1.In vitro anti-tumor effects and mechanisms of a novel c-KIT inhibitor PN17-1 on gastrointestinal stromal tumor GIST-882 cells
Ji-wei SHEN ; Shuang WU ; Jun LI ; Yun-peng ZHOU ; Ye CHEN ; Ju LIU
Acta Pharmaceutica Sinica 2025;60(2):379-387
In recent years, gastrointestinal stromal tumors (GIST) have increased incidence and mortality, and most GIST is caused by the activation mutation of the c-KIT gene. Therefore, c-KIT has become a promising therapeutic target of GIST. At present, the drugs approved for the treatment of GIST including imatinib, sunitinib, regorafenib and ripretinib, are mostly prone to developing resistance and accompanied by various degrees of adverse reactions. Therefore, there is an urgent need to develop new c-KIT inhibitors to solve the problem of resistance. In this study, we investigated the anti-tumor effect of a novel c-KIT inhibitor PN17-1 on gastrointestinal stromal tumor GIST-882 cells
2.Optimizing 5-aminosalicylate for moderate ulcerative colitis: expert recommendations from the Asia-Pacific, Middle East, and Africa Inflammatory Bowel Disease Coalition
Filiz AKYÜZ ; Yoon Kyo AN ; Jakob BEGUN ; Satimai ANIWAN ; Huu Hoang BUI ; Webber CHAN ; Chang Hwan CHOI ; Nazeer CHOPDAT ; Susan J CONNOR ; Devendra DESAI ; Emma FLANAGAN ; Taku KOBAYASHI ; Allen Yu-Hung LAI ; Rupert W LEONG ; Alex Hwong-Ruey LEOW ; Wai Keung LEUNG ; Julajak LIMSRIVILAI ; Virly Nanda MUZELLINA ; Kiran PEDDI ; Zhihua RAN ; Shu Chen WEI ; Jose SOLLANO ; Michelle Mui Hian TEO ; Kaichun WU ; Byong Duk YE ; Choon Jin OOI
Intestinal Research 2025;23(1):37-55
The lack of clear definition and classification for “moderate ulcerative colitis (UC)” creates ambiguity regarding the suitability of step-up versus top-down treatment approaches. In this paper, experts address crucial gaps in assessing and managing moderate UC. The Asia-Pacific, Middle East, and Africa Inflammatory Bowel Disease Coalition comprised 24 experts who convened to share, discuss and vote electronically on management recommendations for moderate UC. Experts emphasized that the goal of treating UC is to attain clinical, biomarker, and endoscopic remission using cost-effective strategies such as 5-aminosalicylates (5-ASAs), well-tolerated therapy that can be optimized to improve outcomes. Experts agreed that 5-ASA therapy could be optimized by maximizing dosage (4 g/day for induction of remission), combining oral and topical administration, extending treatment duration beyond 8 weeks, and enhancing patient adherence through personalized counselling and reduced pill burden. Treatment escalation should ideally be reserved for patients with predictors of aggressive disease or those who do not respond to 5-ASA optimization. Premature treatment escalation to advanced therapies (including biologics and oral small molecules) may have long-term health and financial consequences. This paper provides consensus-based expert recommendations and a treatment algorithm, based on current evidence and practices, to assist decision-making in real-world settings.
3.Optimizing 5-aminosalicylate for moderate ulcerative colitis: expert recommendations from the Asia-Pacific, Middle East, and Africa Inflammatory Bowel Disease Coalition
Filiz AKYÜZ ; Yoon Kyo AN ; Jakob BEGUN ; Satimai ANIWAN ; Huu Hoang BUI ; Webber CHAN ; Chang Hwan CHOI ; Nazeer CHOPDAT ; Susan J CONNOR ; Devendra DESAI ; Emma FLANAGAN ; Taku KOBAYASHI ; Allen Yu-Hung LAI ; Rupert W LEONG ; Alex Hwong-Ruey LEOW ; Wai Keung LEUNG ; Julajak LIMSRIVILAI ; Virly Nanda MUZELLINA ; Kiran PEDDI ; Zhihua RAN ; Shu Chen WEI ; Jose SOLLANO ; Michelle Mui Hian TEO ; Kaichun WU ; Byong Duk YE ; Choon Jin OOI
Intestinal Research 2025;23(1):37-55
The lack of clear definition and classification for “moderate ulcerative colitis (UC)” creates ambiguity regarding the suitability of step-up versus top-down treatment approaches. In this paper, experts address crucial gaps in assessing and managing moderate UC. The Asia-Pacific, Middle East, and Africa Inflammatory Bowel Disease Coalition comprised 24 experts who convened to share, discuss and vote electronically on management recommendations for moderate UC. Experts emphasized that the goal of treating UC is to attain clinical, biomarker, and endoscopic remission using cost-effective strategies such as 5-aminosalicylates (5-ASAs), well-tolerated therapy that can be optimized to improve outcomes. Experts agreed that 5-ASA therapy could be optimized by maximizing dosage (4 g/day for induction of remission), combining oral and topical administration, extending treatment duration beyond 8 weeks, and enhancing patient adherence through personalized counselling and reduced pill burden. Treatment escalation should ideally be reserved for patients with predictors of aggressive disease or those who do not respond to 5-ASA optimization. Premature treatment escalation to advanced therapies (including biologics and oral small molecules) may have long-term health and financial consequences. This paper provides consensus-based expert recommendations and a treatment algorithm, based on current evidence and practices, to assist decision-making in real-world settings.
4.Optimizing 5-aminosalicylate for moderate ulcerative colitis: expert recommendations from the Asia-Pacific, Middle East, and Africa Inflammatory Bowel Disease Coalition
Filiz AKYÜZ ; Yoon Kyo AN ; Jakob BEGUN ; Satimai ANIWAN ; Huu Hoang BUI ; Webber CHAN ; Chang Hwan CHOI ; Nazeer CHOPDAT ; Susan J CONNOR ; Devendra DESAI ; Emma FLANAGAN ; Taku KOBAYASHI ; Allen Yu-Hung LAI ; Rupert W LEONG ; Alex Hwong-Ruey LEOW ; Wai Keung LEUNG ; Julajak LIMSRIVILAI ; Virly Nanda MUZELLINA ; Kiran PEDDI ; Zhihua RAN ; Shu Chen WEI ; Jose SOLLANO ; Michelle Mui Hian TEO ; Kaichun WU ; Byong Duk YE ; Choon Jin OOI
Intestinal Research 2025;23(1):37-55
The lack of clear definition and classification for “moderate ulcerative colitis (UC)” creates ambiguity regarding the suitability of step-up versus top-down treatment approaches. In this paper, experts address crucial gaps in assessing and managing moderate UC. The Asia-Pacific, Middle East, and Africa Inflammatory Bowel Disease Coalition comprised 24 experts who convened to share, discuss and vote electronically on management recommendations for moderate UC. Experts emphasized that the goal of treating UC is to attain clinical, biomarker, and endoscopic remission using cost-effective strategies such as 5-aminosalicylates (5-ASAs), well-tolerated therapy that can be optimized to improve outcomes. Experts agreed that 5-ASA therapy could be optimized by maximizing dosage (4 g/day for induction of remission), combining oral and topical administration, extending treatment duration beyond 8 weeks, and enhancing patient adherence through personalized counselling and reduced pill burden. Treatment escalation should ideally be reserved for patients with predictors of aggressive disease or those who do not respond to 5-ASA optimization. Premature treatment escalation to advanced therapies (including biologics and oral small molecules) may have long-term health and financial consequences. This paper provides consensus-based expert recommendations and a treatment algorithm, based on current evidence and practices, to assist decision-making in real-world settings.
5.A preliminary study on developing statistical distribution table of hearing threshold deviation for otologically normal Chinese adults
Linjie WU ; Yang LI ; Haiying LIU ; Anke ZENG ; Jinzhe LI ; Wei QIU ; Hua ZOU ; Meng YE ; Meibian ZHANG
Journal of Environmental and Occupational Medicine 2025;42(7):800-807
background Current assessment of noise-induced hearing loss relies on the hearing threshold statistical distribution table of ISO 7029-2017 standard (ISO 7029), which is based on foreign population data and lacks a hearing threshold distribution table derived from pure-tone audiometry data of the Chinese population, hindering accurate evaluation of hearing loss in this group. Objective To establish a statistical distribution table of hearing threshold level (HTL) for otologically normal Chinese adults and to provide a scientific basis for revising the diagnostic criteria of occupational noise-induced deafness in China. Methods A total of
6.Mechanism of Yishen Jiangtang Decoction in regulating endoplasmic reticulum stress-mediated NLRP3 inflammasome to improve renal damage in diabetic nephropathy db/db mice.
Yun-Jie YANG ; Bin-Hua YE ; Chen QIU ; Han-Qing WU ; Bo-Wei HUANG ; Tong WANG ; Shi-Wei RUAN ; Fang GUO ; Jian-Ting WANG ; Ming-Qian JIANG
China Journal of Chinese Materia Medica 2025;50(10):2740-2749
This study aims to explore the mechanism through which Yishen Jiangtang Decoction(YSJTD) regulates endoplasmic reticulum stress(ERS)-mediated NOD-like receptor thermal protein domain associated protein 3(NLRP3) inflammasome to improve diabetic nephropathy(DN) in db/db mice. Thirty db/db mice were randomly divided into the model group, YSJTD group, ERS inhibitor 4-phenylbutyric acid(4-PBA) group, with 10 mice in each group. Additionally, 10 db/m mice were selected as the control group. The YSJTD group was orally administered YSJTD at a dose of 0.01 mL·g~(-1), the 4-PBA group was orally administered 4-PBA at a dose of 0.5 mg·g~(-1), and the control and model groups were given an equal volume of carboxylmethyl cellulose sodium. The treatments were administered once daily for 8 weeks. Food intake, water consumption, and body weight were recorded every 2 weeks. After the intervention, fasting blood glucose(FBG), glycosylated hemoglobin(HbA1c), urine microalbumin(U-mALB), 24-hour urine volume, serum creatinine(Scr), and blood urea nitrogen(BUN) were measured. Inflammatory markers interleukin-1β(IL-1β) and interleukin-18(IL-18) were detected using the enzyme-linked immunosorbent assay(ELISA). Renal pathology was assessed through hematoxylin-eosin(HE), periodic acid-Schiff(PAS), and Masson staining, and transmission electron microscopy(TEM). Western blot was used to detect the expression levels of glucose-regulated protein 78(GRP78), C/EBP homologous protein(CHOP), NLRP3, apoptosis-associated speck-like protein containing CARD(ASC), cysteinyl aspartate-specific proteinase(caspase-1), and gasdermin D(GSDMD) in kidney tissues. The results showed that compared to the control group, the model group exhibited poor general condition, increased weight and food and water intake, and significantly higher levels of FBG, HbA1c, U-mALB, kidney index, 24-hour urine volume, IL-1β, and IL-18. Compared to the model group, the YSJTD and 4-PBA groups showed improved general condition, increased body weight, decreased food intake, and lower levels of FBG, U-mALB, kidney index, 24-hour urine volume, and IL-1β. Specifically, the YSJTD group showed a significant reduction in IL-18 levels compared to the model group, while the 4-PBA group exhibited decreased water intake and HbA1c levels compared to the model group. Although there was a decreasing trend in water intake and HbA1c in the YSJTD group, the differences were not statistically significant. No significant differences were observed in BUN, Scr, and kidney weight among the groups. Renal pathology revealed that the model group exhibited more severe renal damage compared to the control group. Kidney sections from the model group showed diffuse mesangial proliferation in the glomeruli, tubular edema, tubular dilation, significant inflammatory cell infiltration in the interstitium, and increased glycogen staining and blue collagen deposition in the basement membrane. In contrast, the YSJTD and 4-PBA groups showed varying degrees of improvement in renal damage, glycogen staining, and collagen deposition, with the YSJTD group showing more significant improvements. TEM analysis indicated that the model group had extensive cytoplasmic edema, homogeneous thickening of the basement membrane, fewer foot processes, and widening of fused foot processes. In the YSJTD and 4-PBA groups, cytoplasmic swelling of renal tissues was reduced, the basement membrane remained intact and uniform, and foot process fusion improved.Western blot results indicated that compared to the control group, the model group showed upregulation of GRP78, CHOP, GSDMD, NLRP3, ASC, and caspase-1 expression. In contrast, both the YSJTD and 4-PBA groups showed downregulation of these markers compared to the model group. These findings suggest that YSJTD exerts a protective effect against DN by alleviating NLRP3 inflammasome activation through the inhibition of ERS, thereby improving the inflammatory response in db/db DN mice.
Animals
;
Endoplasmic Reticulum Stress/drug effects*
;
Diabetic Nephropathies/metabolism*
;
NLR Family, Pyrin Domain-Containing 3 Protein/genetics*
;
Drugs, Chinese Herbal/administration & dosage*
;
Mice
;
Inflammasomes/drug effects*
;
Male
;
Kidney/pathology*
;
Endoplasmic Reticulum Chaperone BiP
;
Humans
;
Interleukin-18/genetics*
;
Mice, Inbred C57BL
7.Research progress in mechanisms of kidney-tonifying traditional Chinese medicine in promoting healing of osteoporotic fractures.
Jun WU ; Ou-Ye LI ; Ken QIN ; Xuan WAN ; Wang-Bing XU ; Yong LI ; Jia-Wei ZHONG ; Yong-Xiang YE ; Rui XU
China Journal of Chinese Materia Medica 2025;50(15):4166-4177
Osteoporotic fractures(OPF) refer to the fractures caused by minor violence in the state of osteoporosis, seriously threatening the life and health of elderly patients. Drug and surgical therapies have limitations such as single targets, diverse adverse reactions, and poor prognosis. Kidney-tonifying traditional Chinese medicine(TCM) has good potential in the treatment of OPF. TCM can promote the healing of OPF by promoting angiogenesis in the early stage of bone healing, promoting osteogenic differentiation of bone marrow mesenchymal stem cells in the stage of bone repair, maintaining the balance of osteogenic and osteoclastic system in the stage of bone remodeling, and regulating the oxidative stress responses throughout the process of OPF healing. TCM can alleviate the pathological state of osteoporosis and promote fracture healing in OPF patients via multiple pathways and targets, demonstrating the advantages and potential of biphasic regulation.
Humans
;
Drugs, Chinese Herbal/therapeutic use*
;
Osteoporotic Fractures/metabolism*
;
Animals
;
Fracture Healing/drug effects*
;
Medicine, Chinese Traditional
;
Kidney/metabolism*
;
Osteogenesis/drug effects*
8.Association of higher serum follicle-stimulating hormone levels with successful microdissection testicular sperm extraction outcomes in nonobstructive azoospermic men with reduced testicular volumes.
Ming-Zhe SONG ; Li-Jun YE ; Wei-Qiang XIAO ; Wen-Si HUANG ; Wu-Biao WEN ; Shun DAI ; Li-Yun LAI ; Yue-Qin PENG ; Tong-Hua WU ; Qing SUN ; Yong ZENG ; Jing CAI
Asian Journal of Andrology 2025;27(3):440-446
To investigate the impact of preoperative serum follicle-stimulating hormone (FSH) levels on the probability of testicular sperm retrieval, we conducted a study of nonobstructive azoospermic (NOA) men with different testicular volumes (TVs) who underwent microdissection testicular sperm extraction (micro-TESE). A total of 177 NOA patients undergoing micro-TESE for the first time from April 2019 to November 2022 in Shenzhen Zhongshan Obstetrics and Gynecology Hospital (formerly Shenzhen Zhongshan Urology Hospital, Shenzhen, China) were retrospectively reviewed. The subjects were divided into four groups based on average TV quartiles. Serum hormone levels in each TV group were compared between positive and negative sperm retrieval subgroups. Overall sperm retrieval rate was 57.6%. FSH levels (median [interquartile range]) were higher in the positive sperm retrieval subgroup compared with the negative outcome subgroup when average TV was <5 ml (first quartile [Q1: TV <3 ml]: 43.32 [17.92] IU l -1 vs 32.95 [18.56] IU l -1 , P = 0.048; second quartile [Q2: 3 ml ≤ TV <5 ml]: 31.31 [15.37] IU l -1 vs 25.59 [18.40] IU l -1 , P = 0.042). Elevated serum FSH levels were associated with successful micro-TESE sperm retrieval in NOA men whose average TVs were <5 ml (adjusted odds ratio [OR]: 1.06 per unit increase; 95% confidence interval [CI]: 1.01-1.11; P = 0.011). In men with TVs ≥5 ml, larger TVs were associated with lower odds of sperm retrieval (adjusted OR: 0.84 per 1 ml increase; 95% CI: 0.71-0.98; P = 0.029). In conclusion, elevated serum FSH levels were associated with positive sperm retrieval in micro-TESE in NOA men with TVs <5 ml. In men with TV ≥5 ml, increases in average TVs were associated with lower odds of sperm retrieval.
Humans
;
Male
;
Azoospermia/surgery*
;
Sperm Retrieval/statistics & numerical data*
;
Adult
;
Follicle Stimulating Hormone/blood*
;
Retrospective Studies
;
Testis/pathology*
;
Microdissection
;
Organ Size
9.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
10.Diagnosis of coronary artery lesions in children based on Z-score regression model.
Yong WANG ; Jia-Ying JIANG ; Yan DENG ; Bo LI ; Ping SHUAI ; Xiao-Ping HU ; Yin-Yan ZHANG ; Han WU ; Lu-Wei YE ; Qian PENG
Chinese Journal of Contemporary Pediatrics 2025;27(2):176-183
OBJECTIVES:
To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula.
METHODS:
A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated.
RESULTS:
The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas.
CONCLUSIONS
The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans
;
Male
;
Female
;
Child, Preschool
;
Child
;
Coronary Artery Disease/diagnostic imaging*
;
Infant
;
Mucocutaneous Lymph Node Syndrome
;
Regression Analysis
;
Coronary Vessels/diagnostic imaging*
;
Echocardiography
;
Adolescent

Result Analysis
Print
Save
E-mail