1.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
2.A practice guideline for therapeutic drug monitoring of mycophenolic acid for solid organ transplants.
Shuang LIU ; Hongsheng CHEN ; Zaiwei SONG ; Qi GUO ; Xianglin ZHANG ; Bingyi SHI ; Suodi ZHAI ; Lingli ZHANG ; Liyan MIAO ; Liyan CUI ; Xiao CHEN ; Yalin DONG ; Weihong GE ; Xiaofei HOU ; Ling JIANG ; Long LIU ; Lihong LIU ; Maobai LIU ; Tao LIN ; Xiaoyang LU ; Lulin MA ; Changxi WANG ; Jianyong WU ; Wei WANG ; Zhuo WANG ; Ting XU ; Wujun XUE ; Bikui ZHANG ; Guanren ZHAO ; Jun ZHANG ; Limei ZHAO ; Qingchun ZHAO ; Xiaojian ZHANG ; Yi ZHANG ; Yu ZHANG ; Rongsheng ZHAO
Journal of Zhejiang University. Science. B 2025;26(9):897-914
Mycophenolic acid (MPA), the active moiety of both mycophenolate mofetil (MMF) and enteric-coated mycophenolate sodium (EC-MPS), serves as a primary immunosuppressant for maintaining solid organ transplants. Therapeutic drug monitoring (TDM) enhances treatment outcomes through tailored approaches. This study aimed to develop an evidence-based guideline for MPA TDM, facilitating its rational application in clinical settings. The guideline plan was drawn from the Institute of Medicine and World Health Organization (WHO) guidelines. Using the Delphi method, clinical questions and outcome indicators were generated. Systematic reviews, Grading of Recommendations Assessment, Development, and Evaluation (GRADE) evidence quality evaluations, expert opinions, and patient values guided evidence-based suggestions for the guideline. External reviews further refined the recommendations. The guideline for the TDM of MPA (IPGRP-2020CN099) consists of four sections and 16 recommendations encompassing target populations, monitoring strategies, dosage regimens, and influencing factors. High-risk populations, timing of TDM, area under the curve (AUC) versus trough concentration (C0), target concentration ranges, monitoring frequency, and analytical methods are addressed. Formulation-specific recommendations, initial dosage regimens, populations with unique considerations, pharmacokinetic-informed dosing, body weight factors, pharmacogenetics, and drug-drug interactions are covered. The evidence-based guideline offers a comprehensive recommendation for solid organ transplant recipients undergoing MPA therapy, promoting standardization of MPA TDM, and enhancing treatment efficacy and safety.
Mycophenolic Acid/administration & dosage*
;
Drug Monitoring/methods*
;
Humans
;
Organ Transplantation
;
Immunosuppressive Agents/administration & dosage*
;
Delphi Technique
3.Genome-wide investigation of transcription factor footprints and dynamics using cFOOT-seq.
Heng WANG ; Ang WU ; Meng-Chen YANG ; Di ZHOU ; Xiyang CHEN ; Zhifei SHI ; Yiqun ZHANG ; Yu-Xin LIU ; Kai CHEN ; Xiaosong WANG ; Xiao-Fang CHENG ; Baodan HE ; Yutao FU ; Lan KANG ; Yujun HOU ; Kun CHEN ; Shan BIAN ; Juan TANG ; Jianhuang XUE ; Chenfei WANG ; Xiaoyu LIU ; Jiejun SHI ; Shaorong GAO ; Jia-Min ZHANG
Protein & Cell 2025;16(11):932-952
Gene regulation relies on the precise binding of transcription factors (TFs) at regulatory elements, but simultaneously detecting hundreds of TFs on chromatin is challenging. We developed cFOOT-seq, a cytosine deaminase-based TF footprinting assay, for high-resolution, quantitative genome-wide assessment of TF binding in both open and closed chromatin regions, even with small cell numbers. By utilizing the dsDNA deaminase SsdAtox, cFOOT-seq converts accessible cytosines to uracil while preserving genomic integrity, making it compatible with techniques like ATAC-seq for sensitive and cost-effective detection of TF occupancy at the single-molecule and single-cell level. Our approach enables the delineation of TF footprints, quantification of occupancy, and examination of chromatin influences on TF binding. Notably, cFOOT-seq, combined with FootTrack analysis, enables de novo prediction of TF binding sites and tracking of TF occupancy dynamics. We demonstrate its application in capturing cell type-specific TFs, analyzing TF dynamics during reprogramming, and revealing TF dependencies on chromatin remodelers. Overall, cFOOT-seq represents a robust approach for investigating the genome-wide dynamics of TF occupancy and elucidating the cis-regulatory architecture underlying gene regulation.
Transcription Factors/genetics*
;
Humans
;
Chromatin/genetics*
;
Animals
;
Binding Sites
;
Mice
;
DNA Footprinting/methods*
4.Gender-Specific Prevalence and Risk Factors of Hypertension in a Chinese Rural Population: The Henan Rural Cohort Study.
Fayaz AHMAD ; Tahir MEHMOOD ; Xiao Tian LIU ; Ying Hao YUCHI ; Ning KANG ; Wei LIAO ; Rui Yu WU ; Bota BAHETI ; Xiao Kang DONG ; Jian HOU ; Sohail AKHTAR ; Chong Jian WANG
Biomedical and Environmental Sciences 2025;38(11):1417-1429
OBJECTIVE:
To investigate hypertension (HTN) trends, key risk factors, and gender disparities in rural China, and to propose targeted strategies for improving HTN control in resource-limited settings.
METHODS:
This longitudinal study used data from the Henan Rural Cohort Study, including baseline (2015-2017; n = 39,224) and follow-up (2018-2022; n = 28,621) participants. HTN was defined as systolic/diastolic blood pressure ≥ 140/90 mmHg, self-reported diagnosis, or use of antihypertensive medication. Severity was classified using a 7-tier blood pressure (BP) staging system (optimal, normal, high normal, and HTN stages 1-4). A generalized linear mixed-effects model (GLMM) identified associated risk factors.
RESULTS:
HTN prevalence increased modestly from 32.7% (95% CI: 32.2-33.2) to 33.9% (95% CI: 33.3%-34.4%). Awareness and treatment improved from 20.1% to 25.3%, and from 18.8% to 24.4%, respectively, but control rates remained low (6.2% to 12.3%). After adjustment, women had a 1.53-fold higher HTN risk than men ( OR = 1.53, 95% CI: 1.43-1.63), revealing gender-specific trends. Key risk factors included alcohol use ( OR = 1.37, 95% CI: 1.27-1.47) and overweight status ( OR = 1.76, 95% CI: 1.66-1.86). BP staging showed an increase in optimal BP (42.3% to 45.8%), but stagnant management of advanced HTN stages.
CONCLUSION
Hypertension in rural China is shaped by behavioral risk factors and healthcare access gaps. Gender-sensitive, community-based interventions, including task-shifting models, are necessary to mitigate the growing burden of hypertension.
Humans
;
Hypertension/etiology*
;
China/epidemiology*
;
Female
;
Male
;
Rural Population/statistics & numerical data*
;
Prevalence
;
Risk Factors
;
Middle Aged
;
Adult
;
Aged
;
Longitudinal Studies
;
Sex Factors
;
Cohort Studies
;
East Asian People
5.Expression,prognostic relevance of P4HB in glioblastoma and its biological effects on tumor cells
Guan-You HUANG ; Xiao-Hong HOU ; Xue-Cheng GE ; Hong-Chuan GAN ; Shu-Yu HAO ; Zhen WU
Medical Journal of Chinese People's Liberation Army 2024;49(4):459-467
Objective To investigate the expression of prolyl 4-hydroxylase β-polypeptide(P4HB)in glioblastoma multiforme(GBM)and its impact on clinical prognosis,as well as on the proliferation and migration of U87 cells.Methods(1)According to the Cancer Genome Atlas(TCGA)database,GTEx database and GEPIA2 database,the difference expression of P4HB in GBM and normal brain tissues were analyzed by R software.(2)A total of 52 patients with GBM who underwent surgical treatment from February 2017 to December 2019 were collected from Department of Neurosurgery,the Second People's Hospital of Guiyang.The normal brain tissues of 10 patients were selected as controls.Immunohistochemical method was used to detect the expression level of P4HB in tumor tissues and normal tissues.The Kaplan-Meier method with the log-rank test was employed for survival analysis.Receiver operating characteristic(ROC)curve was used to analyze the predictive valuable of P4HB expression in survival rate of GBM.Univariate and multivariate Cox regression analysis were used to identify the expression of P4HB and related clinicopathological factors affecting the survival and prognosis of the patients.(3)Human GBM U87 cells were randomly assigned into three groups:control group,NC-siRNA group and P4HB-siRNA group.P4HB expression was interfered with by the transfection of siRNA in P4HB-siRNA group.Real-time quantitative polymerase chain reaction(qRT-PCR)was used to detect the content of P4HB mRNA in U87 cells.Cell counting kit-8(CCK-8)and immunofluorescence assay were used to analyze the effects of P4HB on the proliferation of U87 cells.Scratch test was used to analyze the effects of P4HB on cell migration.Results The expression of P4HB was significantly upregulated in GBM tissues compared with normal brain tissues(P<0.05).The γδ T cells(r=-0.227)and follicular helper T cells(r=-0.226)were negatively correlated with the expression of P4HB,while natural killer cell(r=0.417),macrophages(r=0.374),neutrophils(r=0.344),and immature dendritic cells(r=0.263)were positively correlated with the expression of P4HB.Kaplan-Meier survival analysis showed that the progression-free survival and disease-specific survival of GBM patients with high P4HB expression were significantly lower than those with low expression(P<0.05).ROC curve showed that the area under the curve(AUC)of P4HB in predicting overall survival rate of GBM patients was 0.982,and 1-year,3-year,and 5-year survival was 0.655,0.724,0.861,respectively.The immunohistochemistry results suggested that P4HB protein was significantly highly expressed in GBM tumors.Survival analysis indicated that high expression of P4HB was associated with bad prognosis in GBM patients(P<0.05).Multivariate Cox regression analysis indicated that high expression of P4HB and TERT promoter mutations were the independent prognostic risk factors for GBM(P<0.05).Compared with control group and NC-siRNA group,the expression levels of P4HB were decreased significantly after transfected with siRNA in U87 cells of P4HB-siRNA group(P<0.01),and the proliferation ability and the wound healing rate were decreased significantly in P4HB-siRNA group(P<0.001).Conclusions P4HB is significantly highly expressed in GBM,which indicates that the prognosis of patients is poor.Knockout of P4HB could inhibit cellular proliferation and migration of GBM U87 cells.P4HB may be used as the relevant predictive marker and potential therapeutic target in GBM.
6.Preliminary study on delaying aging induced thymus degeneration in SAMP6 mice with Bazi Bushen capsule
Zhao-Dong LI ; Yin-Xiao CHEN ; Bo-Yang GONG ; Zhe XU ; Zhi-Xian YU ; Yue-Xuan SHI ; Yan-Fei PENG ; Yu-Hong BIAN ; Yun-Long HOU ; Xiang-Ling WANG ; Shu-Wu ZHAO
Chinese Pharmacological Bulletin 2024;40(6):1186-1192
Aim To explore the improvement effect of Bazi Bushen capsule on thymic degeneration in SAMP6 mice and the possible mechanism.Methods Twenty 12 week old male SAMP6 mice were randomly divided into the model group(SAMP6)and the Bazi Busheng capsule treatment group(SAMP6+BZBS).Ten SAMR1 mice were assigned to a homologous control group(SAMR1).The SAMP6+BZBS group was oral-ly administered Bazi Bushen capsule suspension(2.8 g·kg-1)daily,while the other two groups were orally administered an equal amount of distilled water.After nine weeks of administration,the morphology of the thymus in each group was observed and the thymus in-dex was calculated;HE staining was used to observe the structural changes of thymus tissue;SA-β-gal stai-ning was used to detect thymic aging;flow cytometry was used to detect the proportion of thymic CD3+T cells in each group;Western blot was used to detect the levels of p16,Bax,Bcl-2,and cleaved caspase-3 proteins in thymus;immunofluorescence was applied to detect the proportion of cortical thymic epithelial cells in each group;ELISA was employed to detect IL-7 lev-els in thymus.Results Compared with the SAMP6 group,the thymic index of the SAMP6+BZBS group significantly increased(P<0.05);the disordered thy-mic structure was significantly improved;the positive proportion of SA-β-gal staining significantly decreased(P<0.01);the proportion of CD3+T cells apparently increased(P<0.05);the level of p16 protein signifi-cantly decreased(P<0.05);the level of Bcl-2 pro-tein significantly increased(P<0.05),while the lev-el of cleaved caspase-3 protein markedly decreased(P<0.05);the proportion of cortical thymic epithelial cells evidently increased;the level of IL-7 significantly increased(P<0.01).Conclusions Bazi Bushen capsule can delay thymic degeneration,inhibit cell ap-optosis in thymus and promote thymic cell development in SAMP6 mice,which may be related to increasing the proportion of cortical thymic epithelial cells and promoting IL-7 secretion.
7.Chinese expert consensus on the diagnosis and treatment of traumatic supraorbital fissure syndrome (version 2024)
Junyu WANG ; Hai JIN ; Danfeng ZHANG ; Rutong YU ; Mingkun YU ; Yijie MA ; Yue MA ; Ning WANG ; Chunhong WANG ; Chunhui WANG ; Qing WANG ; Xinyu WANG ; Xinjun WANG ; Hengli TIAN ; Xinhua TIAN ; Yijun BAO ; Hua FENG ; Wa DA ; Liquan LYU ; Haijun REN ; Jinfang LIU ; Guodong LIU ; Chunhui LIU ; Junwen GUAN ; Rongcai JIANG ; Yiming LI ; Lihong LI ; Zhenxing LI ; Jinglian LI ; Jun YANG ; Chaohua YANG ; Xiao BU ; Xuehai WU ; Li BIE ; Binghui QIU ; Yongming ZHANG ; Qingjiu ZHANG ; Bo ZHANG ; Xiangtong ZHANG ; Rongbin CHEN ; Chao LIN ; Hu JIN ; Weiming ZHENG ; Mingliang ZHAO ; Liang ZHAO ; Rong HU ; Jixin DUAN ; Jiemin YAO ; Hechun XIA ; Ye GU ; Tao QIAN ; Suokai QIAN ; Tao XU ; Guoyi GAO ; Xiaoping TANG ; Qibing HUANG ; Rong FU ; Jun KANG ; Guobiao LIANG ; Kaiwei HAN ; Zhenmin HAN ; Shuo HAN ; Jun PU ; Lijun HENG ; Junji WEI ; Lijun HOU
Chinese Journal of Trauma 2024;40(5):385-396
Traumatic supraorbital fissure syndrome (TSOFS) is a symptom complex caused by nerve entrapment in the supraorbital fissure after skull base trauma. If the compressed cranial nerve in the supraorbital fissure is not decompressed surgically, ptosis, diplopia and eye movement disorder may exist for a long time and seriously affect the patients′ quality of life. Since its overall incidence is not high, it is not familiarized with the majority of neurosurgeons and some TSOFS may be complicated with skull base vascular injury. If the supraorbital fissure surgery is performed without treatment of vascular injury, it may cause massive hemorrhage, and disability and even life-threatening in severe cases. At present, there is no consensus or guideline on the diagnosis and treatment of TSOFS that can be referred to both domestically and internationally. To improve the understanding of TSOFS among clinical physicians and establish standardized diagnosis and treatment plans, the Skull Base Trauma Group of the Neurorepair Professional Committee of the Chinese Medical Doctor Association, Neurotrauma Group of the Neurosurgery Branch of the Chinese Medical Association, Neurotrauma Group of the Traumatology Branch of the Chinese Medical Association, and Editorial Committee of Chinese Journal of Trauma organized relevant experts to formulate Chinese expert consensus on the diagnosis and treatment of traumatic supraorbital fissure syndrome ( version 2024) based on evidence of evidence-based medicine and clinical experience of diagnosis and treatment. This consensus puts forward 12 recommendations on the diagnosis, classification, treatment, efficacy evaluation and follow-up of TSOFS, aiming to provide references for neurosurgeons from hospitals of all levels to standardize the diagnosis and treatment of TSOFS.
8.Background, design, and preliminary implementation of China prospective multicenter birth cohort
Si ZHOU ; Liping GUAN ; Hanbo ZHANG ; Wenzhi YANG ; Qiaoling GENG ; Niya ZHOU ; Wenrui ZHAO ; Jia LI ; Zhiguang ZHAO ; Xi PU ; Dan ZHENG ; Hua JIN ; Fei HOU ; Jie GAO ; Wendi WANG ; Xiaohua WANG ; Aiju LIU ; Luming SUN ; Jing YI ; Zhang MAO ; Zhixu QIU ; Shuzhen WU ; Dongqun HUANG ; Xiaohang CHEN ; Fengxiang WEI ; Lianshuai ZHENG ; Xiao YANG ; Jianguo ZHANG ; Zhongjun LI ; Qingsong LIU ; Leilei WANG ; Lijian ZHAO ; Hongbo QI
Chinese Journal of Perinatal Medicine 2024;27(9):750-755
China prospective multicenter birth cohort (Prospective Omics Health Atlas birth cohort, POHA birth cohort) study was officially launched in 2022. This study, in collaboration with 12 participating units, aims to establish a high-quality, multidimensional cohort comprising 20 000 naturally conceived families and assisted reproductive families. The study involves long-term follow-up of parents and offspring, with corresponding biological samples collected at key time points. Through multi-omics testing and analysis, the study aims to conduct multi-omics big data research across the entire maternal and infant life cycle. The goal is to identify new biomarkers for maternal and infant diseases and provide scientific evidence for risk prediction related to maternal diseases and neonatal health.
10.Intermittent heat exposure induces thoracic aorta injury in spontaneously hypertensive rats by activating the AMPK/mTOR/ULK1 pathway.
Chun Li YANG ; Shu Jing XUE ; Xiao Min WU ; Ling HOU ; Tao XU ; Guang Hua LI
Journal of Southern Medical University 2023;43(2):191-198
OBJECTIVE:
To investigate the effects of different manners of heat exposure on thoracic aorta injury in spontaneously hypertensive rats (SHRs) and explore the underlying mechanism.
METHODS:
Normal 6 to 7-week-old male SHRs were randomized into control group (cage at room temperature), intermittent heat exposure group (SHR-8 group, exposed to 32 ℃ for 8 h daily for 7 days) and SHR-24 group (with continuous exposure to 32 ℃ for 7 days). After the treatments, the pathologies of the thoracic aorta of the rats were observed with HE staining, and the expressions of Beclin1, LC3B and p62 were detected with Western blotting and immunofluorescence assay; TUNEL staining was used to observe cell apoptosis in the thoracic aorta, and the expressions of caspase-3, Bax, and Bcl-2 were detected using Western blotting. The effects of intraperitoneal injections of 3-MA (an autophagy agonist), rapamycin (an autophagy inhibitor) or compound C 30 min before intermittent heat exposure on the expressions of proteins associated with autophagy, apoptosis and the AMPK/mTOR/ULK1 pathway in the aorta were examined with immunohistochemistry.
RESULTS:
In SHR-8 group, the rats showed incomplete aortic intima with disordered cell distribution and significantly increased expressions of Beclin1, LC3II/LC3I and Bax, lowered expressions of p62 and Bcl-2, and increased apoptotic cells in the thoracic aorta (P < 0.05). Pretreatment with 3-MA obviously inhibited the expressions of autophagy- and apoptosis-related proteins, whereas rapamycin promoted their expressions. Compared with the control group, the rats in SHR-8 group had significantly down-regulated p-mTOR and up-regulated p-AMPK and p-ULK1 expression of in the aorta; Treatment with compound C obviously lowered the expressions of p-AMPK and p-ULK1 and those of LC3B and Beclin1 as well.
CONCLUSION
In SHRs, intermittent heat exposure causes significant pathologies and promotes autophagy and apoptosis in the thoracic aorta possibly by activating the AMPK/mTOR/ULK1 pathway.
Rats
;
Male
;
Animals
;
Rats, Inbred SHR
;
AMP-Activated Protein Kinases/metabolism*
;
bcl-2-Associated X Protein/metabolism*
;
Aorta, Thoracic
;
Beclin-1
;
Hot Temperature
;
TOR Serine-Threonine Kinases/metabolism*
;
Proto-Oncogene Proteins c-bcl-2/metabolism*
;
Apoptosis
;
Aortic Diseases
;
Autophagy
;
Autophagy-Related Protein-1 Homolog/metabolism*

Result Analysis
Print
Save
E-mail