Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards* ; Humans ; Consensus ; Drugs, Chinese Herbal/therapeutic use* ; Surveys and Questionnaires

OBJECTIVE: To compare the clinical efficacy and complication rates of staged open reduction internal fixation (ORIF) and external fixation combined with limited internal fixation (EFLIF) in the treatment of high-energy Pilon fractures. METHODS: A retrospective selection was conducted on 78 patients diagnosed with high-energy tibial Pilon fractures who received treatment between January 2021 and October 2023. These patients were categorized into the staged ORIF group and the EFLIF group according to their respective treatment protocols. The staged ORIF group comprised 48 patients, including 29 males and 19 females, aged from 33 to 53 years old with a mean age of (43.25±4.67) years old. The time from injury to treatment averaged (6.54±2.21) hours. All patients received staged ORIF treatment. The EFLIF Group consisted of 30 patients, including 18 males and 12 females, aged from 36 to 54 years old with a mean age of (43.37±3.24) years old. The time from injury to treatment averaged (6.87±1.96) hours. All patients received EFLIF treatment. The recovery of ankle joint function, fracture reduction quality, fracture healing time, and surgical-related indicators between two groups were observed and compared six months after surgery. Additionally, the postoperative complications of the two groups were recorded. RESULTS: Both groups of patients were followed up and the duration ranged from 6 to 12 months, with an average of (8.97±1.26) months. At 6-month postoperative follow-up, the American Orthopaedic Foot and Ankle Society (AOFAS) score in the ORIF group was (83.15±20.93), which did not show a statistically significant difference compared to the EFLIF group (81.88±20.67), P>0.05. The excellent and good rate of fracture reduction in the staged ORIF group was 33.33% (16/48), which did not show a statistically significant difference compared to the EFLIF group (30.00%, 9/30), P>0.05. The hospitalization duration and fracture healing time in the staged ORIF group were (16.57±1.25) days and (12.14±1.15) weeks, respectively. When compared to the EFLIF group, which demonstrated a hospitalization duration of (15.97±2.16 ) days and a fracture healing time of (12.36±1.17) weeks, no statistically significant differences were observed (P>0.05). The intraoperative blood loss in the staged ORIF group was (76.54±11.65) ml, which was significantly higher than that in the EFLIF group (70.15±10.29) ml, and the difference was statistically significant (P<0.05). The incidence of superficial tissue infection was 2.08%(1/48), which was significantly lower than that observed in the EFLIF group at 16.67% (5/30), and this difference was statistically significant (P<0.05). CONCLUSION Both staged ORIF and EFLIF were effective treatment options for high-energy closed Pilon fractures of the tibia. However, regarding the prevention of superficial tissue infection, staged ORIF demonstrates superior risk control compared to EFLIF.
Humans ; Male ; Female ; Middle Aged ; Adult ; Tibial Fractures/physiopathology* ; Fracture Fixation, Internal/methods* ; Retrospective Studies ; External Fixators ; Open Fracture Reduction/methods* ; Treatment Outcome

PURPOSE: Septic shock is associated with high mortality and poor outcomes among sepsis patients with coagulopathy. Although traditional statistical methods or machine learning (ML) algorithms have been proposed to predict septic shock, these potential approaches have never been systematically compared. The present work aimed to develop and compare models to predict septic shock among patients with sepsis. METHODS: It is a retrospective cohort study based on 484 patients with sepsis who were admitted to our intensive care units between May 2018 and November 2022. Patients from the 908th Hospital of Chinese PLA Logistical Support Force and Nanchang Hongdu Hospital of Traditional Chinese Medicine were respectively allocated to training (n=311) and validation (n=173) sets. All clinical and laboratory data of sepsis patients characterized by comprehensive coagulation indexes were collected. We developed 5 models based on ML algorithms and 1 model based on a traditional statistical method to predict septic shock in the training cohort. The performance of all models was assessed using the area under the receiver operating characteristic curve and calibration plots. Decision curve analysis was used to evaluate the net benefit of the models. The validation set was applied to verify the predictive accuracy of the models. This study also used Shapley additive explanations method to assess variable importance and explain the prediction made by a ML algorithm. RESULTS: Among all patients, 37.2% experienced septic shock. The characteristic curves of the 6 models ranged from 0.833 to 0.962 and 0.630 to 0.744 in the training and validation sets, respectively. The model with the best prediction performance was based on the support vector machine (SVM) algorithm, which was constructed by age, tissue plasminogen activator-inhibitor complex, prothrombin time, international normalized ratio, white blood cells, and platelet counts. The SVM model showed good calibration and discrimination and a greater net benefit in decision curve analysis. CONCLUSION The SVM algorithm may be superior to other ML and traditional statistical algorithms for predicting septic shock. Physicians can better understand the reliability of the predictive model by Shapley additive explanations value analysis.
Humans ; Shock, Septic/blood* ; Machine Learning ; Male ; Female ; Retrospective Studies ; Middle Aged ; Aged ; Sepsis/complications* ; ROC Curve ; Cohort Studies ; Adult ; Intensive Care Units ; Algorithms ; Blood Coagulation ; Critical Illness

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula. METHODS: A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated. RESULTS: The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas. CONCLUSIONS The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans ; Male ; Female ; Child, Preschool ; Child ; Coronary Artery Disease/diagnostic imaging* ; Infant ; Mucocutaneous Lymph Node Syndrome ; Regression Analysis ; Coronary Vessels/diagnostic imaging* ; Echocardiography ; Adolescent

An 11-year-old boy presented with erythematous plaques over the bilateral mandibular and mental regions for 2 years, accompanied by cough and dyspnea for more than 2 months. Chest computed tomography angiography revealed marked stenosis of the right pulmonary artery, irregular aortic caliber, and aortic wall thickening. Histopathological examination of the skin lesion, including immunohistochemistry and special stains, confirmed a chronic suppurative inflammation. Whole-exome sequencing was negative. A final diagnosis of granuloma faciale and Takayasu arteritis was established. Combination therapy with systemic tocilizumab, prednisone, and methotrexate, along with topical 0.1% tacrolimus ointment, resulted in a favorable clinical response. This report summarizes the clinical features of a pediatric case of granuloma faciale and Takayasu arteritis and reviews the etiology, diagnostic approach, and current treatment strategies for the disorders, aiming to enhance clinicians' understanding of these conditions.
Humans ; Male ; Child ; Takayasu Arteritis/diagnosis* ; Facial Dermatoses/diagnosis*

OBJECTIVE: To investigate lymph node metastasis (LNM) in the prostatic anterior fat pad (PAFP) of PCa patients after robot-assisted radical prostatectomy (RARP), and analyze the clinicopathological features and prognosis of LNM in the PAFP. METHODS: We retrospectively analyzed the clinicopathological data on 1 003 cases of PCa treated by RARP in the Department of Urology of PLA General Hospital from January 2017 to December 2022. All the patients underwent routine removal of the PAFP during RARP and pathological examination, with the results of all the specimens examined and reported by pathologists. Based on the presence and locations of LNM, we grouped the patients for statistical analysis, compared the clinicopathological features between different groups using the Student's t, Mann-Whitney U and Chi-square tests, and conducted survival analyses using the Kaplan-Meier and Log-rank methods and survival curves generated by Rstudio. RESULTS: Lymph nodes were detected in 77 (7.7%) of the 1 003 PAFP samples, and LNM in 11 (14.3%) of the 77 cases, with a positive rate of 1.1% (11/1 003). Of the 11 positive cases, 9 were found in the upgraded pathological N stage, and the other 2 complicated by pelvic LNM. The patients with postoperative pathological stage≥T3 constituted a significantly higher proportion in the PAFP LNM than in the non-PAFP LNM group (81.8% ［9/11］ vs 36.2% ［359/992］, P = 0.005), and so did the cases with Gleason score ≥8 (87.5% ［7/8］ vs 35.5% ［279/786］, P = 0.009). No statistically significant differences were observed in the clinicopathological features and biochemical recurrence-free survival between the patients with PAFP LNM only and those with pelvic LNM only. CONCLUSION The PAFP is a potential route to LNM, and patients with LNM in the PAFP are characterized by poor pathological features. There is no statistically significant difference in biochemical recurrence-free survival between the patients with PAFP LNM only and those with pelvic LNM only. Routine removal of the PAFP and independent pathological examination of the specimen during RARP is of great clinical significance.
Humans ; Male ; Prostatectomy/methods* ; Robotic Surgical Procedures ; Lymphatic Metastasis ; Retrospective Studies ; Prognosis ; Prostatic Neoplasms/pathology* ; Adipose Tissue/pathology* ; Prostate/pathology* ; Lymph Nodes/pathology* ; Middle Aged ; Aged

Objective To compare the differences in the clinical application of Sijunzi Decoction,a classical formula for tonifying qi,in ancient and modern literature,so as to provide a reference for its clinical application and research and development.Methods The clinical application of Sijunzi Decoction in ancient times was analyzed by retrieving the database of Zhong Hua Yi Dian(Collection of Traditional Chinese Medical Books),and the clinical application of Sijunzi Decoction in modern times was analyzed by retrieving the database of China National Knowledge Infrastructure(CNKI).Results In the record of ancient traditional Chinese medicine books,Sijunzi Decoction was indicated for the syndromes characterized by the pathogenesis of"deficiency of nutrient qi and defensive qi,and weakness of zang-fu organs",and was widely used to treat various diseases related to internal medicine,surgery,gynecology and pediatrics,including dysentery,consumptive disease,diarrhea,jaundice,smallpox,metrorrhagia and carbuncle.Moreover,Sijunzi Decoction was used for the management of patients who was weakness due to chronic diseases,elderly and insufficiency of qi,or at the late stage of exogenous cold disease,cholera,and malaria.In the modern clinical practice,Sijunzi Decoction was indicated for digestive system diseases,surgical diseases,tumor-related diseases,pediatric diseases,gynecological diseases,respiratory diseases and hepatobiliary diseases,in particular for chronic gastritis,adverse reactions related to radiotherapy and chemotherapy for tumors,postoperative period of cancer and diabetes mellitus during pregnancy.Conclusion The analysis of ancient and modern literatures indicated that the indications of Sijunzi Decoction is expanded from the predominated spleen-stomach system diseases(digestive system diseases)in antient times to multiple system diseases such as surgical diseases,tumor-related diseases,pediatric diseases,gynecological diseases,respiratory diseases and hepatobiliary diseases in modern times.And the pathogenesis of the indications of Sijunzi Decoction is characterized by the"deficiency of nutrient qi and defensive qi,and weakness of the zang-fu organs".

Objective:To analyze the methylation characteristics of the lymphocyte-specific protein-tyrosine kinase (LCK) promoter region in the peripheral blood circulation of rheumatoid arthritis (RA) patients and its correlation with clinical indicators.Methods:Targeted methylation sequencing was used to compare the methylation levels of 7 CpG sites in the LCK promoter region in the peripheral blood of RA patients with healthy controls (HC) and osteoarthritis (OA) patients. Correlation analysis and ROC curve construction were performed with clinical information.Results:Non-parametric tests revealed that compared with HC [0.53(0.50, 0.57)] and OA patients [0.59(0.54, 0.62), H=47.17, P<0.001], RA patients [0.63(0.59, 0.68)] exhibited an overall increase in methylation levels. Simultaneously, when compared with the HC group [0.38(0.35, 0.41), 0.59(0.55, 0.63), 0.60(0.55, 0.64), 0.59(0.55, 0.63), 0.58(0.53, 0.62), 0.45(0.43, 0.49), 0.57(0.54, 0.61)], the RA group [0.46(0.42, 0.49), 0.70(0.65, 0.75), 0.70(0.66, 0.76), 0.70(0.65, 0.75), 0.69(0.64, 0.74), 0.55(0.51, 0.59), 0.68(0.63, 0.73)] showed a significant elevation in methylation levels at CpG sites cg05350315_60, cg05350315_80, cg05350315_95, cg05350315_101, cg05350315_104, cg05350315_128, and cg05350315_142, with statistically significant differences ( Z=-5.63, -5.89, -5.91, -5.89, -5.98, -5.95, -5.95, all P<0.001). Compared with the OA group [0.65(0.59, 0.69), 0.65(0.60, 0.69), 0.64(0.58, 0.68), 0.50(0.45, 0.54), 0.63(0.58, 0.67)], the RA group [0.70(0.66, 0.76), 0.70(0.65, 0.75), 0.69(0.64, 0.74), 0.55(0.51, 0.59), 0.68(0.63, 0.73)] exhibited a significant increase in methylation levels at CpG sites cg05350315_95, cg05350315_101, cg05350315_104, cg05350315_128, and cg05350315_142, with statistically significant differences ( Z=-3.56, -3.52, -3.60, -3.67, -3.62; P=0.036, 0.042, 0.031, 0.030, 0.030). Furthermore, Pearson correlation coefficient analysis revealed a positive correlation between the overall methylation level in this region and C-reactive protein (CRP) ( r=0.19, P=0.004) and erythrocyte sedimentation rate ( r=0.14, P=0.035). The overall methylation level of the LCK promoter region in the CRP (low) group [0.63 (0.58, 0.68)] was higher than that in the CRP (high) group [0.65(0.61, 0.70)], with statistically significant differences ( Z=2.60, P=0.009). Finally, by constru-cting a ROC curve, the discriminatory efficacy of peripheral blood LCK promoter region methylation levels for identifying RA patients, especially seronegative RA patients, from HC and OA groups was validated, with an AUC value of 0.78 (95% CI: 0.63, 0.93). Conclusion:This study provides insights into the methylation status and methylation haplotype patterns of the LCK promoter region in the peripheral blood of RA patients. The overall methylation level in this region is positively correlated with the level of inflammation and can be used to differentiate seronegative RA patients from the HC and OA patients.

Objective To investigate the correlation between the level of N-terminal pro-Brain natriuretic peptide(NT-proBNP)and cardiorespiratory fitness following acute exposure to high altitude.Methods Forty-six subjects were recruited from the Second Affiliated Hospital of Army Medical University in June 2022,including 19 males and 27 females.After completing cardiopulmonary exercise test(CPET),serological detection of myocardial cell-related markers,and multiple metabolites at a plain altitude(300 meters above sea level),all subjects flew to a high-altitude location(3900 meters above sea level).Biomarker testing and CPET were repeated on the second and third days after arrival at high altitude.Changes in serum biomarker and key CPET indicators before and after rapid ascent to high altitude were compared,and the correlation between serum levels of various myocardial cell-related markers and metabolites and high altitude cardiorespiratory fitness was analyzed.Results Compared with the plain altitude,there was a significant decrease in maximal oxygen uptake after rapid ascent to high altitude[(25.41±6.20)ml/(kg.min)vs.(30.17±5.01)ml/(kg.min),P<0.001].Serum levels of NT-proBNP,Epinephrine(E),plasma renin activity(PRA),angiotensin Ⅱ(Ang Ⅱ),angiotensin-converting enzyme 2(ACE2)and leptin(LEP)significantly increased,with all differences being statistically significant(P<0.05)after acute high altitude exposure.In contrast,no statistically significant differences were observed for creatine kinase MB(CK-MB),cardiac troponin I(cTnI),myoglobin(Myo)and norepinephrine(NE)(P>0.05).Correlation analysis showed a significant negative correlation between NT-proBNP at plain altitude(r=-0.768,P<0.001)and at high altitude(r=-0.791,P<0.001)with maximal oxygen uptake at high altitude.Multivariate linear regression analysis indicated that maximal oxygen uptake at plain altitude(t=2.069,P=0.045),NT-proBNP at plain altitude(t=-2.436,P=0.020)and at high altitude(t=-3.578,P=0.001)were independent influencing factors of cardiorespiratory fitness at high altitude.Conclusion Cardiorespiratory fitness significantly decreases after rapid ascent to high altitude,and the baseline NT-proBNP level at plain altitude is closely related to cardiorespiratory fitness at high altitude,making it a potential predictor indicator for high altitude cardiorespiratory fitness.