Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards* ; Humans ; Consensus ; Drugs, Chinese Herbal/therapeutic use* ; Surveys and Questionnaires

OBJECTIVE: To compare the clinical efficacy and complication rates of staged open reduction internal fixation (ORIF) and external fixation combined with limited internal fixation (EFLIF) in the treatment of high-energy Pilon fractures. METHODS: A retrospective selection was conducted on 78 patients diagnosed with high-energy tibial Pilon fractures who received treatment between January 2021 and October 2023. These patients were categorized into the staged ORIF group and the EFLIF group according to their respective treatment protocols. The staged ORIF group comprised 48 patients, including 29 males and 19 females, aged from 33 to 53 years old with a mean age of (43.25±4.67) years old. The time from injury to treatment averaged (6.54±2.21) hours. All patients received staged ORIF treatment. The EFLIF Group consisted of 30 patients, including 18 males and 12 females, aged from 36 to 54 years old with a mean age of (43.37±3.24) years old. The time from injury to treatment averaged (6.87±1.96) hours. All patients received EFLIF treatment. The recovery of ankle joint function, fracture reduction quality, fracture healing time, and surgical-related indicators between two groups were observed and compared six months after surgery. Additionally, the postoperative complications of the two groups were recorded. RESULTS: Both groups of patients were followed up and the duration ranged from 6 to 12 months, with an average of (8.97±1.26) months. At 6-month postoperative follow-up, the American Orthopaedic Foot and Ankle Society (AOFAS) score in the ORIF group was (83.15±20.93), which did not show a statistically significant difference compared to the EFLIF group (81.88±20.67), P>0.05. The excellent and good rate of fracture reduction in the staged ORIF group was 33.33% (16/48), which did not show a statistically significant difference compared to the EFLIF group (30.00%, 9/30), P>0.05. The hospitalization duration and fracture healing time in the staged ORIF group were (16.57±1.25) days and (12.14±1.15) weeks, respectively. When compared to the EFLIF group, which demonstrated a hospitalization duration of (15.97±2.16 ) days and a fracture healing time of (12.36±1.17) weeks, no statistically significant differences were observed (P>0.05). The intraoperative blood loss in the staged ORIF group was (76.54±11.65) ml, which was significantly higher than that in the EFLIF group (70.15±10.29) ml, and the difference was statistically significant (P<0.05). The incidence of superficial tissue infection was 2.08%(1/48), which was significantly lower than that observed in the EFLIF group at 16.67% (5/30), and this difference was statistically significant (P<0.05). CONCLUSION Both staged ORIF and EFLIF were effective treatment options for high-energy closed Pilon fractures of the tibia. However, regarding the prevention of superficial tissue infection, staged ORIF demonstrates superior risk control compared to EFLIF.
Humans ; Male ; Female ; Middle Aged ; Adult ; Tibial Fractures/physiopathology* ; Fracture Fixation, Internal/methods* ; Retrospective Studies ; External Fixators ; Open Fracture Reduction/methods* ; Treatment Outcome

PURPOSE: Septic shock is associated with high mortality and poor outcomes among sepsis patients with coagulopathy. Although traditional statistical methods or machine learning (ML) algorithms have been proposed to predict septic shock, these potential approaches have never been systematically compared. The present work aimed to develop and compare models to predict septic shock among patients with sepsis. METHODS: It is a retrospective cohort study based on 484 patients with sepsis who were admitted to our intensive care units between May 2018 and November 2022. Patients from the 908th Hospital of Chinese PLA Logistical Support Force and Nanchang Hongdu Hospital of Traditional Chinese Medicine were respectively allocated to training (n=311) and validation (n=173) sets. All clinical and laboratory data of sepsis patients characterized by comprehensive coagulation indexes were collected. We developed 5 models based on ML algorithms and 1 model based on a traditional statistical method to predict septic shock in the training cohort. The performance of all models was assessed using the area under the receiver operating characteristic curve and calibration plots. Decision curve analysis was used to evaluate the net benefit of the models. The validation set was applied to verify the predictive accuracy of the models. This study also used Shapley additive explanations method to assess variable importance and explain the prediction made by a ML algorithm. RESULTS: Among all patients, 37.2% experienced septic shock. The characteristic curves of the 6 models ranged from 0.833 to 0.962 and 0.630 to 0.744 in the training and validation sets, respectively. The model with the best prediction performance was based on the support vector machine (SVM) algorithm, which was constructed by age, tissue plasminogen activator-inhibitor complex, prothrombin time, international normalized ratio, white blood cells, and platelet counts. The SVM model showed good calibration and discrimination and a greater net benefit in decision curve analysis. CONCLUSION The SVM algorithm may be superior to other ML and traditional statistical algorithms for predicting septic shock. Physicians can better understand the reliability of the predictive model by Shapley additive explanations value analysis.
Humans ; Shock, Septic/blood* ; Machine Learning ; Male ; Female ; Retrospective Studies ; Middle Aged ; Aged ; Sepsis/complications* ; ROC Curve ; Cohort Studies ; Adult ; Intensive Care Units ; Algorithms ; Blood Coagulation ; Critical Illness

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula. METHODS: A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated. RESULTS: The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas. CONCLUSIONS The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans ; Male ; Female ; Child, Preschool ; Child ; Coronary Artery Disease/diagnostic imaging* ; Infant ; Mucocutaneous Lymph Node Syndrome ; Regression Analysis ; Coronary Vessels/diagnostic imaging* ; Echocardiography ; Adolescent

An 11-year-old boy presented with erythematous plaques over the bilateral mandibular and mental regions for 2 years, accompanied by cough and dyspnea for more than 2 months. Chest computed tomography angiography revealed marked stenosis of the right pulmonary artery, irregular aortic caliber, and aortic wall thickening. Histopathological examination of the skin lesion, including immunohistochemistry and special stains, confirmed a chronic suppurative inflammation. Whole-exome sequencing was negative. A final diagnosis of granuloma faciale and Takayasu arteritis was established. Combination therapy with systemic tocilizumab, prednisone, and methotrexate, along with topical 0.1% tacrolimus ointment, resulted in a favorable clinical response. This report summarizes the clinical features of a pediatric case of granuloma faciale and Takayasu arteritis and reviews the etiology, diagnostic approach, and current treatment strategies for the disorders, aiming to enhance clinicians' understanding of these conditions.
Humans ; Male ; Child ; Takayasu Arteritis/diagnosis* ; Facial Dermatoses/diagnosis*

OBJECTIVE: To investigate lymph node metastasis (LNM) in the prostatic anterior fat pad (PAFP) of PCa patients after robot-assisted radical prostatectomy (RARP), and analyze the clinicopathological features and prognosis of LNM in the PAFP. METHODS: We retrospectively analyzed the clinicopathological data on 1 003 cases of PCa treated by RARP in the Department of Urology of PLA General Hospital from January 2017 to December 2022. All the patients underwent routine removal of the PAFP during RARP and pathological examination, with the results of all the specimens examined and reported by pathologists. Based on the presence and locations of LNM, we grouped the patients for statistical analysis, compared the clinicopathological features between different groups using the Student's t, Mann-Whitney U and Chi-square tests, and conducted survival analyses using the Kaplan-Meier and Log-rank methods and survival curves generated by Rstudio. RESULTS: Lymph nodes were detected in 77 (7.7%) of the 1 003 PAFP samples, and LNM in 11 (14.3%) of the 77 cases, with a positive rate of 1.1% (11/1 003). Of the 11 positive cases, 9 were found in the upgraded pathological N stage, and the other 2 complicated by pelvic LNM. The patients with postoperative pathological stage≥T3 constituted a significantly higher proportion in the PAFP LNM than in the non-PAFP LNM group (81.8% ［9/11］ vs 36.2% ［359/992］, P = 0.005), and so did the cases with Gleason score ≥8 (87.5% ［7/8］ vs 35.5% ［279/786］, P = 0.009). No statistically significant differences were observed in the clinicopathological features and biochemical recurrence-free survival between the patients with PAFP LNM only and those with pelvic LNM only. CONCLUSION The PAFP is a potential route to LNM, and patients with LNM in the PAFP are characterized by poor pathological features. There is no statistically significant difference in biochemical recurrence-free survival between the patients with PAFP LNM only and those with pelvic LNM only. Routine removal of the PAFP and independent pathological examination of the specimen during RARP is of great clinical significance.
Humans ; Male ; Prostatectomy/methods* ; Robotic Surgical Procedures ; Lymphatic Metastasis ; Retrospective Studies ; Prognosis ; Prostatic Neoplasms/pathology* ; Adipose Tissue/pathology* ; Prostate/pathology* ; Lymph Nodes/pathology* ; Middle Aged ; Aged

【Objective】 To objectively evaluate the quality control level of blood testing process in blood banks through quantitative monitoring and trend analysis, and to promote the homogenization level and standardized management of blood testing laboratories in blood banks. 【Methods】 A quality monitoring indicator system covering the whole process of blood collection and supply, including blood donation service, blood component preparation, blood testing, blood supply and quality control was established. The questionnaire Quality Monitoring Indicators for Blood Collection and Supply Process with clear definition of indicators and calculation formulas was distributed to 17 blood banks in Shandong province. Quality monitoring indicators of each blood bank from January to December 2022 were collected, and 31 indicators in terms of blood testing were analyzed using SPSS25.0 software. 【Results】 The proportion of unqualified serological tests in 17 blood bank laboratories was 55.84% for ALT, 13.63% for HBsAg, 5.08% for anti HCV, 5.62% for anti HIV, 18.18% for anti TP, and 1.65% for other factors (mainly sample quality). The detection unqualified rate and median were (1.23±0.57)% and 1.11%, respectively. The ALT unqualified rate and median were (0.74±0.53)% and 0.60%, respectively. The detection unqualified rate was positively correlated with ALT unqualified rate (r=0.974, P<0.05). The unqualified rate of HBsAg, anti HCV, anti HIV and anti TP was (0.15±0.09)%, (0.05±0.04)%, (0.06±0.03)% and (0.20±0.05)% respectively. The average unqualified rate, average hemolysis rate, average insufficient volume rate and the abnormal hematocrit rate of samples in 17 blood bank laboratories was 0.21‰, 0.08‰, 0.01‰ and 0.02‰ respectively. There were differences in the retest concordance rates of four HBsAg, anti HCV and anti HIV reagents, and three anti TP reagents among 17 blood bank laboratories (P<0.05). The usage rate of ELISA reagents was (114.56±3.30)%, the outage rate of ELISA was (10.23±7.05) ‰, and the out of range rate of ELISA was (0.90±1.17) ‰. There was no correlation between the out of range rate, outrage rate and usage rate (all P>0.05), while the outrage rate was positively correlated with the usage rate (r=0.592, P<0.05). A total of 443 HBV DNA positive samples were detected in all blood banks, with an unqualified rate of 3.78/10 000; 15 HCV RNA positive samples were detected, with an unqualified rate of 0.13/10 000; 5 HIV RNA positive samples were detected, with an unqualified rate of 0.04/10 000. The unqualified rate of NAT was (0.72±0.04)‰, the single NAT reaction rate [(0.39±0.02)‰] was positively correlated with the single HBV DNA reaction rate [ (0.36±0.02) ‰] (r=0.886, P<0.05). There was a difference in the discriminated reactive rate by individual NAT among three blood bank laboratories (C, F, H) (P<0.05). The median resolution rate of 17 blood station laboratories by minipool test was 36.36%, the median rate of invalid batch of NAT was 0.67%, and the median rate of invalid result of NAT was 0.07‰. The consistency rate of ELISA dual reagent detection results was (99.63±0.24)%, and the median length of equipment failure was 14 days. The error rate of blood type testing in blood collection department was 0.14‰. 【Conclusion】 The quality monitoring indicator system for blood testing process in Shandong can monitor potential risks before, during and after the experiment, and has good applicability, feasibility, and effectiveness, and can facilitate the continuous improvement of laboratory quality control level. The application of blood testing quality monitoring indicators will promote the homogenization and standardization of blood quality management in Shandong, and lay the foundation for future comprehensive evaluations of blood banks.

【Objective】 To establish an effective quality indicator monitoring system, scientifically and objectively evaluate the quality management level of blood banks, and achieve continuous improvement of quality management in blood bank. 【Methods】 A quality monitoring indicator system that covers the whole process of blood collection and supply was established, the questionnaire of Quality Monitoring Indicators for Blood Collection and Supply Process with clear definition of indicators and calculation formulas was distributed to 17 blood banks in Shandong. Statistical analysis of 21 quality monitoring indicators in terms of blood donation service (10 indicators), blood component preparation (7 indicators ), and blood supply (4 indicators) from each blood bank from January to December 2022 were conducted using SPSS25.0 software The differences in quality monitoring indicators of blood banks of different scales were analyzed. 【Results】 The average values of quality monitoring indicators for blood donation service process of 17 blood banks were as follows: 44.66% (2 233/5 000) of regular donors proportion, 0.22% (11/50) of adverse reactions incidence, 0.46% (23/5 000) of non-standard whole blood collection rate, 0.052% (13/25 000) of missed HBsAg screening rate, 99.42% (4 971/5 000) of first, puncture successful rate, 86.49% (173/200) of double platelet collection rate, 66.50% (133/200) of 400 mL whole blood collection rate, 99.25% (397/400) of donor satisfaction rate, 82.68% (2 067/2 500) of use rate of whole blood collection bags with bypass system with sample tube, and 1 case of occupational exposure in blood collection.There was a strong positive correlation between the proportion of regular blood donors and the collection rate of 400 mL whole blood (P<0.05). The platelet collection rate, incidence of adverse reactions to blood donation, and non-standard whole blood collection rate in large blood banks were significantly lower than those in medium and small blood banks (P<0.05). The average quality monitoring indicators for blood component preparation process of 17 blood banks were as follows: the leakage rate of blood component preparation bags was 0.03% (3/10 000), the discarding rate of lipemic blood was 3.05% (61/2 000), the discarding rate of hemolysis blood was 0.13%(13/10 000). 0.06 case had labeling errors, 8 bags had blood catheter leaks, 2.76 bags had blood puncture/connection leaks, and 0.59 cases had non-conforming consumables. The discarding rate of hemolysis blood of large blood banks was significantly lower than that of medium and small blood banks (P<0.05), and the discarding rate of lipemic blood of large and medium blood banks was significantly lower than that of small blood banks (P<0.05). The average values of quality monitoring indicators for blood supply process of 17 blood banks were as follows: the discarding rate of expired blood was 0.023% (23/100 000), the leakage rate during storage and distribution was of 0.009%(9/100 000), the discarding rate of returned blood was 0.106% (53/50 000), the service satisfaction of hospitals was 99.16% (2 479/2 500). The leakage rate of blood components during storage and distribution was statistically different with that of blood component preparation bags between different blood banks (P<0.05). There were statistically significant differences in the proportion of regular blood donors, incidence of adverse reactions, non-standard whole blood collection rate, 400 mL whole blood collection rate, double platelet collection rate, the blood bag leakage rate during preparation process, the blood components leakage rate during storage and distribution as well as the discarding rate of lipemic blood, hemolysis blood, expired blood and returned blood among large, medium and small blood banks (all P<0.05). 【Conclusion】 The establishment of a quality monitoring indicator system for blood donation services, blood component preparation and blood supply processes in Shandong has good applicability, feasibility and effectiveness. It can objectively evaluate the quality management level, facilitate the continuous improvement of the quality management system, promote the homogenization of blood management in the province and lay the foundation for future comprehensive evaluation of blood banks.

Objective:To analyze the methylation characteristics of the lymphocyte-specific protein-tyrosine kinase (LCK) promoter region in the peripheral blood circulation of rheumatoid arthritis (RA) patients and its correlation with clinical indicators.Methods:Targeted methylation sequencing was used to compare the methylation levels of 7 CpG sites in the LCK promoter region in the peripheral blood of RA patients with healthy controls (HC) and osteoarthritis (OA) patients. Correlation analysis and ROC curve construction were performed with clinical information.Results:Non-parametric tests revealed that compared with HC [0.53(0.50, 0.57)] and OA patients [0.59(0.54, 0.62), H=47.17, P<0.001], RA patients [0.63(0.59, 0.68)] exhibited an overall increase in methylation levels. Simultaneously, when compared with the HC group [0.38(0.35, 0.41), 0.59(0.55, 0.63), 0.60(0.55, 0.64), 0.59(0.55, 0.63), 0.58(0.53, 0.62), 0.45(0.43, 0.49), 0.57(0.54, 0.61)], the RA group [0.46(0.42, 0.49), 0.70(0.65, 0.75), 0.70(0.66, 0.76), 0.70(0.65, 0.75), 0.69(0.64, 0.74), 0.55(0.51, 0.59), 0.68(0.63, 0.73)] showed a significant elevation in methylation levels at CpG sites cg05350315_60, cg05350315_80, cg05350315_95, cg05350315_101, cg05350315_104, cg05350315_128, and cg05350315_142, with statistically significant differences ( Z=-5.63, -5.89, -5.91, -5.89, -5.98, -5.95, -5.95, all P<0.001). Compared with the OA group [0.65(0.59, 0.69), 0.65(0.60, 0.69), 0.64(0.58, 0.68), 0.50(0.45, 0.54), 0.63(0.58, 0.67)], the RA group [0.70(0.66, 0.76), 0.70(0.65, 0.75), 0.69(0.64, 0.74), 0.55(0.51, 0.59), 0.68(0.63, 0.73)] exhibited a significant increase in methylation levels at CpG sites cg05350315_95, cg05350315_101, cg05350315_104, cg05350315_128, and cg05350315_142, with statistically significant differences ( Z=-3.56, -3.52, -3.60, -3.67, -3.62; P=0.036, 0.042, 0.031, 0.030, 0.030). Furthermore, Pearson correlation coefficient analysis revealed a positive correlation between the overall methylation level in this region and C-reactive protein (CRP) ( r=0.19, P=0.004) and erythrocyte sedimentation rate ( r=0.14, P=0.035). The overall methylation level of the LCK promoter region in the CRP (low) group [0.63 (0.58, 0.68)] was higher than that in the CRP (high) group [0.65(0.61, 0.70)], with statistically significant differences ( Z=2.60, P=0.009). Finally, by constru-cting a ROC curve, the discriminatory efficacy of peripheral blood LCK promoter region methylation levels for identifying RA patients, especially seronegative RA patients, from HC and OA groups was validated, with an AUC value of 0.78 (95% CI: 0.63, 0.93). Conclusion:This study provides insights into the methylation status and methylation haplotype patterns of the LCK promoter region in the peripheral blood of RA patients. The overall methylation level in this region is positively correlated with the level of inflammation and can be used to differentiate seronegative RA patients from the HC and OA patients.