Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Patients with severe trauma require an extremely timely treatment and transfusion plays an irreplaceable role in the emergency treatment of such patients. An increasing number of evidence-based medicinal evidences and clinical practices suggest that patients with severe traumatic bleeding benefit from early transfusion of low-titer group O whole blood or hemostatic resuscitation with red blood cells, plasma and platelet of a balanced ratio. However, the current domestic mode of blood supply cannot fully meet the requirements of timely and effective blood transfusion for emergency treatment of patients with severe trauma in clinical practice. In order to solve the key problems in blood supply and blood transfusion strategies for emergency treatment of severe trauma, Branch of Clinical Transfusion Medicine of Chinese Medical Association, Group for Trauma Emergency Care and Multiple Injuries of Trauma Branch of Chinese Medical Association, Young Scholar Group of Disaster Medicine Branch of Chinese Medical Association organized domestic experts of blood transfusion medicine and trauma treatment to jointly formulate Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients ( version 2024). Based on the evidence-based medical evidence and Delphi method of expert consultation and voting, 10 recommendations were put forward from two aspects of blood support mode and transfusion strategies, aiming to provide a reference for transfusion resuscitation in the emergency treatment of severe trauma and further improve the success rate of treatment of patients with severe trauma.

Objective:To summarize the clinical treatment of complete left bundle branch block (CLBBB) after the transcatheter closure of ventricular septal defect (VSD).Methods:A case series study was conducted on the treatments and outcomes of 25 children with CLBBB after transcatheter VSD closure in Guangdong Provincial People′s Hospital from January 2010 to December 2023.Paired sample t test was used to evaluate the effect of occlude removal. Results:Among the 25 patients, 12 were males (48%), and 13 were females (52%).The age at surgery was 3.18 (2.51-3.86) years, the height before surgery was 95.0 (90.0-97.5) cm, and the weight before surgery was 13 (12-15) kg.Fourteen children were early-onset cases (≤ 1 month), while the other 11 were late-onset cases (> 1 month).The mean follow-up time was (6.63±3.93) years.Of the 14 early-onset cases, 6 children underwent occluder removal within 1 month and restored normal heart rhythm or incomplete right bundle branch block; 4 children underwent occluder removal after 1 month, of whom 2 recovered, 1 remained CLBBB, and 1 had complete atrioventricular block (CAVB); the other 4 children received drug treatment, of whom 2 had normal heart rhythm, 1 had left anterior fascicular block, and 1 died of cardiac shock and heart failure.All the 11 late-onset cases were first treated by drugs, of whom 3 recovered, and the other 8 remained CLBBB.One of the 8 cases received occluder removal at 8 months after surgery and recovered, 1 had CAVB, and the other 6 remained CLBBB.Conclusions:For patients with CLBBB after transcatheter closure of VSD, drug therapy is not always effective, and CLBBB is easy to recur.Therefore, occluder removal is recommended to be done immediately after CLBBB is discovered.Patients with persistent CLBBB should be followed up regularly, and pacemaker implantation may be performed if necessary.

Objective:To investigate the value of early tight junction protein Claudin-5 levels in predicting the severity of acute pancreatitis (AP).Methods:A prospective observational study was conducted, including patients diagnosed with AP and admitted to the Northern Jiangsu People's Hospital from December 1, 2021 to November 30, 2022. Eligible healthy volunteers were randomly selected to serve as healthy controls during the same period. Patients were classified into mild acute pancreatitis (MAP) group, moderate-severe acute pancreatitis (MSAP) group, and severe acute pancreatitis (SAP) group based on the 2012 Atlanta classification criteria. Patients with SAP were then divided into three subgroups of 1, 3, and 7 days based on the duration of hospitalization. Baseline data, such as gender, age, underlying disease, and probable etiology, was collected from all enrolled individuals. The enzyme-linked immunosorbent assay (ELISA) was employed to detect serum Claudin-5 levels in each cohort of enrollees. Data on additional serologic indicators, including hematocrit (HCT), albumin (Alb), serum Ca 2+, C-reactive protein (CRP), and procalcitonin (PCT) levels, were obtained via the in-hospital test query system in each group of patients with AP. The modified Marshall score (mMarshall), modified CT severity index (mCTSI) score, bedside severity index of severity in acute pancreatitis (BISAP) score, and acute physiology and chronic health evaluation Ⅱ(APACHEⅡ) were recorded for each group of patients with AP. Differences in the above indicators between groups were analyzed and compared. Spearman's correlation method was employed to examine the relationship between Claudin-5 levels and each influential factor. The receiver operator characteristic curve (ROC curve) was plotted to analyze the predictive value of each influencing factor on SAP. Ridge regression was used to screen for independent risk factors for SAP. Results:A total of 109 patients with AP were enrolled, comprising 66 in the MAP group, 15 in the MSAP group, and 28 in the SAP group. Additionally, 27 healthy volunteers were enrolled as the healthy control group. No statistically significant differences were observed in gender and age among the enrolled groups, and no statistically significant differences were identified among the three groups of patients with AP in terms of underlying disease and etiologic composition. As the disease progressed, serum Claudin-5 levels exhibited a notable increase across all AP patient groups, and they were all significantly higher than those in the healthy control group [ng/L: 888.58 (574.52, 1 141.59), 3 749.02 (2 784.93, 5 789.92), 4 667.81 (3 935.21, 7 315.66) vs. 291.13 (250.19, 314.75), all P < 0.05]. Subgroup analyses showed that as the disease duration prolonged, patients in the SAP group exhibited a notable decline in Claudin-5 levels at 3 days post-admission, compared with those at 1 day post-admission [ng/L: 2 052.59 (1 089.43, 4 006.47) vs. 4 667.81 (3 935.21, 7 315.66), P < 0.05]. Spearman correlation analysis showed that serum Claudin-5 levels in patients with AP were significantly positively correlated with CRP, PCT, HCT, and mMarshall, mCTSI, and BISAP scores ( r values were 0.570, 0.525, 0.323, 0.774, 0.670, 0.652, all P < 0.001), and significantly negatively correlated with Alb ( r = -0.394, P < 0.001). A significant trend was observed in patients with AP, with an increase of HCT levels and a decrease of Alb levels as the disease progressed (both P < 0.05). An improvement of aforementioned phenomena was observed in patients with SAP following treatment, indirectly indicating that serum Claudin-5 level was a positive indicator of vascular leakage. ROC curve analysis showed that serum Claudin-5 levels in patients with AP exhibited the highest accuracy for early prediction of SAP, with the area under the ROC curve (AUC) of 0.948. When serum Claudin-5 levels ≥2 997 ng/L, the sensitivity for early screening for SAP was 100% and the specificity was 88.89%. Multifactorial ridge regression analysis showed that serum Claudin-5 level, PCT and APACHEⅡscore could be used as independent risk factors for early prediction of SAP (all P < 0.05). Conclusion:Serum Claudin-5 levels facilitate early prediction of SAP and are strongly associated with inflammatory response and vascular leakage.

Objective:To investigate the long-term safety and effectiveness of stent implantation for residual pulmonary artery stenosis after complicated congenital heart disease.Methods:The symptoms, signs, echocardiography, cardiac CT, cardiac catheterization, six-minute walking distance, and BNP of 41 patients diagnosed from January 1996 to January 2020. In this group, 41 patients, 30 males and 11 females, aged 1.3-14.5 years old, mean (6.1±3.6) years old, and weighed 8-43 kg, mean (18.9±9.4)kg, compared the diameter of the target vessel, pressure difference across stenosis, cardiac function before and postoperative follow-up, and evaluated the long-term effect of stent implantation in the treatment of pulmonary artery stenosis.Results:All 41 patients were not lost to follow-up, no death, and there were no serious adverse events such as stent fracture, artery dissection and pulmonary embolism during follow-up. The median follow-up time was 7.1 years (3.1 to 13.8 years). As of January 2023, the echocardiographic results showed that the diameter of the target vessels in 41 patients increased from preoperative (3.9±1.5) mm to (6.0±1.5) mm ( P<0.05), the pressure difference across the stenosis decreased from preoperative (51.4±19.1) mmHg to (33.1±19.7) mmHg (1 mmHg=0.133 kPa, P<0.05); Heart spiral CT showed that the ratio of target vessel diameter to distal vessel diameter increased from preoperative 0.4±0.2 to 0.9±0.3( P<0.05). All patients had no slow growth and development, no recurrent lung infection, 39 patients (95.1%) had gradeⅠcardiac function, and 2 patients (4.9%) had gradeⅡcardiac function.As children in school age, the walking distance of 6 min was 462 to 633 m, mean( 529.9±57.1)m, the respiratory score was 0.5-1, and the lower limb force score was 6-12. There were 5 long-term adverse events, including 4 cases of target vessel restenosis (9.7%), and 1 case (2.4%), two of the patients with restenosis with repeated target vessel stenosis and lateral pulmonary hypertension were surgically intervention: stent removing and pumonary expanding, after 4, 13 years of stent implantation.And the others were still in follow-up, and no further intervention was made. The Cox multivariate survival analysis suggested that right ventricular systolic blood pressure was a risk factor for endpoint events before stent implantation ( P<0.05). Conclusion:The treatment of residual pulmonary artery stenosis after complicated congenital heart disease after percutaneous stent implantation can effectively relieve the right heart pressure overload, improve pulmonary blood flow, stabilize cardiac function, improve the long-term prognosis of patients with complicated congenital heart disease, reduce the chest opening rate of reoperation, and have stable long-term curative effect.

Objective:To explore the potential mechanisms of anterior cingulate cortex (ACC) in modulating pain behavior and anxiety-like behavior of rats with chronic non-specific low back pain induced by nerve growth factor (NGF).Methods:Ninety-six male SPF grade SD rats aged 8 weeks were randomly divided into four groups according the random number table method: control group, model group, control+ D-2-amino-5-phosphonopentanoate (D-AP5) group (control+ D-AP5 group) and model+ D-AP5 group, with 24 rats in each group.Low back pain model of rat was established by injection of NGF into multifidus muscle (left side) of the low backs of rats(two times with a five-day interval). Five days after modeling, rats in model+ D-AP5 group and control+ D-AP5 group were injected with the N-methyl-D-aspartate (NMDA) receptor antagonist D-AP5(2 μg, 0.3 μL) at the right side of the ACC once a day for consecutive 3 days, and rats in control group and model group were injected with the same amount of 0.9% sodium chloride solution. Seven days after modeling, the pain threshold of rats was evaluated by mechanical stimulation test and hot and cold plate test.The anxiety-like behavior was tested by open field test.The density of glial fibrillary acidic protein (GFAP) positive cells and c-Fos(a kind of immediate early gene) positive cells of the spinal cord were observed by immunofluorescence. The expression of GFAP, c-Fos, phosphorylated-c-Jun N-terminal kinases (p-JNK), monocyte chemoattractant protein-1 (MCP-1), and chemokine (C-X-C motif) ligand 1 (CXCL-1) proteins in the L2 segment of the spinal cord were detected by Western blot. SPSS 23.0 software was used for statistical analysis. One-way ANOVA was used to analyze normal distribution measurement data for comparison among multiple groups, and Tukey test was used for further pairwise comparisons. The Kruakal-Wallis H test was used for non-normal distribution measurement data, and Mann-Whitney U test was used for further pairwise comparisons with Bonferroni-corrected P-values. Results:In the experiments measuring pressure pain threshold (PPT) and paw withdrawal threshold (PWT), there were statistically significant differences in the PPT and PWT of rats among the four groups ( F=53.498, 41.939, both P<0.001). Seven days after modeling, PPT ((418.5±46.9) g) and PWT ( (55.6±7.1) g) in the ipsilateral side of the rats in model+ D-AP5 group were higher than those in model group ((290.0±32.0) g, (30.5±7.5) g) (both P<0.001). In the open field test, there were statistically significant differences in percentage of the inner zone distance ( H=11.922, P<0.01) and the percentage of inner zone time ( H=21.614, P<0.001) of rats among the four groups. The percentage of inner zone time in model+ D-AP5 group was higher than that in model group (5.6(4.3, 7.9) %, 3.1(2.1, 3.8) %) ( P<0.01). The results of immunofluorescence showed that there were statistically significant differences in the density of GFAP positive cells and c-Fos positive cells at the ipsilateral side of the superficial laminae of rats among the four groups ( H=49.085, F=18.120, both P<0.001). The density of GFAP positive cells (34.3(21.1, 47.5) cells/mm 2) and c-Fos positive cells ((52.7±39.4) cells/mm 2) at the ipsilateral side of the superficial laminae in model+ D-AP5 group were less than those in model group (76.5(68.6, 94.9) cells/mm 2, (112.4±63.7) cells/mm 2) (both P<0.001). The Western blot results showed that there were statistically significant differences in the protein expression of GFAP, c-Fos, p-JNK, MCP-1 and CXCL-1 in the L2 segment of rats among the four groups ( F=49.413, 38.437, 41.867, 36.735, 130.951, all P<0.001). The protein expression of GFAP (1.7±0.5), c-Fos (1.1±0.1), p-JNK (1.7±0.3), MCP-1 (1.0±0.4) and CXCL-1 (0.8±0.1) in the L2 segment in model+ D-AP5 group were lower than those in model group ((4.3±0.7), (2.6±0.5), (2.8±0.4), (2.9±0.4), (3.5±0.4)) (all P<0.01). Conclusion:ACC modulates mechanical hyperalgesia and anxiety-like behavior in chronic non-specific low back pain rats, which might be associated with the involvement of spinal astrocytes, p-JNK signal pathway and chemokines such as MCP-1 and CXCL-1.

Objective: To identify the risk of HIV infection among men who have sex with men (MSM) with different sex roles, so as to provide insights into the prevention and control strategies for HIV infection among MSM. Methods: Peer-driven sampling method was employed to recruit MSM in a city in Xinjiang Uygur Autonomous Region in 2022, a questionnaire survey was conducted to collect demographic information and sexual behaviors, and laboratory tests were conducted to detect HIV and syphilis antibodies. The characteristics of sexual behaviors among MSM with different sex roles and prevalence of HIV infection were analyzed, and factors affecting HIV infection among MSM were identified using a multivariable logistic regression model. Results: A total of 666 MSM were investigated, with a mean age of (28.70±8.09) years and 577 local residents (86.64%). There were 166 insertive MSM (24.92%), 179 receptive MSM (26.88%) and 321 both receptive and insertive MSM (48.20%). The HIV infection rate was 8.26%, with 3.61% in insertive MSM, 13.41% in receptive MSM, and 7.79% in both receptive and insertive MSM. Significant differences were seen in age, recruitment route, sexual orientation, age of first homosexual sex, condom use with temporary partners and HIV infection rate among different sex roles (all P<0.05). Multivariable logistic regression analysis showed that insertive MSM had a lower risk of HIV infection than both receptive and insertive MSM (OR=0.513, 95%CI: 0.272-0.969), while there was no significant difference in the risk of HIV infection between receptive MSM and both receptive and insertive MSM (OR=2.088, 95%CI: 0.081-5.380). Conclusions The risk of HIV infection among receptive and both receptive and insertive MSM are higher than that among insertive MSM. Classified measures should be taken to reduce the transmission of HIV in this population.

Objective:To study the signaling pathway of the up-regulation of claudin-5 expression by Xuebijing injection.Methods:Animal and cell models of acute respiratory distress syndrome (ARDS) were induced by lipopolysaccharide (LPS). ① In vivo study, 20 male Sprague-Dawley (SD) rats were randomly divided into 4 groups: control group, LPS group (LPS injection 10 mg/kg for 12 hours), Xuebijing control group (Xuebijing injection 1 mg/kg, twice a day, for 3 days), and Xuebijing intervention group (LPS injection after pretreatment of Xuebijing injection), according to random number method with 5 rats in each group. The lung tissues were taken to detect lung dry/wet weight ratio (W/D) and the morphological changes in each group. Claudin-5, phosphorylated forkhead box transcription factor O1 (p-FOXO1), total FOXO1 (t-FOXO1), phosphorylated Akt (p-Akt) and total Akt (t-Akt) in lung tissues were detected by immunohistochemical staining (IHC) and Western blotting. ② In vitro study, human pulmonary microvascular endothelial cells (HPMECs) were divided into 6 groups (5 holes in each group): control group, Xubijing control group (incubated with 2 g/L Xubijing for 24 hours), phosphoinositide 3-kinases (PI3K) signaling pathway LY294002 control group (incubated with 10 μmol/L LY294002 for 1 hour), LPS group (incubated with 1 mg/L LPS for 12 hours), Xubijing intervention group (incubated with 2 g/L Xuebijing for 24 hours, then with 1 mg/L LPS for 12 hours) and LY294002 intervention group (incubated with 10 μmol/L LY294002 for 1 hour, then with 2 g/L and Xubijing for 24 hours, and then with 1 mg/L LPS for 12 hours). The expression levels of claudin-5, p-FOXO1, t-FOXO1, p-Akt and t-Akt of HPMECs in each group were assessed by Western blotting. Results:In vivo study: ① Compared with the control group, the lung W/D ratio increased significantly in LPS group (6.79±0.42 vs. 4.19±0.13), and decreased significantly after the intervention of Xuebijing (4.92±0.38 vs. 6.79±0.42, P < 0.01). ② Morphological changes of lung tissue: compared with the control group, the injury of lung tissue in LPS group was more serious, which was significantly improved after Xuebijing intervention. ③ Expression levels of claudin-5, p-Akt/t-Akt and p-FOXO1/t-FOXO1: the expression levels of claudin-5, p-Akt/t-Akt and p-FOXO1/t-FOXO1 in LPS group were significantly decreased as compared with the control group (claudin-5/GAPDH: 0.33±0.03 vs. 1.03±0.07, p-Akt/t-Akt: 0.18±0.02 vs. 1.01±0.13, p-FOXO1/t-FOXO1: 0.16±0.06 vs. 1.00±0.19, all P < 0.01). After the intervention of Xuebijing, the expression levels were significantly increased as compared with the LPS group (claudin-5/GAPDH: 0.53±0.05 vs. 0.33±0.03, p-Akt/t-Akt: 0.56±0.12 vs. 0.18±0.02, p-FOXO1/t-FOXO1: 0.68±0.10 vs. 0.16±0.06, all P < 0.01). In vitro study: compared with the control group, the expression level of claudin-5 in the LPS group was significantly decreased (claudin-5/β-actin: 0.45±0.03 vs. 1.01±0.15, P < 0.01), and the expression level of claudin-5 in Xuebijing intervention group was also significantly decreased (claudin-5/β-actin: 0.80±0.08 vs. 1.01±0.15, P < 0.01). After the intervention of LY294002, the expression of claudin-5 was significantly decreased as compared with the Xubijing intervention group (claudin-5/β-actin: 0.41±0.02 vs. 0.80±0.08, P < 0.01). Conclusion:Xuebijing injection improve pulmonary vascular barrier function in rats with ARDS by up-regulating claudin-5 expression through PI3K/Akt/FOXO1 signaling pathway.

Currently, transcranial magnetic stimulation (TMS) has been widely used in the treatment of depression, Parkinson's disease and other neurological diseases. To be able to monitor the brain's internal activity during TMS in real time and achieve better treatment outcomes, the researchers proposed combining TMS with neuroimaging methods such as magnetic resonance imaging (MRI), both of which use Tesla-level magnetic fields. However, the combination of strong current, large magnetic field and small size is likely to bring physical concerns which can lead to mechanical and thermal instability. In this paper, the MRI static magnetic field, the TMS coil and human head model were built according to the actual situations. Through the coupling of the magnetic field and the heat transfer module in the finite element simulation software COMSOL, the force and temperature of the TMS coil and head were obtained when the TMS was used in combination with MRI (TMS-MRI technology). The results showed that in a 3 T MRI environment, the maximum force density on the coil could reach 2.51 × 10⁹ N/m³. Both the direction of the external magnetic field and the current direction in the coil affected the force distributions. The closer to the boundary of the external magnetic field, the greater the force. The magnetic field generated by the coil during TMS treatment increased the temperature of the brain tissue by about 0.16 °C, and the presence of the MRI static magnetic field did not cause additional thermal effects. The results of this paper can provide a reference for the development of the use guidelines and safety guidelines of TMS-MRI technology.
Brain/physiology* ; Humans ; Magnetic Fields ; Magnetic Resonance Imaging/methods* ; Temperature ; Transcranial Magnetic Stimulation/methods*

Objective : To investigate the effect and mechanism of prenatal hypoxia on pulmonary artery vascular function in adult male offspring. Methods : Sprague⁃Dawley pregnant rats were randomly divided into hypoxia group and control group. Pregnant rats in the hypoxia group were housed in the hypoxia chamber ( a mixture of 89. 5% nitrogen gas and 10. 5% oxygen) from gestational day 10th to 20th. Pregnant rats in the control group were fed under normal oxygen. All animals were fed with standard rat food and tap water, and allowed to give birth naturally. After weaning , the male offspring were raised to 4 months old. Male offspring rats were anesthetized with chloral hydrate , and pulmonary artery was isolated for vascular function and molecular experiments. Results : Compared with the control group , phenylephrine ( PE) Ⅳ induced contraction response in prenatal hypoxic pulmonary artery was decreased (P < 0. 001) . There was no difference in acetyl choline (ACH) Ⅳand sodium nitrate (SNP) Ⅳinduced diastolic responses between the two groups. Compared with control group , Cav1 . 2 protein (P < 0. 01) and mRNA levels (P < 0. 001) in hypoxia group were reduced. Conclusion Prenatal hypoxia can lead to a decreased PE⁃induced vasoconstriction response in adult male offspring , which is related to the down⁃regulation of Cav1. 2 expression in pulmonary artery.