1.China’s participation in schistosomiasis control in Africa: value and practice of the trinity model
Jian HE ; Xinyao WANG ; Yuzheng HUANG ; Juma SALEH ; Ally MAYASSA ; Xiaonong ZHOU ; Kun YANG
Chinese Journal of Schistosomiasis Control 2025;37(1):1-7
As a neglected tropical disease, schistosomiasis remains a major public health challenge in underdeveloped areas, notably Africa. Currently, the national schistosomiasis control programmes in Africa mainly depend on foreign aids; however, conventional international aid models have multiple limitations. To enhance the effectiveness and sustainability of global schistosomiasis control programmes, this article proposes a trinity collaboration model based on international rules, China’s experiences and local needs, which is explained with China aid project of schistosomiasis control in Zanzibar as an example. Based on the successful experiences from the national schistosomiasis control programme in China, this model emphasizes the compliance with World Health Organization guidelines and fully considers local actual needs to promote the effectiveness and sustainability of the schistosomiasis control programme through integrating international resources and promoting China’s experience to meet local needs. The successful practice of the China aid project of schistosomiasis control in Zanzibar provides strong evidence that the model is of great theoretical significance and practical value to improve the efficiency of multilateral collaboration and promote global health governance.
2.Effect and mechanism of paeonol in regulating NF-κB/HIF-1α signaling pathway to inhibit the migration of bladder cancer T24 cells
Xinyao AI ; Wenjia CHEN ; Xi CHEN ; Yingzheng WANG ; Yinghao WANG ; Meixia HUANG
China Pharmacy 2025;36(15):1871-1875
OBJECTIVE To investigate the role and mechanism of paeonol in inhibiting the migration of bladder cancer T24 cells by regulating nuclear factor κB (NF-κB)/hypoxia-inducible factor-1α (HIF-1α)-mediated aerobic glycolysis. METHODS T24 cells were divided into control group, cisplatin group (positive control, 3.001 μg/mL), and paeonol low-, medium- and high-dose groups (100, 200, 400 μg/mL), respectively. After 24 h of administration intervention, the effect of paeonol on the migration ability of T24 cells was detected (expressed by the cell scratch wound healing rate). The effect of paeonol on the mitochondrial membrane potential of T24 cells was detected (expressed by the ratio of red/green fluorescence intensity). Cellular adenosine triphosphate (ATP) levels and lactate content in T24 cells were measured. The levels of NF-κB/HIF-1α signaling pathway, the expression of migration-related proteins, and key enzymes involved in aerobic glycolysis in the cells were all determined. RESULTS Compared with the control group, the cell scratch wound healing rates in the paeonol medium- and high-dose groups and the cisplatin group were decreased significantly (P<0.01); in the paeonol groups, the expression levels of NF-κB/HIF-1α signaling pathway-related proteins such as NF- κB and HIF-1α, migration-related proteins such as matrix metalloproteinase 2 (MMP2), MMP9, and vascular endothelial growth factor, as well as key enzymes involved in aerobic glycolysis such as glucose transporter 1, hexokinase 2 and pyruvate kinase isozyme type M2, were all reduced to varying degrees in the cells, most of these reductions showed statistically significant differences (P<0.05 or P<0.01); the ratio of red/green fluorescence intensity in mitochondria of cells in the medium- and high-dose paeonol groups were significantly decreased (P<0.01); the ATP concentration in cells of the paeonol high-dose group, and the lactate content in cells across all paeonol groups were significantly decreased (P<0.05 or P<0.01). CONCLUSIONS Paeonol significantly inhibits the migration of bladder cancer T24 cells, and its mechanism of action may be related to the inhibition of the NF-κB/HIF-1α signaling pathway, and the down-regulation of key enzyme activities involved in aerobic glycolysis.
3.Analysis of the Treatment Strategy of Heart Failure with Preserved Ejection Fraction Based on ZHANG Boli's Theory of “Damp-turbidity and Phlegm-rheum Type of Diseases”
Guangning QIN ; Xinyao JIN ; Yaoyuan LIU ; Kai WANG ; Feng JIANG ; Ming HUANG
Journal of Traditional Chinese Medicine 2024;65(1):35-38
Professor ZHANG Boli believed that the core pathogenesis of heart failure with preserved ejection fraction (HFpEF) is weak pulse at yang and wiry pulse at yin. By referring to the theory of “damp-turbidity and phlegm-rheum type of diseases”, he proposed that yin pathogens of damp-turbidity and phlegm-rheum may damage yang qi in each stage of HFpEF, thus aggravating the trend of weak pulse at yang and wiry pulse at yin, which played an important role in the deterioration of HFpEF. Therefore, Professor ZHANG Boli advocated that importance should be attached to the elimination of yin pathogen and the protection of yang qi during the various stages of HFpEF in order to delay the aggravation of weak pulse at yang and wiry pulse at yin; he put forward the idea of staged treatment that “yin pathogen should be dispelled and yang qi should be demonstrated”; and he formulated the treatment strategy of treating the disease as early as possible, eliminating pathogens and protecting yang, interrupting the disease trend, using warm-like medicinals, and activating blood circulation, to enrich the theoretical system of traditional Chinese medicine in the treatment of HFpEF.
4.Relation of negative life events,neuroticism and exercise frequency to depressive symptoms in college freshmen
Wei ZHANG ; Xingmeng NIU ; Xinyao ZHANG ; Yiju WANG ; Yan QIN ; Yunxuan XIA ; Fuqin MU ; Yueqin HUANG ; Shumin BO ; Yan LIU
Chinese Mental Health Journal 2024;38(11):996-1002
Objective:Analyzing the relationship between negative life events and depressive symptoms in university freshmen,and the mediating effects of neuroticism and the moderating role of exercise frequency.Meth-ods:A sampling of 8 079 university freshmen,and the Patient Health Questionnaire was used to assess depressive symptoms,the Eysenck Personality Inventory-Neuroticism subscale to assess neuroticism,the self-administered questionnaire to assess the number of negative life events that the participants had experienced and the exercise fre-quency.Model 4 in the Process plug-in was used to test the mediating effect of neuroticism,and Model 7 to test the moderating role of exercise frequency.Results:The numbers of negative life events were positively correlated with the depressive symptoms scores(r=0.16,P<0.01),and were positively correlated with the neuroticism scores(r=0.26,P<0.01).The neuroticism scores were positively correlated with the depressive symptoms scores(r=0.52,P<0.01).Neuroticism score partially mediated between negative life events and depressive symptoms score,with a mediating effect of 78.4%,and exercise frequency score moderated between negative life events and neuroti-cism scores(β=-0.05,P=0.032).Conclusion:Negative life events are associated with depressive symptoms,neuroticism plays a mediating role,and exercise frequency could moderate negative life events and neuroticism.
5.Research progress of 18F-FDG PET/CT in the diagnosis and prognosis of follicular lymphoma
Wenpeng HUANG ; Xinyao SUN ; Lele SONG ; Qi YANG ; Lei KANG
Journal of Chinese Physician 2024;26(4):621-626
Follicular lymphoma (FL) is the most common inert B-cell lymphoproliferative disease characterized by extensive lymph node involvement, splenomegaly, and bone marrow infiltration. In recent years, with the development of molecular imaging technology and precision medicine, the imaging research of FL has been moving towards a more refined direction. 18F-FDG PET/CT plays an increasingly important role in the diagnosis, staging, efficacy evaluation, and prognosis judgment of FL patients, promoting more precise personalized treatment and improving the efficacy and survival of FL patients. This article reviews the research progress of 18F-FDG PET/CT in the diagnosis and prognosis of FL based on domestic and foreign research progress, summarizing existing literature, in order to provide reference for personalized diagnosis and treatment of FL.
6.Research progress in imaging manifestations and diagnosis and treatment of ectopic thyroid
Xinyao SUN ; Wenpeng HUANG ; Lele SONG ; Lei KANG
Journal of Chinese Physician 2023;25(12):1900-1904
Ectopic thyroid (ETG) is a thyroid tissue located outside the normal anatomical position, often occurring in the chest. Clinical symptoms are related to its location and its impact on adjacent structures. In ETG imaging examination, single photon emission computed tomography (SPECT) nuclide imaging of thyroid perchlorate ( 99Tc mO 4-) is the most commonly used method for localization and characterization. ETG with normal function shows high radiation uptake in the corresponding area. For difficult to distinguish tumors in the base of the tongue and the thyrohyoid region, 131I or 123I imaging with more specificity for thyroid tissue uptake is needed. ETG exhibits a variety of manifestations in computed tomography (CT) and magnetic resonance imaging (MRI), mostly irregular soft tissue density masses with clear boundaries and uneven density. There are low-density cystic changes or high-density calcifications within the masses, with uneven or uniform enhancement. In ultrasound, ETG is mainly hypoechoic, with some showing cystic solid echoes and abundant blood flow signals within the gland. Asymptomatic ETG patients usually do not require treatment, while symptomatic patients often require surgical resection and have a good prognosis. Before surgery, relevant examinations should be combined to clarify the nature of the tumor as much as possible, to avoid permanent hypothyroidism caused by misdiagnosis and misresection.
7.Akinesia deformation sequence in a fetus suspected by prenatal ultrasound and confirmed after mid-term termination
Xinyao LUO ; Qiuyang GU ; Xinxiu LIU ; Jianhua LI ; Liyan HUANG ; Xiaohua HUANG ; Shengnan WU ; Jingping YANG ; Meihua TAN
Chinese Journal of Perinatal Medicine 2022;25(3):218-221
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.
8.Core competency system for emergency rescue of sudden infectious diseases among military advance nurses
Xinyao HUANG ; Lijuan ZHOU ; Ruiheng MA
Chinese Journal of Practical Nursing 2021;37(12):887-893
Objective:To establish the core competency index system for emergency rescue of infectious diseases among military advance nurses, so as to provide a reference for evaluating the core emergency capability of military advanced nursing staff.Methods:The index system of emergency core competence of military advanced nursing staff in the emergency of infectious diseases was preliminarily formulated. Based on the evidence-based theory, the improved Delphi correspondence method was used to issue two rounds of questionnaires to 20 authoritative experts. After sorting out and analyzing, the effective questionnaire was formed, and the weight of each index was calculated by AHP.Results:The recovery rates of the two rounds of expert questionnaire were 100%, and the expert authority coefficients were 0.792 and 0.846, respectively; the Kendall ′s W was close to 1, which was statistically significant ( P < 0.01). Finally, three first-class indicators, 12 second-class indicators and 52 third-class indicators were determined, including knowledge related to the prevention of sudden infectious diseases, professional nursing skills and medical support capacity. Conclusion:The results show that the index content of the core emergency rescue capability system of military advanced nursing staff is centralized, the weight distribution is reasonable and has high practicability, which is conducive to improve the practical technical ability and core emergency ability of the military advanced nursing staff, improve the emergency rescue level of infectious disease emergencies and the overall medical support level of military hospitals
9.Content Determination and Cluster Analysis of 7 Kinds of Triterpenes in Poria cocos from Different Habitats
Ming WAN ; Chao HUANG ; Yuying YANG ; Xinyao LUO ; Xiaochuan YE ; Ying DING ; Qiong DONG ; Shuhe CHEN
China Pharmacy 2020;31(17):2101-2106
OBJECTIVE:To establish a method for th e content determination of 7 kinds of triterpenoids in Poria cocos ,and to compare the differences of the above components in P. cocos from different habitats ,so as to provide reference for the quality control of P. cocos . METHODS :Using 36 batches of P. cocos from different habitats as samples ,HPLC method was used for content determination of dehydrotomorphic acid , polyporhinic acid C , 3-epidehydrotomorphic acid , 3-O-acetyl-16 α-hydroxy-hydrogenolysaccharic acid ,dehydrotomorphic acid ,pachymic acid and dehydrotrametenolic acid. The column was performed on Thermo Acclaim 120 C18 with mobile phase consisted of acetonitrile-phosphoric acid water (gradient elution )at the flow rate of 1 mL/min. The detection wavelength was set at 210 nm. The column temperature was 30 ℃,and the injection volume was 20 μL. SPSS 21.0 statistical software was used for cluster analysis of 36 batches of P. cocos from different habitats. RESULTS : The linearity of 7 triterpenoids was good in the range of their mass concentration (all r≥0.999 0);average recoveries were 96.74%-104.04%(RSD=0.54%-1.55%,n=6). RSDs of precision ,and reproducibility stability (24 h)tests were all lower than 3.0%(n=6). RSD of durability test was lower than 5.0%(n=2). There were some differences in the single content of 7 indicator components among samples from different habitats ,but the total content difference was not obvious (the total content of most samples was in the range of 1.3-1.9 mg/g). After cluster analysis ,36 batches of sample were clustered into 5 categories,i.e. S 27 was clustered into class Ⅰ;S30 and S 34 were clustered into class Ⅱ;S2,S8 and S 9 were clustered into class Ⅲ;S10,S11,S12 and S 14 were clustered into class Ⅳ;and the remaining 26 batches of samples were clustered into class Ⅴ. CONCLUSIONS :The method is simple ,and has good precision ,repeatability and durability. It can be used for the simultaneous determination of above 7 components in P. cocos . There has no significant difference in the quality of P. cocos from different habitats. The content of P. cocos in most producing areas is uniform in content and stable in quality ,only a few of them are different. Δ 基金项目 :国家重点研发计划中医药现代化研究重点专项
10.MRI and CT features of struma ovarii
Na LIN ; Meilian XIONG ; Ruqi FANG ; Xinyao HUANG ; Dairong CAO
Chinese Journal of Medical Imaging Technology 2018;34(5):719-722
Objective To analyze MRI and CT features of struma ovarii (SO).Methods CT and MRI findings of 14 patients with pathologically confirmed single SO were retrospectively analyzed.The morphology,size,density/signal intensity and enhancement pattern of lesions were analyzed.Results All the tumors appeared as well-defined cystic-solid masses,11 were multilobulated and 3 were round-like.Thirteen lesions were multicystic,and 1 was unilocular.The solid components appeared as thickness septa or wall in 11 and as nodule in 3 lesions.The maximum diameter of the tumors were 3-34 cm,with an average size of (11.34±2.24)cm.MRI showed extremely low signal intensity regions in cyst portion of 7 masses on T2WI without enhancement,while obvious enhancement in solid potion.CT showed high attenuation in cyst portion of 7 masses without enhancement,CT value were 57-90 HU,whereas the solid potion obviously enhanced,and CT values were 145-270 HU.Plaque-like calcification on the walls or nodules were observed in 4 patients.Conclusion CT and MRI findings of SO have certain characteristics,which are helpful for diagnosis and differential diagnosis.

Result Analysis
Print
Save
E-mail