1.Tumor necrosis factor-a-308 polymorphism and risk of non-Hodgkin lymphoma: a meta-analysis
Xinnian YU ; Shanliang ZHONG ; Mei CHENG
Journal of Leukemia & Lymphoma 2018;27(7):410-414
Objective To investigate the association between the tumor necrosis factor (TNF)-α-308 G>A polymorphism and risk of non-Hodgkin lymphoma (NHL).Methods PubMed,CNKI and Wanfang dataknowledge service platform were searched to obtain relevant literature by using the following terms:lymphoma and (tumor necrosis factor or TNF) and (polymorphism or SNP or variant or mutation).Overall results were combined by using fixed effect model or random effect model.Publication bias was evaluated by using the Begg funnel plot and Egger test.Results Fifteen eligible studies were identified,including 9 738 NHL cases and 10 854 controls.The results of the overall meta-analysis showed that the TNF-α-308 AA genotype was associated with increased risk of NHL in two genetic models (AA vs.GG:OR =1.55,95 % CI 1.30-1.86,I2 =42.4 %;AA vs.AG+GG:OR =1.53,95 % CI 1.27-1.83,I2 =41.8%).Stratified by ethnicity,TNF-α-308 A allele was associated with an increased NHL risk in Caucasians (A vs.G;AA vs.GG;AG vs.GG;AA vs.AG+GG;AA+AG vs.GG) but a decreased risk in Asians (A vs.G;AG vs.GG;AA+AG vs.GG).Conclusion The TNF-o-308 G>A polymorphism is associated with the risk of NHL.
2.Expression of recombinant human beta-defensin-2 gene with C terminal of double marks of Myc and poly-histidine in transfected COS-7 cells.
Shaohui CAI ; Jun DU ; Xinnian CHENG ; Ning HUANG ; Nagase FUMIHIKO ; Hasegawa TAKAIKI ; Boyao WANG
Journal of Biomedical Engineering 2003;20(2):255-280
The aim of this study is to explore the possibility and technical itinerary of establishing an mammal engineering cell line in which hBD-2 can be effectively expressed, secreted, detected, separated and purified. The full hBD2 cDNA was inserted into the multi clone site of a eukaryotic expressive plasmid pcDNA3.1/Myc-His(+) and located closely at the upstream of two tag gene (myc and 6 Poly-histidines) so as to construct another recombinant eukaryotic expressive vector of hBD-2 gene: rpcDNA3.1/Myc-His/hBD-2. By the use of RT-PCR with special primers, a band of 240 bp was amplified from COS-7 cells transfected by this recombinant plasmid, which matched full length of cDNA coding hBD2 plus myc epitope and 6 poly-histidines tags. Western blot analysis with specific anti-histidines antibody revealed that the lysate of COS-7 cells transfected by rpcDNA3.1/Myc-His/hBD-2 had a strong band with molecular weight of about 10 Kd that was approximate to the size of chiasmic peptide. Antibacterial activity assay showed that obvious bacterial inhibition occurred in both lysate and supernatant of COS-7 cells transfected by rpcDNA3.1/Myc-His/hBD-2.
Animals
;
Base Sequence
;
Blotting, Western
;
COS Cells
;
Gene Expression
;
Genes, myc
;
Histidine
;
genetics
;
Humans
;
Molecular Sequence Data
;
Plasmids
;
Reverse Transcriptase Polymerase Chain Reaction
;
Transfection
;
beta-Defensins
;
biosynthesis
;
genetics
;
pharmacology
3.Rat ?-defensin rBD-1 gene expresses constitutively in skin and kidney
Ning HUANG ; Qi WU ; Bin TANG ; Xinnian CHENG ; Boyao WANG
Chinese Journal of Pathophysiology 1986;0(01):-
AIM: To determine tissue distribution of rat ?-defensin rBD-1 gene expression.METHODS: Total RNA was isolated from 10 kinds of rat tissues. RT-PCR were performed with primers (R 1 5′→3′ ACTCTGGACCCTGACTTCACCG; R 2 5′→3′ CCCTTGCTTGTCCTTTATGTCC). The RT-PCR products around 272 bp in size were cloned into pGEM-T easy vector and the recombinant clones were analyzed by digestion with restriction endonucleases and DNA sequencing.RESULTS: Rat ?-defensin rBD-1 transcripts were found in the kidney and skin, whereas its mRNA was not detected in trachea, uterus, bladder, small intestine, spleen, skeletal muscle, bone marrow and parotid. Sequence analysis confirmed that the RT-PCR product is rBD-1 cDNA. CONCLUSION: These data suggested that ?-defensin rBD-1 may participate not only in the kidney but also in the skin natural defense against infections.

Result Analysis
Print
Save
E-mail