1.Interpretation of perioperative immunotherapy for lung cancer in 2024 WCLC/ESMO
Jiahe LI ; Xiaopeng REN ; Jiayu LU ; Chenyuan ZHANG ; Ruitao FAN ; Xuxu ZHANG ; Xinyao XU ; Guizhen LI ; Jipeng ZHANG ; Wei LI ; Qiang LU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(03):300-307
The 2024 World Conference on Lung Cancer (WCLC) and the European Society for Medical Oncology (ESMO) Annual Meeting, two of the most prestigious events in oncology, have concluded sequentially. As the most authoritative annual gatherings in lung cancer and the entire oncology field, the WCLC and ESMO conferences brought together top oncology experts and scientists from around the world to share, discuss, and publish the latest cutting-edge advancements in oncology. In both conferences, lung cancer immunotherapy remained a hot topic of considerable interest. This article aims to summarize and discuss the important research progress on perioperative immunotherapy for non-small cell lung cancer reported at the two conferences.
2.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
3.Interpretation of advances in the treatment of esophageal cancer and gastroesophageal junction cancer at the 2025 American Society of Clinical Oncology Gastrointestinal Cancers Symposium (ASCO-GI)
Jiahe LI ; Jiayu LU ; Xuxu ZHANG ; Xinyao XU ; Jipeng ZHANG ; Wei LI ; Guizhen LI ; Qiang LU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(06):771-778
The 2025 American Society of Clinical Oncology Gastrointestinal Cancers Symposium (ASCO-GI) was held from January 23 to 25, 2025. Several significant studies on the treatment of esophageal and gastroesophageal junction (GEJ) cancer were presented at the symposium, highlighting notable advances, particularly in the perioperative and advanced settings. Immunotherapy has demonstrated significant promise in the neoadjuvant treatment of esophageal cancer, showing potential to become a standard treatment. Furthermore, the long-term survival benefits of combining immunotherapy with chemotherapy for advanced GEJ cancer were further validated. This article summarizes and interprets the researches presented at the symposium concerning perioperative and advanced treatments for esophageal and GEJ cancers.
4.Interpretation of advances in immune therapy for non-small cell lung cancer at the 2025 European Lung Cancer Congress
Wen LIU ; Jiayu LU ; Xuxu ZHANG ; Xinyao XU ; Jipeng ZHANG ; Wei LI ; Guizhen LI ; Bo BAO ; Qiang LU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(08):1063-1071
The 2025 European Lung Cancer Congress (ELCC) convened in Paris, France, centering on the optimization and innovation of immunotherapy for non-small cell lung cancer (NSCLC). Key topics at the congress included the application strategies for perioperative immunotherapy, breakthroughs in combination therapy models for advanced NSCLC, and the emerging roles of biomarkers in predicting diverse treatment outcomes. This paper integrates data from several key pivotal studies to systematically analyze the clinical value of neoadjuvant therapy within the perioperative setting, the potential of targeted combination regimens, and the challenges of managing drug resistance, thus offering new directions for clinical practice.
5.A meta-analysis of prevalent characteristics of injury-related behaviors among adolescents based on Chinese literature
Xiaodi BAI ; Yunlan JIANG ; Ting XU ; Siyu LIN ; Heyao XU ; Shulan LIU ; Xinyao ZHOU
Shanghai Journal of Preventive Medicine 2024;36(10):969-976
ObjectiveTo conduct a meta-analysis of the prevalent characteristics of the injury-related behaviors among adolescents in China based on Chinese literature, so as to inform the prevention and control of injury-related behaviors of this population. MethodsA cross-sectional study on the prevalent characteristics of adolescent injury-related behaviors was conducted with the data collected from CNKI, VIP, Wanfang Data, CBM, PubMed, and Web of Science. The review included publications from the inception of the databases to November 2023. Meta-analysis was performed with Stata 15.1 software. ResultsA total of 40 articles were included in this study, and the meta-analysis results showed that cycling violation rate was 38% (95%CI: 32%‒43%), walking violation rate was 29% (95%CI: 22%‒36%), rate of unsafe swimming was 13% (95%CI: 11%‒14%), suicidal ideation rate was 13% (95%CI: 12%‒15%) and the prevalence of fighting was 19% (95%CI: 17%‒22%). Subgroup analysis showed that the cycling violation rate was (44%) for boys and 34% (95%CI: 28%‒40%) for girls. Adolescents in Northeast, East, and Southwest of China had the highest rate of cycling violation (44%), of which junior high school students had the highest rate of violation [42% (95%CI: 36%‒49%)]. As for the walking violation rate, male students [29% (95%CI: 21%‒37%)] was higher than that of female students [22% (95%CI: 15%‒30%)]. Adolescents in North of China had the highest rate of walking violation [54% (95%CI: 30%‒76%)], of which vocational school students accounted for 38% (95%CI:21%‒56%) of the total violation. In terms of the detection rate of unsafe swimming, male students [18% (95%CI: 14%‒24%)] was higher than that of female students [8% (95%CI: 6%‒10%)]. Adolescents in Central South China had the highest rate of unsafe swimming [15% (95%CI: 12%‒18%)], of which, vocational school students accounted for the highest [15% (95%CI: 10%‒19%)]. When it comes to the prevalence of suicidal ideation, female students [16% (95%CI: 13%‒19%)] was higher than that of male students [13% (95%CI: 11%‒15%)]. Adolescents in Southwest of China had the highest rate of suicidal ideation [17% (95%CI: 10%‒25%)], of which high school students accounted for the highest [15% (95%CI: 12%‒18%)]. Finally, the detection rate of fights was 30% (95%CI: 26%‒34%) for boys and 11% (95%CI: 10%‒14%) for girls. Adolescents from Southwest of China had the highest rate [29% (95%CI: 24%‒34%)] for fights, and junior high school students accounted for the highest [26% (95%CI: 22%‒31%)]. ConclusionThe prevalence of harmful behaviors among adolescents in China is notably high, with statistical differences across gender, region, and school stages. These behaviors pose a risk to adolescent health, underscoring the need for targeted interventions by health and educational authorities.
6.Technical points of modular operation and standard procedure for three-port anterior mediastinal thymic disease surgery via subxiphoid approach: Experience of Tangdu Hospital
Jipeng ZHANG ; Yongan ZHOU ; Jinbo ZHAO ; Chenghui JIA ; Xinyao XU ; Guangyu XIANG ; Jiahe LI ; Qiang LU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2024;31(12):1735-1742
Surgery is an important treatment for the anterior mediastinal disease. With the rapid development of minimally invasive techniques, complete resection of the lesion in most patients with thymic disease can be achieved through thoracoscopic surgery. Practice has proved that the three-port resection of anterior mediastinal thymus disease via the subxiphoid approach is an ideal surgical method for the treatment of anterior mediastinal thymic tumors at present, which has strong popularization and popularity and can benefit the patients. The procedure focuses primarily on the anterior and upper mediastinum and can thoroughly expose the anatomy of the mediastinum and both sides, with minimal intraoperative bleeding, high safety, minimal trauma and postoperative pain, and a short hospital stay. It has clear advantages over conventional thoracic open-heart surgery and transversal resection. However, the surgical approach and field of view, and intraoperative precautions of this procedure are completely different from those of previous thoracoscopic procedures, and from the subxiphoid single-port approach adopted by other centers. Based on 10 years of surgical experience at our center, a modular mode of surgical operation has been developed and its procedure has been standardized. This paper will share and discuss relevant operational points and experiences.
7.Interpretation of the progress in esophageal cancer treatment in the 2024 American Society of Clinical Oncology Gastrointestinal Cancer Symposium
Xuxu ZHANG ; Junhai LI ; Xinyao XU ; Jiahe LI ; Jipeng ZHANG ; Wei LI ; Lei WANG ; Qiang LU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2024;31(06):807-813
The 2024 American Society of Clinical Oncology Gastrointestinal Cancers Symposium (ASCO-GI) was held in San Francisco, the USA from January 18th to 20th, 2024 (local time). The multiple studies presented in this symposium will have a significant impact on the clinical practice of esophageal cancer. This article will focus on the surgical methods of esophageal cancer, perioperative immunotherapy, drug therapy for advanced esophageal cancer, rescue treatment after immunotherapy resistance, and other relevant aspects. It aims to summarize and interpret the significant advancements in the field of esophageal cancer presented in this symposium.
8.Construction and application of informatization management system for clinical microbial specimen submission
Peng JIANG ; Jie XU ; Wei FENG ; Huizhe LU ; Xinyao ZHANG ; Jicheng YAN ; Xuanding WANG
Chinese Journal of Hospital Administration 2024;40(5):356-361
To effectively play the guiding role of pathogenic diagnosis in the rational use of antibiotics, hospitals at all levels urgently need to establish an effective control system for clinical microbial specimen submission. In response to the common problems in medical institutions in China, such as the low rate of microbiological specimen submission before antibiotic treatment, unreasonable structure of microbiological specimens, and the majority of morning sputum and urine specimens collected for pathogen testing, the Second Affiliated Hospital of Zhejiang University School of Medicine has constructed a management system for clinical microbiological specimen submission using artificial intelligence technology. It used a built-in intelligent rule engine to implement full process control over the sampling and submission of microbiological specimens by doctors when prescribing antibiotics, urge doctors to implement the requirement of collecting samples before using antibiotics for treatment, and recommend priority the collection of sterile specimens. In addition, the hospital transformed the laboratory and testing process with the goal of receiving microbial samples 24 hours without interruption and inoculating in real-time. The informatization management system began to be applied throughout the hospital in December 2015. The average rate of microbial sample submission before the first therapeutic use of antibiotics from June 2016 to 2023 was 79.2%, an increase of 90.2 percentage points from 41.7% in June 2014 ( χ2=467.781, P<0.01). The structure of microbial specimens continued to be optimized, and the proportion of sterile specimens in all submitted specimens increased from 47.2% in 2014 to 49.9% in 2023 ( χ2=139.119, P<0.01). The proportion of morning sputum and morning urine specimens decreased from 65.2% and 60.6% in 2014 to 11.1% and 16.9% in 2023, respectively ( χ2 values were 19 787.434 and 4 346.664, respectively, P<0.01), providing a more reliable basis for pathogenic diagnosis in clinical practice and providing reference for improving the management of pathogenic specimen submission in medical institutions.
9.The application value of SWE in early hepatic fibrosis and renal fibrosis in MAFLD
Mengmeng QIAN ; Xiaochen GUO ; Pengfei WANG ; Xiu CHEN ; Xinyao WU ; Chunpeng ZOU ; Maosheng XU
China Modern Doctor 2024;62(33):23-27
Objective To explore the value of shear wave elastography(SWE)in the early assessment of hepatic and renal fibrosis in patients with metabolic associated fatty liver disease(MAFLD).Methods A total of 52 MAFLD patients admitted to the Second Affiliated Hospital of Wenzhou Medical University from July 2023 to May 2024 were selected as MAFLD group,and 40 non-MAFLD patients treated during the same period were served as control group.General information,laboratory data and ultrasound data were collected and compared between two groups.The differences as well as the correlation of the indicators between two groups were compared.The value of SWE in hepatic fibrosis and renal fibrosis in MAFLD patients was assessed.Results Liver function indicators,uric acid and aspartate aminotransferase-to-platelet ratio index(APRI)in MAFLD group were higher than those in control group(P<0.01);There were no statistically significant differences between two groups in fibrosis 4 index,estimated glomerular filtration rate,serum creatinine and blood urea nitrogen(P>0.05).The brightness of the liver,liver-kidney ratio,and liver elasticity value were higher in MAFLD group than those in control group(P<0.05);There was no significant difference in the elasticity value of the right renal cortex between two groups(P>0.05).Liver elasticity values was positively correlated with alanine aminotransferase(ALT);The liver-kidney ratio was positively correlated with body mass index(BMI),ALT,aspartate aminotransferase,alkaline phosphatase,y-glutamyl transferase and APRI.No significant correlation was found between the right renal cortex elasticity and BMI,estimated glomerular filtration rate,serum creatinine,blood urea nitrogen,or serum uric acid.Conclusion SWE helps in early identification of liver hardness in the MAFLD patients.But the application of SWE in early renal fibrosis in the MAFLD patients needs further evaluation.
10.Mining and analysis of adverse drug event signals related to macitentan
Zhenhu WU ; Xinyao CHEN ; Yaoxin CHEN ; Yinji XU
China Pharmacy 2024;35(13):1628-1633
OBJECTIVE To mine adverse drug event (ADE) signals related to the pulmonary arterial hypertension (PAH) therapeutic drug macitentan, and to provide reference for safe clinical medication. METHODS Macitentan-related ADE reports were collected from the US FDA Adverse Event Reporting System (FAERS) database from the fourth quarter of 2013 to the third quarter of 2023. Data mining was conducted by using the reporting odds ratio (ROR) method and the comprehensive standard method established by the UK Medicines and Healthcare Products Regulatory Agency (referred to as “MHRA method”) under the proportional imbalance approach. According to the systemic organ class (SOC) and preferred term (PT) stated in 26.0 edition of Medical Dictionary of Regulatory Activities, standardized coding of ADE names was performed, followed by the analysis of time to onset (TTO) and the Weibull shape parameter (WSP) test. RESULTS Overall, a total of 26 079 ADE reports were identified with macitentan as the primary suspect drug. These reports predominantly involved female patients (73.25%) and were concentrated in the age range of 18 to 65 years (42.39%). The majority of reports originated from the US (84.42%), with hospitalization or prolonged hospital stays (59.82%) being the most common in severe treatment outcome. A total of 269 ADE positive signals related to macitentan were identified. Among these, hypothyroidism, ADE related to renal injury such as the increase of serum creatinine and blood urea nitrogen, and ADE related to psychiatric disorders like apathy and despair were not included in the drug label. TTO analysis indicated that the majority of macitentan-related ADE signals occurred between 0-30 days after initial treatment (492 reports, 21.52%) and over 360 days (411 reports, 17.98%). The results of WSP test showed that most of the top 20 reported ADE signals conformed to the characteristics of an early failure curve. CONCLUSIONS When clinically using macitentan in patients with PAH, attention should be given not only to the adverse reactions mentioned on the drug label but also to thyroid dysfunction, kidney dysfunction and mental disorder-related ADEs.

Result Analysis
Print
Save
E-mail