1.Mechanism of Qilin pills in the treatment of asthenozoospermia: Based on HPLC-MS combined with bioinformatics.
Chun-Ling WANG ; Yu-Rong XU ; Ya-Xu JIA ; Jia LIU ; Li-L HUANG ; Bai-Hao CHEN
National Journal of Andrology 2025;31(7):579-590
OBJECTIVE:
The aim of this study is to investigate the main active substances of Qilin pills by high performance liquid chromatogre-electrostatic field orbitrap mass spectrometry (HPLC-Q-Orbitrap /MS), and explore the mechanism of its action in the treatment of asthenozoospermia by combining network pharmacology and molecular docking.
METHODS:
(1) Qilin pills were quantitatively and qualitatively analyzed by HPLC-Q-Orbitrap /MS. (2) The top 100 compounds in Qilin pills were screened by content analysis and SwissADME, and their targets were predicted. The asthenozoospermia targets were searched through the database. And a "protein-protein interaction" (PPI) network was constructed. KEGG and GO analysis was performed using the DAVID database. And a "drug-target-pathway" network was constructed. (3) SailVina was used for molecular docking.
RESULTS:
(1) A total of 1 275 known components were found and ranked in Qilin pills by HPLC-Q-Orbitrap /MS analysis. (2) The top 100 compounds in Qilin pills predicted a total of 1 053 targets and 184 potential therapeutic targets for asthenozoospermia. KEGG pathway analysis and GO analysis showed that the treatment of asthenozoospermia by Qilin pills may be related to the steroid hormone synthesis pathway, the response to steroid hormones, the chromosomal region of cells and the activity of steroid hydroxylase. The mechanism of Qilin pills in treating asthenozoospermia may be related to regulating the synthesis, metabolism and reaction process of sex hormone in the body. (3) The molecular docking results of its key targets (CYP19A1, ESR1, HSP90AA1, p53, HIF1α and BCL2) showed that the key active ingredients M030, M039, M043, M050, M055 and M073 of Qilin pills had spontaneous binding. It had a binding energy of less than -5 kJ /mol.
CONCLUSION
The material basis of Qilin pills has been explored by this study. And the mechanism of action of Qilin pills in the treatment of asthenozoospermia is highly bound to the expression and response process of steroid hormones, which provides a theoretical basis for the clinical application of Qilin pills.
Asthenozoospermia/drug therapy*
;
Chromatography, High Pressure Liquid
;
Molecular Docking Simulation
;
Drugs, Chinese Herbal/chemistry*
;
Male
;
Computational Biology
;
Humans
;
Mass Spectrometry
;
Protein Interaction Maps
;
Liquid Chromatography-Mass Spectrometry
2.Association of Body Mass Index with All-Cause Mortality and Cause-Specific Mortality in Rural China: 10-Year Follow-up of a Population-Based Multicenter Prospective Study.
Juan Juan HUANG ; Yuan Zhi DI ; Ling Yu SHEN ; Jian Guo LIANG ; Jiang DU ; Xue Fang CAO ; Wei Tao DUAN ; Ai Wei HE ; Jun LIANG ; Li Mei ZHU ; Zi Sen LIU ; Fang LIU ; Shu Min YANG ; Zu Hui XU ; Cheng CHEN ; Bin ZHANG ; Jiao Xia YAN ; Yan Chun LIANG ; Rong LIU ; Tao ZHU ; Hong Zhi LI ; Fei SHEN ; Bo Xuan FENG ; Yi Jun HE ; Zi Han LI ; Ya Qi ZHAO ; Tong Lei GUO ; Li Qiong BAI ; Wei LU ; Qi JIN ; Lei GAO ; He Nan XIN
Biomedical and Environmental Sciences 2025;38(10):1179-1193
OBJECTIVE:
This study aimed to explore the association between body mass index (BMI) and mortality based on the 10-year population-based multicenter prospective study.
METHODS:
A general population-based multicenter prospective study was conducted at four sites in rural China between 2013 and 2023. Multivariate Cox proportional hazards models and restricted cubic spline analyses were used to assess the association between BMI and mortality. Stratified analyses were performed based on the individual characteristics of the participants.
RESULTS:
Overall, 19,107 participants with a sum of 163,095 person-years were included and 1,910 participants died. The underweight (< 18.5 kg/m 2) presented an increase in all-cause mortality (adjusted hazards ratio [ aHR] = 2.00, 95% confidence interval [ CI]: 1.66-2.41), while overweight (≥ 24.0 to < 28.0 kg/m 2) and obesity (≥ 28.0 kg/m 2) presented a decrease with an aHR of 0.61 (95% CI: 0.52-0.73) and 0.51 (95% CI: 0.37-0.70), respectively. Overweight ( aHR = 0.76, 95% CI: 0.67-0.86) and mild obesity ( aHR = 0.72, 95% CI: 0.59-0.87) had a positive impact on mortality in people older than 60 years. All-cause mortality decreased rapidly until reaching a BMI of 25.7 kg/m 2 ( aHR = 0.95, 95% CI: 0.92-0.98) and increased slightly above that value, indicating a U-shaped association. The beneficial impact of being overweight on mortality was robust in most subgroups and sensitivity analyses.
CONCLUSION
This study provides additional evidence that overweight and mild obesity may be inversely related to the risk of death in individuals older than 60 years. Therefore, it is essential to consider age differences when formulating health and weight management strategies.
Humans
;
Body Mass Index
;
China/epidemiology*
;
Male
;
Female
;
Middle Aged
;
Prospective Studies
;
Rural Population/statistics & numerical data*
;
Aged
;
Follow-Up Studies
;
Adult
;
Mortality
;
Cause of Death
;
Obesity/mortality*
;
Overweight/mortality*
3.Survey on the current status of Helicobacter pylori infection and related risk factors in Haikou city
Xiao-Dong ZHANG ; Da-Ya ZHANG ; Shi-Ju CHEN ; Run-Xiang CHEN ; Yan ZHOU ; Ling WEI ; Chang-Jiang LIU ; Yun-Qian XIE ; Fei-Hu BAI
Modern Interventional Diagnosis and Treatment in Gastroenterology 2024;29(4):393-397
Objective To explore the relevant risk factors of H.pylori infection,and provide reference for prevention and treatment of H.pylori in this area,and further provide theoretical basis for the prevention and treatment of gastric cancer.Methods A total of 1200 residents in four districts of Haikou city were investigated by questionnaire and urea 14 C breath test by holistic stratified random sampling to calculate the population infection rate and analyze the risk factors of infection.Results The total infection rate was 32.5%,which was lower than the national H.pylori infection rate.No consumption of fruits and vegetables,no habit of washing hands before meals,and people with gastrointestinal symptoms,are independent risk factors of H.pylori infection.No consumption of pickled products is of great significance to prevent H.pylori infection.Conclusion The prevalence of H.pylori infection in the population of Haikou is lower than the national average,and H.pylori infection is closely related to the poor living habits of residents.
4.The taste correction process of ibuprofen oral solution based on the combination of electronic tongue technology and artificial taste comprehensive evaluation
Rui YUAN ; Yun-ping QU ; Yan WANG ; Ya-xuan ZHANG ; Wan-ling ZHONG ; Xiao-yu FAN ; Hui-juan SHEN ; Yun-nan MA ; Jin-hong YE ; Jie BAI ; Shou-ying DU
Acta Pharmaceutica Sinica 2024;59(8):2404-2411
This experiment aims to study the taste-masking effects of different kinds of corrigent used individually and in combination on ibuprofen oral solution, in order to optimize the taste-masking formulation. Firstly, a wide range of corrigent and the mass fractions were extensively screened using electronic tongue technology. Subsequently, a combination of sensory evaluation, analytic hierarchy process (AHP)-fuzzy mathematics evaluation, and Box-Behnken experimental design were employed to comprehensively assess the taste-masking effects of different combinations of corrigent on ibuprofen oral solution, optimize the taste-masking formulation, and validate the results. The study received ethical approval from the Review Committee of the Beijing University of Chinese Medicine (ethical code: 2024BZYLL0102). The results showed that corrigent fractions and types were screened separately through single-factor experiments. Subsequently, a Box-Behnken response surface design combined with AHP and fuzzy mathematics evaluation was used to fit a functional model:
5.Drug resistance and phylo-typing of ESBL-producing Escherichia coli from diarrheic lambs in Kashgar area,Xinjiang
Yun HU ; Bai-Li ZHENG ; Wei-Li CHEN ; Ya-Ling CHENG ; Lan MA ; Pan-Pan TONG ; Ying-Yu LIU
Chinese Journal of Zoonoses 2024;40(8):716-722
The objective of this study was to determine the frequency and resistance patterns of ESBL-producing E.coli in lambs with diarrhea in the Kashi area,Xinjiang.The findings may provide guidance for the prevention and control of clinical E.coli disease.We collected 385 samples of perianal feces from lambs with diarrhea in the Kashgar area.From these samples,we isolated 371 strains of E.coli.We then used the double-paper-sheet synergistic method to screen for ESBL-producing E.coli.Additionally,we conducted analyses to identify drug-resistance genes,analyze drug resistance,and study the phylo-typing of the screened strains.Of 371 E.coli strains,204 were identified as ESBL-producing strains.The prevalence rates of blaCTX-M,blaCTX-M-1G,blaCTX-M-9G,and bla TEM resistance genes was 67.65%,69.12%,30.39%,and 63.73%,respectively.All ESBL-pro-ducing strains were resistant to multiple drugs,with resistance rates ranging from 90.69%to 100%for eight specific drugs:ampicillin,cefotaxime,gentamicin,enrofloxacin,azithromy-cin,tetracycline,chloramphenicol,methotrexate,and amitrazine.The phylogenetic subgroups of the strains were distributed primarily in groups A and D.Among group A strains,41.11%exhibited resistance to ten drugs,whereas among group D strains,40%exhibited resistance to 11 drugs.ESBL-pro-ducing strains of Escherichia coli are the main pathogens cau-sing diarrhea in lambs in the Kashgar region;group A is the main group,and all groups are multi-drug resistant.
6.Role and mechanism of neuronal restriction silencing factor REST/NRSF in regulation of epilepsy
Hui LIU ; Bai-Hui YU ; Ya-Qi WANG ; Yi-Ling CHEN ; Zi-Hao CHENG ; Jia-Rui MA ; Zi-Shuo KANG ; Fan ZHANG
Chinese Pharmacological Bulletin 2024;40(9):1727-1734
Aim To investigate the effect and role of neuronal restriction silencing factor(REST/NRSF)in epilepsy disorder.Methods Immunohistochemistry,immunofluorescence,Western blot and qPCR tech-niques were used to detect REST/NRSF expression levels in hippocampal tissues of mice induced by kainic acid and human brain tissue.Viral injections,EEG re-cordings and behavioral methods were used to test the effects on epileptic mice after knockdown and overex-pression of REST/NRSF in the hippocampal CA1 re-gion,respectively.Results The positive rate of REST/NRSF in the lesions of epileptic patients was significantly higher compared with that in the control group.The levels of REST/NRSF protein and mRNA in the CA1 region of the hippocampus of mice in the KA model group were significantly higher.Kv7.2 and Kv7.3 potassium channel mRNA expression levels were significantly down-regulated.Significant up-regu-lation of REST/NRSF expression levels was observed in mouse hippocampus after NMDA injection.Knock-down of REST/NRSF in the CA1 region of hippocam-pus significantly elevated the expression levels of Kv7.2 and Kv7.3 potassium channel mRNAs.The fre-quency of EEG spiking and sharp-wave issuance and epileptic seizure grade were significantly lower.Over-expression of REST/NRSF in the CA1 region of hippo-campus significantly reduced the mRNA expression lev-els of Kv7.2 and Kv7.3 potassium channels.The fre-quency of EEG spiking and sharp-wave issuance was significantly higher and epileptic symptoms were exac-erbated.Conclusion REST/NRSF in mouse hipp-ocampal brain regions is involved in epileptic disease development through transcriptional regulation of Kv7.2 and Kv7.3 potassium channels.
8.Quality evaluation of Bupleuri Radix in Shanxi Province by LC-MS based pseudotargeted metabonomics
Xue BAI ; Ya-xuan GUO ; Ai-ling XU ; Xiao-xia GAO ; Xue-mei QIN ; Xiao-min WANG ; Zhen-yu LI
Acta Pharmaceutica Sinica 2023;58(7):1963-1970
Bupleuri Radix is commonly used in the traditional Chinese medicine, and saikosaponins are the important active ingredients. In this study, we first established a relative quantitative method for 25 saikosaponins using ultra high performance liquid chromatography-triple quadrupole mass spectrometry (UHPLC-QTrap-MS) in the scheduled multiple reaction monitoring (sMRM) mode. The established method showed good intra-day and intra-day precision, linearity, repeatability and stability. Then the method was applied to compare 37 batches of Bupleuri Radix from different planting areas. The results showed that there was no significant difference in the saikosaponins composition of Bupleuri Radix from different planting areas in Shanxi Province, which indicating that Bupleuri Radix is well adapted to the environment, so it is suitable for widely planting. However, Bupleuri Radix harvested at spring and autumn were differed from those harvested at summer, which indicated that the traditional harvesting experience was reasonable. Correlation analysis showed that saikosaponins a and d were positively correlated with some saponins, and 4 saponins (such as clinoposaponin XII) showed bigger content variation were identified by coefficient of variation analysis. The LC-MS based pseudotargeted metabonomic method established in this study can be applied to the comprehensive detection of saikosaponins, which providing new method for the quality evaluation of Bupleuri Radix.
9.Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4
Tingting YANG ; Shuzhen MA ; Ling LYU ; Yuan CHEN ; Ya′nan ZHANG ; Xinli BAI
Chinese Journal of Applied Clinical Pediatrics 2023;38(6):457-460
Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Result Analysis
Print
Save
E-mail