1.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
2.Ferrum@albumin assembled nanoclusters inhibit NF-κB signaling pathway for NIR enhanced acute lung injury immunotherapy.
Xiaoxuan GUAN ; Binbin ZOU ; Weiqian JIN ; Yan LIU ; Yongfeng LAN ; Jing QIAN ; Juan LUO ; Yanjun LEI ; Xuzhi LIANG ; Shiyu ZHANG ; Yuting XIAO ; Yan LONG ; Chen QIAN ; Chaoyu HUANG ; Weili TIAN ; Jiahao HUANG ; Yongrong LAI ; Ming GAO ; Lin LIAO
Acta Pharmaceutica Sinica B 2025;15(11):5891-5907
Acute lung injury (ALI) has been a kind of acute and severe disease that is mainly characterized by systemic uncontrolled inflammatory response to the production of huge amounts of reactive oxygen species (ROS) in the lung tissue. Given the critical role of ROS in ALI, a Fe3O4 loaded bovine serum albumin (BSA) nanocluster (BF) was developed to act as a nanomedicine for the treatment of ALI. Combining with NIR irradiation, it exhibited excellent ROS scavenging capacity. Significantly, it also displayed the excellent antioxidant and anti-inflammatory functions for lipopolysaccharides (LPS) induced macrophages (RAW264.7), and Sprague Dawley rats via lowering intracellular ROS levels, reducing inflammatory factors expression levels, inducing macrophage M2 polarization, inhibiting NF-κB signaling pathway, increasing CD4+/CD8+ T cell ratios, as well as upregulating HSP70 and CD31 expression levels to reprogram redox homeostasis, reduce systemic inflammation, activate immunoregulation, and accelerate lung tissue repair, finally achieving the synergistic enhancement of ALI immunotherapy. It finally provides an effective therapeutic strategy of BF + NIR for the management of inflammation related diseases.
3.Oxymatrine, a novel TLR2 agonist, promotes megakaryopoiesis and thrombopoiesis through the STING/NF-κB pathway.
Chengyang NI ; Ling ZHOU ; Shuo YANG ; Mei RAN ; Jiesi LUO ; Kui CHENG ; Feihong HUANG ; Xiaoqin TANG ; Xiang XIE ; Dalian QIN ; Qibing MEI ; Long WANG ; Juan XIAO ; Jianming WU
Journal of Pharmaceutical Analysis 2025;15(1):101054-101054
Radiation-induced thrombocytopenia (RIT) faces a perplexing challenge in the clinical treatment of cancer patients, and current therapeutic approaches are inadequate in the clinical settings. In this research, oxymatrine, a new molecule capable of healing RIT was screened out, and the underlying regulatory mechanism associated with magakaryocyte (MK) differentiation and thrombopoiesis was demonstrated. The capacity of oxymatrine to induce MK differentiation was verified in K-562 and Meg-01 cells in vitro. The ability to induce thrombopoiesis was subsequently demonstrated in Tg (cd41:enhanced green fluorescent protein (eGFP)) zebrafish and RIT model mice. In addition, we carried out network pharmacological prediction, drug affinity responsive target stability assay (DARTS) and cellular thermal shift assay (CETSA) analyses to explore the potential targets of oxymatrine. Moreover, the pathway underlying the effects of oxymatrine was determined by Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses, Western blot (WB), and immunofluorescence. Oxymatrine markedly promoted MK differentiation and maturation in vitro. Moreover, oxymatrine induced thrombopoiesis in Tg (cd41:eGFP) zebrafish and accelerated thrombopoiesis and platelet function recovery in RIT model mice. Mechanistically, oxymatrine directly binds to toll-like receptor 2 (TLR2) and further regulates the downstream pathway stimulator of interferon genes (STING)/nuclear factor-kappaB (NF-κB), which can be blocked by C29 and C-176, which are specific inhibitors of TLR2 and STING, respectively. Taken together, we demonstrated that oxymatrine, a novel TLR2 agonist, plays a critical role in accelerating MK differentiation and thrombopoiesis via the STING/NF-κB axis, suggesting that oxymatrine is a promising candidate for RIT therapy.
4.Omeprazole combined with different probiotics regulates intestinal microbiota to alleviate functional dyspepsia in children
Yun HE ; Li XIAO ; Juan CAO ; Zhigang LIU ; Weiyao LUO
Basic & Clinical Medicine 2024;44(2):219-224
Objective To explore the effect of omeprazole combined with different probiotics on regulating intestinal flora in reducing functional dyspepsia(FD)in children.Methods Two hundreds children with FD admitted to the Pediatric Department of Foshan Maternal and Child Health Hospital from January 2022 to February 2023 were se-lected as the study subjects.They were randomly divided into omeprazde(omep)group,groups of omeprazole+yeast(yeast group),+clostridium butyricum(clos group),and+bifidobacterium(bifi group)respectively.Results After treatment,serum level of IL-6,TNF-α,IL-1β,hs-CRP,VIP,SS,Enterobacter and Enterococcus in all groups significantly decreased as compared with the finding before treatment(P<0.05).Those targets in the three combined treatment groups were significantly lower compared to the ome group;After treatment,the serum MOT level,bifidobacteria,and lactobacilli in each group were significantly increased(P<0.05),and the results from three combined treatment groups demonstrated notably higher levels compared to the omep group(P<0.05);The scores of symptoms in all groups showed a significant alleviation after the treatment(P<0.05).Additionally,the three combined treatment groups exhibited significantly lower symptom scores than the group treated with omeprazole alone(P<0.05).There was no difference in the incidence of adverse reactions during treatment among the groups.Conclusions Omeprazole combined with different probiotics have achieved good results in the treatment of FD in children.
5.Clinical characteristics and risk factors of juvenile idiopathic arthritis-associated uveitis
Yan ZHANG ; Huan XIAO ; Chong LUO ; Xuemei TANG ; Juan ZHOU
Journal of Army Medical University 2024;46(20):2346-2351
Objective To analyze the risk factors and clinical characteristics of uveitis in children with juvenile idiopathic arthritis (JIA).Methods A retrospective case-control study was conducted on 30 children with JIA-associated uveitis (JIA-U )and 36 age-and gender-matched children diagnosed as simple JIA admitted to Children's Hospital of Chongqing Medical University from June 2016 to June 2023.The clinical data,laboratory indicators and radiological findings were collected,and analyzed for the risk factors for JIA-U with univariate and multivariate analysis.Results In this study,JIA-U mostly occurred in both eyes (63.3%,19/30),with anterior uveitis as the main cause (86.7%,26/30),insidious onset,and mostly occurred after JIA diagnosis (60.0%,18/30),and only 30% showing ocular discomfort or visual impairment.Univariate analysis showed that the JIA children with oligoarthritis JIA,negative rheumatoid factor (RF)and negative anti-cyclic citrullinated peptide antibody (anti-CCP)were prone to be complicated with uveitis (P<0.05 ). Multivariate logistic regression analysis indicated that RF negativity was an independent risk factor for development of JIA-U (OR=5.400,95% CI:1.033~28.227,P=0.046). Conclusion JIA-U of ten develops in both eyes,anterior uveitis is the most common,and it mostly diagnosed after JIA.It has no obvious eye symptoms in the early stage and thus is not easily recognized.Oligoarthritis JIA,RF-negative,and anti-CCP antibody-negative are the high-risk factors for the complication of JIA-U in children with JIA.
6.Carrier screening for 223 monogenic diseases in Chinese population:a multi-center study in 33 104 individuals
Wei HOU ; Xiaolin FU ; Xiaoxiao XIE ; Chunyan ZHANG ; Jiaxin BIAN ; Xiao MAO ; Juan WEN ; Chunyu LUO ; Hua JIN ; Qian ZHU ; Qingwei QI ; Yeqing QIAN ; Jing YUAN ; Yanyan ZHAO ; Ailan YIN ; Shutie LI ; Yulin JIANG ; Manli ZHANG ; Rui XIAO ; Yanping LU
Journal of Southern Medical University 2024;44(6):1015-1023
Objective To investigate the epidemiological characteristics and mutation spectrum of monogenic diseases in Chinese population through a large-scale,multicenter carrier screening.Methods This study was conducted among a total of 33 104 participants(16 610 females)from 12 clinical centers across China.Carrier status for 223 genes was analyzed using high-throughput sequencing and different PCR methods.Results The overall combined carrier frequency was 55.58%for 197 autosomal genes and 1.84%for 26 X-linked genes in these participants.Among the 16 669 families,874 at-risk couples(5.24%)were identified.Specifically,584 couples(3.50%)were at risk for autosomal genes,306(1.84%)for X-linked genes,and 16 for both autosomal and X-linked genes.The most frequently detected autosomal at-risk genes included GJB2(autosomal recessive deafness type 1A,393 couples),HBA1/HBA2(α-thalassemia,36 couples),PAH(phenylketonuria,14 couples),and SMN1(spinal muscular atrophy,14 couples).The most frequently detected X-linked at-risk genes were G6PD(G6PD deficiency,236 couples),DMD(Duchenne muscular dystrophy,23 couples),and FMR1(fragile X syndrome,17 couples).After excluding GJB2 c.109G>A,the detection rate of at-risk couples was 3.91%(651/16 669),which was lowered to 1.72%(287/16 669)after further excluding G6PD.The theoretical incidence rate of severe monogenic birth defects was approximately 4.35‰(72.5/16 669).Screening for a battery of the top 22 most frequent genes in the at-risk couples could detect over 95%of at-risk couples,while screening for the top 54 genes further increased the detection rate to over 99%.Conclusion This study reveals the carrier frequencies of 223 monogenic genetic disorders in the Chinese population and provides evidence for carrier screening strategy development and panel design tailored to the Chinese population.In carrier testing,genetic counseling for specific genes or gene variants can be challenging,and the couples need to be informed of these difficulties before testing and provided with options for not screening these genes or gene variants.
7.Different methods in predicting mortality of pediatric intensive care units sepsis in Southwest China
Rong LIU ; Zhicai YU ; Changxue XIAO ; Shufang XIAO ; Juan HE ; Yan SHI ; Yuanyuan HUA ; Jimin ZHOU ; Guoying ZHANG ; Tao WANG ; Jianyu JIANG ; Daoxue XIONG ; Yan CHEN ; Hongbo XU ; Hong YUN ; Hui SUN ; Tingting PAN ; Rui WANG ; Shuangmei ZHU ; Dong HUANG ; Yujiang LIU ; Yuhang HU ; Xinrui REN ; Mingfang SHI ; Sizun SONG ; Jumei LUO ; Juan LIU ; Juan ZHANG ; Feng XU
Chinese Journal of Pediatrics 2024;62(3):204-210
Objective:To investigate the value of systemic inflammatory response syndrome (SIRS), pediatric sequential organ failure assessment (pSOFA) and pediatric critical illness score (PCIS) in predicting mortality of pediatric sepsis in pediatric intensive care units (PICU) from Southwest China.Methods:This was a prospective multicenter observational study. A total of 447 children with sepsis admitted to 12 PICU in Southwest China from April 2022 to March 2023 were enrolled. Based on the prognosis, the patients were divided into survival group and non-survival group. The physiological parameters of SIRS, pSOFA and PCIS were recorded and scored within 24 h after PICU admission. The general clinical data and some laboratory results were recorded. The area under the curve (AUC) of the receiver operating characteristic curve was used to compare the predictive value of SIRS, pSOFA and PCIS in mortality of pediatric sepsis.Results:Amongst 447 children with sepsis, 260 patients were male and 187 patients were female, aged 2.5 (0.8, 7.0) years, 405 patients were in the survival group and 42 patients were in the non-survival group. 418 patients (93.5%) met the criteria of SIRS, and 440 patients (98.4%) met the criteria of pSOFA≥2. There was no significant difference in the number of items meeting the SIRS criteria between the survival group and the non-survival group (3(2, 4) vs. 3(3, 4) points, Z=1.30, P=0.192). The pSOFA score of the non-survival group was significantly higher than that of the survival group (9(6, 12) vs. 4(3, 7) points, Z=6.56, P<0.001), and the PCIS score was significantly lower than that of the survival group (72(68, 81) vs. 82(76, 88) points, Z=5.90, P<0.001). The predictive value of pSOFA (AUC=0.82) and PCIS (AUC=0.78) for sepsis mortality was significantly higher than that of SIRS (AUC=0.56) ( Z=6.59, 4.23, both P<0.001). There was no significant difference between pSOFA and PCIS ( Z=1.35, P=0.176). Platelet count, procalcitonin, lactic acid, albumin, creatinine, total bilirubin, activated partial thromboplastin time, prothrombin time and international normalized ratio were all able to predict mortality of sepsis to a certain degree (AUC=0.64, 0.68, 0.80, 0.64, 0.68, 0.60, 0.77, 0.75, 0.76, all P<0.05). Conclusion:Compared with SIRS, both pSOFA and PCIS had better predictive value in the mortality of pediatric sepsis in PICU.
8.Carrier screening for 223 monogenic diseases in Chinese population:a multi-center study in 33 104 individuals
Wei HOU ; Xiaolin FU ; Xiaoxiao XIE ; Chunyan ZHANG ; Jiaxin BIAN ; Xiao MAO ; Juan WEN ; Chunyu LUO ; Hua JIN ; Qian ZHU ; Qingwei QI ; Yeqing QIAN ; Jing YUAN ; Yanyan ZHAO ; Ailan YIN ; Shutie LI ; Yulin JIANG ; Manli ZHANG ; Rui XIAO ; Yanping LU
Journal of Southern Medical University 2024;44(6):1015-1023
Objective To investigate the epidemiological characteristics and mutation spectrum of monogenic diseases in Chinese population through a large-scale,multicenter carrier screening.Methods This study was conducted among a total of 33 104 participants(16 610 females)from 12 clinical centers across China.Carrier status for 223 genes was analyzed using high-throughput sequencing and different PCR methods.Results The overall combined carrier frequency was 55.58%for 197 autosomal genes and 1.84%for 26 X-linked genes in these participants.Among the 16 669 families,874 at-risk couples(5.24%)were identified.Specifically,584 couples(3.50%)were at risk for autosomal genes,306(1.84%)for X-linked genes,and 16 for both autosomal and X-linked genes.The most frequently detected autosomal at-risk genes included GJB2(autosomal recessive deafness type 1A,393 couples),HBA1/HBA2(α-thalassemia,36 couples),PAH(phenylketonuria,14 couples),and SMN1(spinal muscular atrophy,14 couples).The most frequently detected X-linked at-risk genes were G6PD(G6PD deficiency,236 couples),DMD(Duchenne muscular dystrophy,23 couples),and FMR1(fragile X syndrome,17 couples).After excluding GJB2 c.109G>A,the detection rate of at-risk couples was 3.91%(651/16 669),which was lowered to 1.72%(287/16 669)after further excluding G6PD.The theoretical incidence rate of severe monogenic birth defects was approximately 4.35‰(72.5/16 669).Screening for a battery of the top 22 most frequent genes in the at-risk couples could detect over 95%of at-risk couples,while screening for the top 54 genes further increased the detection rate to over 99%.Conclusion This study reveals the carrier frequencies of 223 monogenic genetic disorders in the Chinese population and provides evidence for carrier screening strategy development and panel design tailored to the Chinese population.In carrier testing,genetic counseling for specific genes or gene variants can be challenging,and the couples need to be informed of these difficulties before testing and provided with options for not screening these genes or gene variants.
9.Design and application of "1+3" management module for medical high-value consumables in Operation Room
Junhua ZHANG ; Ming XIAO ; Wenzhi CAI ; Wei LUO ; Lingwu CHEN ; Hong WANG ; Zhendong PEI ; Junyan YAO ; Juan XIAO
Chinese Journal of Modern Nursing 2024;30(13):1720-1723
Objective:To establish the "1+3" management module of high-value consumables in Operation Room and verify its application, so as to provide new ideas for cost management of consumables in Operation Room.Methods:The Operating Room team of Shenzhen Hospital of Southern Medical University designed a "1+3" management module in 2022, where "1" referred to the management process of high-value consumables in Operation Room, and "3" referred to the precise management of consumables in Operation Room warehouse, the management of closed-loop use of Operation Room consumables and adverse event management of consumables. Surgeries using high-value consumables in the Thoracic Surgery Department, Gastrointestinal Surgery Department, and Urology Department of the hospital were selected as the research objects. The surgeries using conventional consumables from January to June 2022 were set as the control group, and the surgeries implementing the "1+3" management module from July to December 2022 were set as the observation group. The number of consumables received by the itinerant nurses before the operation and the number of high-value consumables returned after the operation were compared between the two groups. And the number of missed and error charges for high-value consumables in the two groups were counted and compared.Results:The number of consumables received before operation in the control group was higher than that in the observation group, and the difference was statistically significant ( P<0.05). The number of high-value consumables returned in the observation group was less than that in the control group, and the difference was statistically significant ( P<0.01). The proportion of missed charges for consumables in the observation group was lower than that in the control group, and the difference was statistically significant ( P<0.01), but there was no statistically significant difference in the proportion of incorrect charges between the two groups ( P>0.05) . Conclusions:The "1+3" management module for high-value consumables in Operation Room makes the process of receiving, returning, and charging high-value consumables clear, with traceable data, achieving refined management of high-value consumables in Operation Room, reducing the number of high-value consumables returned to the warehouse and reducing the proportion of missed consumables, which is conducive to effective cost control in Operation Room.
10.Expert consensus on ethical requirements for artificial intelligence (AI) processing medical data.
Cong LI ; Xiao-Yan ZHANG ; Yun-Hong WU ; Xiao-Lei YANG ; Hua-Rong YU ; Hong-Bo JIN ; Ying-Bo LI ; Zhao-Hui ZHU ; Rui LIU ; Na LIU ; Yi XIE ; Lin-Li LYU ; Xin-Hong ZHU ; Hong TANG ; Hong-Fang LI ; Hong-Li LI ; Xiang-Jun ZENG ; Zai-Xing CHEN ; Xiao-Fang FAN ; Yan WANG ; Zhi-Juan WU ; Zun-Qiu WU ; Ya-Qun GUAN ; Ming-Ming XUE ; Bin LUO ; Ai-Mei WANG ; Xin-Wang YANG ; Ying YING ; Xiu-Hong YANG ; Xin-Zhong HUANG ; Ming-Fei LANG ; Shi-Min CHEN ; Huan-Huan ZHANG ; Zhong ZHANG ; Wu HUANG ; Guo-Biao XU ; Jia-Qi LIU ; Tao SONG ; Jing XIAO ; Yun-Long XIA ; You-Fei GUAN ; Liang ZHU
Acta Physiologica Sinica 2024;76(6):937-942
As artificial intelligence technology rapidly advances, its deployment within the medical sector presents substantial ethical challenges. Consequently, it becomes crucial to create a standardized, transparent, and secure framework for processing medical data. This includes setting the ethical boundaries for medical artificial intelligence and safeguarding both patient rights and data integrity. This consensus governs every facet of medical data handling through artificial intelligence, encompassing data gathering, processing, storage, transmission, utilization, and sharing. Its purpose is to ensure the management of medical data adheres to ethical standards and legal requirements, while safeguarding patient privacy and data security. Concurrently, the principles of compliance with the law, patient privacy respect, patient interest protection, and safety and reliability are underscored. Key issues such as informed consent, data usage, intellectual property protection, conflict of interest, and benefit sharing are examined in depth. The enactment of this expert consensus is intended to foster the profound integration and sustainable advancement of artificial intelligence within the medical domain, while simultaneously ensuring that artificial intelligence adheres strictly to the relevant ethical norms and legal frameworks during the processing of medical data.
Artificial Intelligence/legislation & jurisprudence*
;
Humans
;
Consensus
;
Computer Security/standards*
;
Confidentiality/ethics*
;
Informed Consent/ethics*

Result Analysis
Print
Save
E-mail