over time in extremely preterm twins with a gestational age of <28 weeks in the 26 grade A tertiary hospitals in Guangdong Province. The incidences of severe asphyxia, pulmonary hemorrhage, PDA, P-IVH, and NRDS decrease in both the heavier and lighter infants of the twins, but the incidence of bronchopulmonary dysplasia increases. With the improvement of diagnosis and treatment, the multidisciplinary collaboration between different fields of fetal medicine including prenatal diagnosis, obstetrics, and neonatology is needed in the future to jointly develop management strategies for twin pregnancy.
Bronchopulmonary Dysplasia/epidemiology* ; Female ; Gestational Age ; Humans ; Infant ; Infant, Extremely Premature ; Infant, Newborn ; Pregnancy ; Respiratory Distress Syndrome, Newborn/epidemiology* ; Retrospective Studies ; Treatment Outcome