1.Development and validation of a prediction score for subtype diagnosis of primary aldosteronism.
Ping LIU ; Wei ZHANG ; Jiao WANG ; Hongfei JI ; Haibin WANG ; Lin ZHAO ; Jinbo HU ; Hang SHEN ; Yi LI ; Chunhua SONG ; Feng GUO ; Xiaojun MA ; Qingzhu WANG ; Zhankui JIA ; Xuepei ZHANG ; Mingwei SHAO ; Yi SONG ; Xunjie FAN ; Yuanyuan LUO ; Fangyi WEI ; Xiaotong WANG ; Yanyan ZHAO ; Guijun QIN
Chinese Medical Journal 2025;138(23):3206-3208
2.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
3.Acupuncture Therapy on Dysphagia in Patients with Parkinson's Disease: A Randomized Controlled Study.
Hong-Ji ZENG ; Wei-Jia ZHAO ; Peng-Chao LUO ; Xu-Yang ZHANG ; Si-Yu LUO ; Yi LI ; He-Ping LI ; Liu-Gen WANG ; Xi ZENG
Chinese journal of integrative medicine 2025;31(3):261-269
OBJECTIVE:
To explore the effect of acupuncture therapy on dysphagia in patients with Parkinson's disease.
METHODS:
This randomized controlled study lasted 42 days and included 112 patients with Parkinson's disease and dysphagia. Participants were randomly assigned to the experimental and control groups (56 cases each group) using the completely randomized design, all under routine treatment. The experimental group was given acupuncture therapy. The primary outcome was Penetration-Aspiration Scale (PAS). The secondary outcomes were (1) Standardized Swallowing Assessment (SSA), and (2) nutritional status including body mass index (BMI), serum albumin, prealbumin, and hemoglobin. Adverse events were recorded as safety indicators.
RESULTS:
One participant quitted the study midway. There were no significant differences in baseline assessment (P>0.05). After treatment, both groups showed significant improvement in PAS, SSA and nutritional status except for BMI of the control group. There were significant differences between the two groups in the PAS for both paste and liquid, SSA (25.18±8.25 vs. 20.84±6.92), BMI (19.97±3.34 kg/m2vs. 21.26 ±2.38 kg/m2), serum albumin (35.16 ±5.29 g/L vs. 37.24 ±3.98 g/L), prealbumin (248.33 ±27.72 mg/L vs. 261.39 ±22.10 mg/L), hemoglobin (119.09±12.53 g/L vs. 126.67±13.97 g/L) (P<0.05). There were no severe adverse events during the study.
CONCLUSION:
The combination of routine treatment and acupuncture therapy can better improve dysphagia and nutritional status in patients with Parkinson's disease, than routine treatment solely. (registration No.
CLINICALTRIAL
gov NCT06199323).
Humans
;
Parkinson Disease/therapy*
;
Deglutition Disorders/physiopathology*
;
Acupuncture Therapy/adverse effects*
;
Male
;
Female
;
Aged
;
Middle Aged
;
Treatment Outcome
;
Nutritional Status
;
Body Mass Index
4.Mechanism of icariin inhibiting the proliferation of human prostate cancer PC-3 cells:An exploration based on cell metabolomics
Tao WANG ; Wei WANG ; Wen-Jun XIONG ; Zi-Jing ZHANG ; Fei WANG ; Yao-Hui PENG ; Yan CHEN ; Hai-Ping ZENG ; Li-Jie LUO
National Journal of Andrology 2024;30(11):963-973
Objective:To study the mechanism of icariin inhibiting the proliferation of human PCa PC-3 cells based on cell metabolomics technology.Methods:We determined the proliferation activity of human PC-3 cells by methyl thiazolyl tetrazolium(MTT)assay,and compared the proliferation of the PC-3 cells among the control,5-fluorouracil and icariin intervention groups.Using the Bligh Dyer method,we extracted endogenous metabolites from the cells,analyzed the metabolic profile by ultra-high pressure liquid chromatography tandem quadrupole time-of-flight mass spectrometry,identified the differential metabolites by principal component anal-ysis and orthogonal partial least-squares discrimination analysis,and enriched the metabolic pathways based on the MetaboAnalyst data-base.Results:Icariin significantly inhibited the proliferation of human PCa PC-3 cells.A total of 89 differential metabolites were i-dentified,mainly including amino acids,phosphatidylcholine,phosphatidylethanolamine,lysophosphatidylcholine,and lysophosphati-dylethanolamine,all with the tendency to return to the normal level after icariin intervention.Icariin significantly downregulated the metabolic levels of the glycerophospholipid metabolites phosphatidylcholine,phosphatidylethanolamine,lysophosphatidylcholine and ly-sophosphatidylethanolamine,and upregulated those of amino acid metabolites tryptophan,leucine,and proline in the PC-3 cells.Conclusion:Icariin inhibits the proliferation of human PCa PC-3 cells,which may be closely related to its regulatory effect on lipid metabolism(glycerophospholipid metabolism)and amino acid metabolism.
5.Current situation and quality control of multidisciplinary clinic——a case study of a tertiary hospital in Guangxi
Zhixiong ZHAO ; Ruhong LONG ; Ping LI ; Liping LUO ; Xiuke WEI
Modern Hospital 2024;24(3):402-405
The Multi-disciplinary diagnosis and treatment(MDT)outpatient service is widely used in the diagnosis and treatment of patients with tumors,difficult critical and complex diseases and multiple diseases.The purpose of this paper is to study the one-stop treatment mode of MDT outpatient service in tertiary hospitals and the closed-loop management after diagnosis,which plays an important role in integrating medical resources,optimizing medical treatment process,improving patient medical experience,and ensuring medical quality and safety.In view of the weak links and difficulties in quality control in MDT outpa-tient management,such as insufficient attention from functional departments,low enthusiasm of clinicians,low initiative of pa-tients,imperfect information construction of MDT outpatient service,poor quality improvement effect,etc.,Effective manage-ment methods such as core members'guidance,supporting incentive and assessment mechanism,regular reporting of quality,im-proving information construction,extending service scope,and increasing publicity efforts have been adopted for continuous im-provement,and remarkable results have been achieved in increasing the number of cases and diseases,expanding brand influ-ence,and improving the quality of consultation.
6.Interventional effect of bone marrow mesenchymal stem cell transplantation with different doses of X-ray irradiation induced hepatic injury in mice
Yue LIANG ; Lan LUO ; Tianyu CHENG ; Gaofeng CHEN ; Wei LIU ; Yongping MU ; Jiamei CHEN ; Ping LIU
Chinese Journal of Hepatology 2024;32(11):1019-1027
Objective:To investigate the interventional effect of bone marrow mesenchymal stem cell (BMMSC) transplantation with different doses of X-ray irradiation induced hepatic injury in mice.Methods:Eighteen female C57BL/6J mice were randomly divided into 0, 2, and 3 Gy irradiation groups and 0, 2, and 3 Gy transplantation groups. The irradiation group was used as the control and injected with an equal volume of culture medium. The mice in the transplantation group were irradiated with different doses of X-ray irradiation, and BMMSCs were intravenously infused into the bone marrow. The mice were sacrificed for sampling at the end of the 21st day. Mice body weight changes were recorded daily. The changes in the content of peripheral blood lymphocytes, red blood cells, platelets, and hemoglobin were detected by an automatic blood tester. The morphological changes in mice liver tissues were observed by hematoxylin-eosin staining. The serum activities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were detected by a biochemical analyzer. The reduced glutathione contents in liver tissue were detected by the microplate method. The malondialdehyde content in liver tissue was detected by thiobarbituric acid. The content of total superoxide dismutase (T-SOD) in liver tissue was detected by the hydroxylamine method. The expression of the F4/80 protein in liver tissue was detected by the immunohistochemistry method. The protein expression of nuclear transcription factor erythroid 2 related factor 2 (Nrf2) and heme oxygenase 1 (HO-1) in liver tissue was determined by the western blotting method. The mRNA expression of NLRP3, IL-6, and Nrf2 in liver tissue was detected by a real-time quantitative polymerase chain reaction. The multiple-group comparisons were analyzed by factorial analysis of variance. The inter-group comparisons were analyzed by the LSD method for statistical analysis.Results:The contents of peripheral blood lymphocytes, erythrocytes, platelets, and hemoglobin were significantly decreased in the 3 Gy irradiation group than the 0 Gy irradiation group ( P<0.05), while the activities of serum ALT and AST were significantly increased ( P<0.05). The malondialdehyde content, F4/80 protein expression level, nucleotide-binding domain and leucine-rich repeats, nucleotide oligomerization domain-like receptor family, pyrin domain containing 3 (NLRP3), and interleukin 6 mRNA expression levels were significantly increased in liver tissue, while the contents of T-SOD and glutathione, Nrf2 and HO-1 protein expression levels, and Nrf2 mRNA expression level in liver tissue were significantly decreased ( P<0.05). The contents of peripheral blood lymphocytes, red blood cells, platelets, and hemoglobin were significantly increased in the 3 Gy transplantation group than the 3 Gy irradiation group ( P<0.05), while the activities of serum ALT and AST were significantly decreased ( P<0.05). The malondialdehyde content, F4/80 protein expression level, NLRP3 and interleukin-6 mRNA expression levels in liver tissue were significantly decreased ( P<0.05), while the content of T-SOD and glutathione, Nrf2 and HO-1 protein expression levels, and Nrf2 mRNA expression level in liver tissue were significantly increased ( P<0.05). Conclusion:X-ray irradiation at a dose of 3 Gy can induce liver oxidative damage in mice. BMMSC transplantation can improve X-ray irradiation-induced liver oxidative damage in mice, and its mechanism of action may be related to the regulation of the Nrf2/HO-1 pathway.
7.Influence of curative-intent resection with textbook outcomes on long-term prognosis of gall-bladder carcinoma: a national multicenter study
Zhipeng LIU ; Zimu LI ; Yule LUO ; Xiaolin ZHAO ; Jie BAI ; Yan JIANG ; Yunfeng LI ; Chao YU ; Fan HUANG ; Zhaoping WU ; Jinxue ZHOU ; Dalong YIN ; Rui DING ; Wei GUO ; Yi ZHU ; Wei CHEN ; Kecan LIN ; Ping YUE ; Yao CHENG ; Haisu DAI ; Dong ZHANG ; Zhiyu CHEN
Chinese Journal of Digestive Surgery 2024;23(7):926-933
Objective:To investigate the influence of curative-intent resection with textbook outcomes of liver surgery (TOLS) on long-term prognosis of gallbladder carcinoma (GBC).Methods:The retrospective cohort study was conducted. The clinicopathological data of 824 patients with GBC in the national multicenter database of Biliary Surgery Group of Elite Group of Chinese Journal of Digestive Surgery, who were admitted to 15 medical centers from January 2014 to January 2021, were collected. There were 285 males and 539 females, aged (62±11)years. According to the evalua-tion criteria of TOLS, patients were divided into those who achieved TOLS and those who did not achieve TOLS. Measurement data with normal distribution were represented as Mean± SD, and com-parison between groups was conducted using the independent sample t test. Measurement data with skewed distribution were represented as M( Q1, Q3), and comparison between groups was conducted using the Mann-Whitney U test. Count data were described as absolute numbers, and comparison between groups was conducted using the chi-square test. Comparison of ordinal data were conduc-ted using the Mann-Whitney U test. The Kaplan-Meier method was used to calculate survival rate and draw survival curve, and the Log-rank test was used for survival analysis. The COX stepwise regression model with backward Wald method was used for univariate and multivariate analyses. Results:(1) Achievement of TOLS. Of the 824 patients undergoing curative-intent resection for GBC, there were 510 cases achieving TOLS and 314 cases not achieving TOLS. (2) Follow-up. Of the 824 patients undergoing curative-intent resection for GBC, after excluding 112 deaths within 90 days after discharge, 712 cases were included for the survival analysis. The median follow-up time, median overall survival time and 5-year overall survival rate of the 510 patients achieving TOLS were 22.1(11.4,30.1)months, 47.6(30.6,64.6)months and 47.5%. The median follow-up time, median overall survival time and 5-year overall survival rate of the 202 patients not achieving TOLS were 14.0(6.8,25.5)months, 24.3(20.0,28.6)months and 21.0%. There was a significant difference in overall survival between patients achieving TOLS and patients not achieving TOLS ( χ2=58.491, P<0.05). (3) Analysis of factors influencing prognosis of patients. Results of multivariate analysis showed that TOLS, carcinoembryonic antigen (CEA), CA19-9, poorly differentiation of tumor, T2 stage of eighth edition of American Joint Committee on Cancer (AJCC) staging, T3 and T4 stage of eighth edition of AJCC staging, N1 stage of the eighth edition of AJCC staging, N2 stage of the eighth edition of AJCC staging, adjuvant therapy were independent factors influencing overall survival time of patients undergoing curative-intent resection for GBC ( hazard ratio=0.452, 1.479, 1.373, 1.612, 1.455, 1.481, 1.835, 1.978, 0.538, 95% c onfidence interval as 0.352-0.581, 1.141-1.964, 1.052-1.791, 1.259-2.063, 1.102-1.920, 1.022-2.147, 1.380-2.441, 1.342-2.915, 0.382-0.758, P<0.05). Conclusion:Patients under-going curative-intent resection for GBC with TOLS can achieve better long-term prognosis.
8.A multicenter retrospective study discussion on maintenance treatment strategies for mantle cell lymphoma
Ping YANG ; Lan LUO ; Shuozi LIU ; Chunyuan LI ; Yingtong CHEN ; Wei ZHANG ; Hui LIU ; Xiubin XIAO ; Hongmei JING
Chinese Journal of Hematology 2024;45(7):660-665
Objective:This study aims to explore the survival advantages of different maintenance strategies for MCL.Methods:Clinical data of 693 newly diagnosed MCL patients in multi-centers admitted from April 1999 to December 2019 were collected. 309 cases received maintenance treatment. The characteristics of patients in different maintenance treatment groups were summarized and Kaplan-Meier survival and prognosis analysis were conducted.Results:The overall 3-year and 5-year progression-free survival (PFS) rates were (73.5±2.9) % and (53.6±4.3) %, respectively. The 3-year and 5-year overall survival (OS) rates were (94.2±1.5) % and (82.7±3.2) %, respectively. The clinical features of different maintenance treatment groups were generally consistent. The 3-year PFS rates of rituximab maintenance, lenalidomide maintenance, BTK inhibitor maintenance and dual-drug maintenance were (70.4±4.1) %, (69.1±7.6) %, (86.9±5.0) %, and (80.4±5.1) %, respectively. Corresponding 3-year OS rates were (92.9±2.4) %, (97.3±2.7) %, (97.9±2.1) %, and (95.3±2.7) %, respectively. There were no significant difference in different groups ( P=0.632, 0.313). Survival analysis identified the MCL International Prognostic Index (MIPI) high-risk group and achieving complete remission before maintenance treatment as independent risk factors for PFS. The MIPI high-risk group, high-dose cytarabine application, treatment lines, and early disease progression (POD24) emerged as independent risk factors for OS. Conclusion:Comparing the different maintenance strategies of MCL, the result showed that BTK inhibitors (BTKi) maintenance demonstrated preliminary advantages in survival. Meanwhile, high-risk group according to MIPI and incomplete remission before maintenance treatment were significant factors related to disease progression.
9.A Novel Trifluoromethyl Quinazoline Compound Inhibits Drug-resistant Glioblastoma Cells Proliferation
Xiao-Zhong CHEN ; Shi-Nan WEI ; Heng LUO ; Peng ZHANG ; Ping SUN ; Bao-Fei SUN
Chinese Journal of Biochemistry and Molecular Biology 2024;40(9):1250-1261
The current treatment of glioma is facing drug resistance,which limits the efficacy of traditional chemotherapy drugs.This study aims to explore the potential mechanisms of the trifluoromethylquinazoline compound(KZL204)against glioma.Through the Cell Counting Kit-8(CCK-8)assay,we found that KZL204 significantly inhibits the growth of drug-resistant cancer cells,with a 48-hour half-maximal inhibitory concentration(IC50)of 3.63±0.38 μmol/L,which is significantly better than the positive control drug temozolomide(TMZ)(IC50 value of 81.67±5.49 μmol/L).Additionally,flow cytometry analysis showed that KZL204 treatment significantly increased the apoptosis rate of drug-resistant tumor cells and arrested the cell cycle at the G2/M phase.At the same time,the Transwell assay confirmed the inhibitory effect of KZL204 on the migration and invasion of drug-resistant cancer cells.Transcriptome analysis revealed 2 435 differentially expressed genes in drug-resistant cancer cells treated with KZL204,of which 1 320 were upregulated,and 1 115 were downregulated.KEGG and GO enrichment analysis showed that these differential genes were significantly enriched in apoptosis-related signaling pathways.Further bioinformatics prediction and Venn diagram analysis identified 35 potential core targets,with the PI3K-AKT signaling pathway being the most significant among the differentially expressed genes.Quantitative real-time PCR(RT-qPCR)experiments confirmed the downregulating effects of KZL204 on genes such as CREB3L1,CSF1,CXCL5,BCL3,and the upregulating effects on genes like FOS,LT A,PTGS2,MAP2K3.Immunoblotting experiments at the protein level also confirmed the impact of KZL204 on the expression of apoptotic proteins,including the upregulation of Bax,cleaved Caspase-3 protein,and the downregulation ofAKT,Bcl-2,Caspase-3,and Caspase-8 protein expression.In summary,KZL204 significantly inhibits the growth and metastasis of drug-resistant glioblastoma and induces apoptosis and cell cycle arrest by regulating the PI3K-AKT and apoptosis-related signaling pathways,demonstrating its potential as a candidate drug against drug-resistant glioma.
10.Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients (version 2024)
Yao LU ; Yang LI ; Leiying ZHANG ; Hao TANG ; Huidan JING ; Yaoli WANG ; Xiangzhi JIA ; Li BA ; Maohong BIAN ; Dan CAI ; Hui CAI ; Xiaohong CAI ; Zhanshan ZHA ; Bingyu CHEN ; Daqing CHEN ; Feng CHEN ; Guoan CHEN ; Haiming CHEN ; Jing CHEN ; Min CHEN ; Qing CHEN ; Shu CHEN ; Xi CHEN ; Jinfeng CHENG ; Xiaoling CHU ; Hongwang CUI ; Xin CUI ; Zhen DA ; Ying DAI ; Surong DENG ; Weiqun DONG ; Weimin FAN ; Ke FENG ; Danhui FU ; Yongshui FU ; Qi FU ; Xuemei FU ; Jia GAN ; Xinyu GAN ; Wei GAO ; Huaizheng GONG ; Rong GUI ; Geng GUO ; Ning HAN ; Yiwen HAO ; Wubing HE ; Qiang HONG ; Ruiqin HOU ; Wei HOU ; Jie HU ; Peiyang HU ; Xi HU ; Xiaoyu HU ; Guangbin HUANG ; Jie HUANG ; Xiangyan HUANG ; Yuanshuai HUANG ; Shouyong HUN ; Xuebing JIANG ; Ping JIN ; Dong LAI ; Aiping LE ; Hongmei LI ; Bijuan LI ; Cuiying LI ; Daihong LI ; Haihong LI ; He LI ; Hui LI ; Jianping LI ; Ning LI ; Xiying LI ; Xiangmin LI ; Xiaofei LI ; Xiaojuan LI ; Zhiqiang LI ; Zhongjun LI ; Zunyan LI ; Huaqin LIANG ; Xiaohua LIANG ; Dongfa LIAO ; Qun LIAO ; Yan LIAO ; Jiajin LIN ; Chunxia LIU ; Fenghua LIU ; Peixian LIU ; Tiemei LIU ; Xiaoxin LIU ; Zhiwei LIU ; Zhongdi LIU ; Hua LU ; Jianfeng LUAN ; Jianjun LUO ; Qun LUO ; Dingfeng LYU ; Qi LYU ; Xianping LYU ; Aijun MA ; Liqiang MA ; Shuxuan MA ; Xainjun MA ; Xiaogang MA ; Xiaoli MA ; Guoqing MAO ; Shijie MU ; Shaolin NIE ; Shujuan OUYANG ; Xilin OUYANG ; Chunqiu PAN ; Jian PAN ; Xiaohua PAN ; Lei PENG ; Tao PENG ; Baohua QIAN ; Shu QIAO ; Li QIN ; Ying REN ; Zhaoqi REN ; Ruiming RONG ; Changshan SU ; Mingwei SUN ; Wenwu SUN ; Zhenwei SUN ; Haiping TANG ; Xiaofeng TANG ; Changjiu TANG ; Cuihua TAO ; Zhibin TIAN ; Juan WANG ; Baoyan WANG ; Chunyan WANG ; Gefei WANG ; Haiyan WANG ; Hongjie WANG ; Peng WANG ; Pengli WANG ; Qiushi WANG ; Xiaoning WANG ; Xinhua WANG ; Xuefeng WANG ; Yong WANG ; Yongjun WANG ; Yuanjie WANG ; Zhihua WANG ; Shaojun WEI ; Yaming WEI ; Jianbo WEN ; Jun WEN ; Jiang WU ; Jufeng WU ; Aijun XIA ; Fei XIA ; Rong XIA ; Jue XIE ; Yanchao XING ; Yan XIONG ; Feng XU ; Yongzhu XU ; Yongan XU ; Yonghe YAN ; Beizhan YAN ; Jiang YANG ; Jiangcun YANG ; Jun YANG ; Xinwen YANG ; Yongyi YANG ; Chunyan YAO ; Mingliang YE ; Changlin YIN ; Ming YIN ; Wen YIN ; Lianling YU ; Shuhong YU ; Zebo YU ; Yigang YU ; Anyong YU ; Hong YUAN ; Yi YUAN ; Chan ZHANG ; Jinjun ZHANG ; Jun ZHANG ; Kai ZHANG ; Leibing ZHANG ; Quan ZHANG ; Rongjiang ZHANG ; Sanming ZHANG ; Shengji ZHANG ; Shuo ZHANG ; Wei ZHANG ; Weidong ZHANG ; Xi ZHANG ; Xingwen ZHANG ; Guixi ZHANG ; Xiaojun ZHANG ; Guoqing ZHAO ; Jianpeng ZHAO ; Shuming ZHAO ; Beibei ZHENG ; Shangen ZHENG ; Huayou ZHOU ; Jicheng ZHOU ; Lihong ZHOU ; Mou ZHOU ; Xiaoyu ZHOU ; Xuelian ZHOU ; Yuan ZHOU ; Zheng ZHOU ; Zuhuang ZHOU ; Haiyan ZHU ; Peiyuan ZHU ; Changju ZHU ; Lili ZHU ; Zhengguo WANG ; Jianxin JIANG ; Deqing WANG ; Jiongcai LAN ; Quanli WANG ; Yang YU ; Lianyang ZHANG ; Aiqing WEN
Chinese Journal of Trauma 2024;40(10):865-881
Patients with severe trauma require an extremely timely treatment and transfusion plays an irreplaceable role in the emergency treatment of such patients. An increasing number of evidence-based medicinal evidences and clinical practices suggest that patients with severe traumatic bleeding benefit from early transfusion of low-titer group O whole blood or hemostatic resuscitation with red blood cells, plasma and platelet of a balanced ratio. However, the current domestic mode of blood supply cannot fully meet the requirements of timely and effective blood transfusion for emergency treatment of patients with severe trauma in clinical practice. In order to solve the key problems in blood supply and blood transfusion strategies for emergency treatment of severe trauma, Branch of Clinical Transfusion Medicine of Chinese Medical Association, Group for Trauma Emergency Care and Multiple Injuries of Trauma Branch of Chinese Medical Association, Young Scholar Group of Disaster Medicine Branch of Chinese Medical Association organized domestic experts of blood transfusion medicine and trauma treatment to jointly formulate Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients ( version 2024). Based on the evidence-based medical evidence and Delphi method of expert consultation and voting, 10 recommendations were put forward from two aspects of blood support mode and transfusion strategies, aiming to provide a reference for transfusion resuscitation in the emergency treatment of severe trauma and further improve the success rate of treatment of patients with severe trauma.

Result Analysis
Print
Save
E-mail