OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

This consensus will introduce the characteristics of fillers used in the surgical cavities of domestic nasal surgery patients based on relevant literature and expert opinions. It will also provide recommendations for the selection of cavity fillers for different nasal diseases, with chronic sinusitis as a representative example.
Humans ; Nasal Cavity/surgery* ; Nasal Surgical Procedures ; China ; Consensus ; Sinusitis/surgery* ; Dermal Fillers

Allergen-specific immunotherapy（AIT） remains the only therapeutic approach with the potential to modify the natural course of allergic rhinitis（AR）. Nevertheless, considerable inter-individual variability exists in patients'responses to AIT. To facilitate more reliable assessment of treatment efficacy, the China Rhinopathy Research Cooperation Group（CRRCG） convened young and middle-aged nasal experts in China to formulate the present consensus. The recommended subjective outcome measures for AIT comprise symptom scores, medication scores, combined symptom and medication scores, quality-of-life assessments, evaluation of disease control, and assessment of comorbidities. Objective indicators may supplement these measures. Currently available objective approaches include skin prick testing, nasal provocation testing, and allergen exposure chambers. However, these methods remain constrained by practical limitations and are not yet appropriate for routine implementation in clinical efficacy evaluation. In addition, several biomarkers, including sIgE and the sIgE/tIgE ratio, sIgG4, serum IgE-blocking activity, IgA, cytokines and chemokines, as well as immune cell surface molecules and their functional activity, have been shown to have associations with AIT outcomes. While these biomarkers may complement subjective assessments, they are subject to significant limitations. Consequently, large-scale multicenter trials and real-world evidence are required to strengthen the evidence base. The present consensus underscores the necessity of integrating patients'subjective experiences with objective testing throughout the treatment process, thereby providing a more comprehensive and accurate framework for efficacy evaluation. Looking forward, future investigations should prioritize the incorporation of multi-omics data and artificial intelligence methodologies, which hold promise for overcoming current limitations in assessment strategies and for advancing both the standardization and personalization of AIT.
Humans ; Allergens/immunology* ; China ; Consensus ; Desensitization, Immunologic ; Immunoglobulin E ; Quality of Life ; Rhinitis, Allergic/therapy* ; Treatment Outcome ; East Asian People

OBJECTIVE: This study reports the first imported case of Lassa fever (LF) in China. Laboratory detection and molecular epidemiological analysis of the Lassa virus (LASV) from this case offer valuable insights for the prevention and control of LF. METHODS: Samples of cerebrospinal fluid (CSF), blood, urine, saliva, and environmental materials were collected from the patient and their close contacts for LASV nucleotide detection. Whole-genome sequencing was performed on positive samples to analyze the genetic characteristics of the virus. RESULTS: LASV was detected in the patient's CSF, blood, and urine, while all samples from close contacts and the environment tested negative. The virus belongs to the lineage IV strain and shares the highest homology with strains from Sierra Leone. The variability in the glycoprotein complex (GPC) among different strains ranged from 3.9% to 15.1%, higher than previously reported for the seven known lineages. Amino acid mutation analysis revealed multiple mutations within the GPC immunogenic epitopes, increasing strain diversity and potentially impacting immune response. CONCLUSION The case was confirmed through nucleotide detection, with no evidence of secondary transmission or viral spread. The LASV strain identified belongs to lineage IV, with broader GPC variability than previously reported. Mutations in the immune-related sites of GPC may affect immune responses, necessitating heightened vigilance regarding the virus.
Humans ; China/epidemiology* ; Genome, Viral ; Lassa Fever/virology* ; Lassa virus/classification* ; Molecular Epidemiology ; Phylogeny

OBJECTIVE: This study aimed to evaluate the association between susceptibility genes and non-alcoholic fatty liver disease (NAFLD) in children with obesity. METHODS: We conducted a two-step case-control study. Ninety-three participants were subjected to whole-exome sequencing (exploratory set). Differential genes identified in the small sample were validated in 1,022 participants using multiplex polymerase chain reaction and high-throughput sequencing (validation set). RESULTS: In the exploratory set, 14 genes from the NAFLD-associated pathways were identified. In the validation set, after adjusting for sex, age, and body mass index, ECI2 rs2326408 (dominant model: OR = 1.33, 95% CI: 1.02-1.72; additive model: OR = 1.22, 95% CI: 1.01-1.47), C6orf201 rs659305 (dominant model: OR = 1.30, 95% CI: 1.01-1.69; additive model: OR = 1.21, 95% CI: 1.00-1.45), CALML5 rs10904516 (pre-ad dominant model: OR = 1.36, 95% CI: 1.01-1.83; adjusted dominant model: OR = 1.40, 95% CI: 1.03-1.91; and pre-ad additive model: OR = 1.26, 95% CI: 1.04-1.66) polymorphisms were significantly associated with NAFLD in children with obesity ( P < 0.05). Interaction analysis revealed that the gene-gene interaction model of CALML5 rs10904516, COX11 rs17209882, and SCD5 rs3733228 was optional ( P < 0.05), demonstrating a negative interaction between the three genes. CONCLUSION In the Chinese population, the CALML5 rs10904516, C6orf201 rs659305, and ECI2 rs2326408 variants could be genetic markers for NAFLD susceptibility.
Humans ; Non-alcoholic Fatty Liver Disease/genetics* ; Child ; Male ; Female ; Genetic Predisposition to Disease ; Case-Control Studies ; Exome Sequencing ; Adolescent ; Polymorphism, Single Nucleotide ; Obesity/complications* ; Pediatric Obesity/complications* ; China

OBJECTIVE: Chronic obstructive pulmonary disease (COPD) is a major health concern in northwest China; however, the impact of particulate matter (PM) exposure during sand-dust storms (SDS) remains poorly understood. Therefore, this study aimed to investigate the association between PM exposure on SDS days and COPD hospitalization risk in arid regions. METHODS: Data on daily COPD hospitalizations were collected from 323 hospitals from 2018 to 2022, along with the corresponding air pollutant and meteorological data for each city in Gansu Province. Employing a space-time-stratified case-crossover design and conditional Poisson regression, we analyzed 265,379 COPD hospitalizations. RESULTS: PM exposure during SDS days significantly increased COPD hospitalization risk [relative risk ( RR) for PM _2.5, lag 3:1.028, 95% confidence interval ( CI): 1.021-1.034], particularly among men and the elderly, and during the cold season. The burden of PM exposure on COPD hospitalization was substantially high in Northwest China, especially in the arid and semi-arid regions. CONCLUSION Our findings revealed a positive correlation between PM exposure during SDS episodes and elevated hospitalization rates for COPD in arid and semi-arid zones in China. This highlights the urgency of developing region-specific public health strategies to address adverse respiratory outcomes associated with SDS-related air quality deterioration.
Humans ; China/epidemiology* ; Pulmonary Disease, Chronic Obstructive/chemically induced* ; Particulate Matter/analysis* ; Hospitalization/statistics & numerical data* ; Male ; Female ; Middle Aged ; Aged ; Air Pollutants/analysis* ; Environmental Exposure/adverse effects* ; Spatio-Temporal Analysis ; Adult ; Sand ; Air Pollution

Objective:To investigate the safety and therapeutic effect of split liver transplantation (SLT) in clinical application.Methods:This is a retrospective case-series study. The clinical data of 203 consecutive SLT, 79 living donor liver transplantation (LDLT) and 1 298 whole liver transplantation (WLT) performed at the Third Affiliated Hospital of Sun Yat-sen University from July 2014 to July 2023 were retrospectively analyzed. Two hundred and three SLT liver grafts were obtained from 109 donors. One hundred and twenty-seven grafts were generated by in vitro splitting and 76 grafts were generated by in vivo splitting. There were 90 adult recipients and 113 pediatric recipients. According to time, SLT patients were divided into two groups: the early SLT group (40 cases, from July 2014 to December 2017) and the mature SLT technology group (163 cases, from January 2018 to July 2023). The survival of each group was analyzed and the main factors affecting the survival rate of SLT were analyzed. The Kaplan-Meier method and Log-rank test were used for survival analysis.Results:The cumulative survival rates at 1-, 3-, and 5-year were 74.58%, 71.47%, and 71.47% in the early SLT group, and 88.03%, 87.23%, and 87.23% in the mature SLT group, respectively. Survival rates in the mature SLT group were significantly higher than those in the early SLT group ( χ2=5.560, P=0.018). The cumulative survival rates at 1-, 3- and 5-year were 93.41%, 93.41%, 89.95% in the LDLT group and 87.38%, 81.98%, 77.04% in the WLT group, respectively. There was no significant difference among the mature SLT group, the LDLT group and the WLT group ( χ2=4.016, P=0.134). Abdominal hemorrhage, infection, primary liver graft nonfunction,and portal vein thrombosis were the main causes of early postoperative death. Conclusion:SLT can achieve results comparable to those of WLT and LDLT in mature technology liver transplant centers, but it needs to go through a certain time learning curve.

Objective To investigate the associations of reproductive health indicators with lung function and chronic obstructive pulmonary disease(COPD)among women aged 40 years and above.Methods From Jul to Sep,2021,female subjects aged 40 years and above were randomly selected from the Shanghai Suburban Adult Cohort and Biobank for COPD screening.A questionnaire was used to obtain information on demographic characteristics and reproductive health indicators.Linear regression was used to analyze the effects of reproductive health indicators on forced vital capacity(FVC)and forced expiratory volume in the first second(FEV1).Logistic regression was also used to analyze the effects of reproductive health factors on FVC as a percentage of the predicted value(FVC%Pred)and FEV1%Pred as well as on COPD.Results A total of 1876 women aged 40 years and above were enrolled with mean age of(62.1±8.2)years old,among them,78.1%were menopausal,and 40.9%had been pregnant≥3 times.Multivariate analysis showed that FVC and FEV1 decreased in postmenopausal women,but menopause was not associated with a decrease in their percentage of predicted values.Pregnancies≥3 times was a risk factor for COPD(for 3 times,OR=4.92,95%CI:1.48-19.95,P<0.05;for≥4 times,OR=9.06,95%CI:2.32-41.57,P<0.01),while pregnancies of 2 times did not increase the risk of COPD.Conclusion In women aged 40 years and above,menopause is associated with poorer FVC and FEV1,and excessive pregnancy(≥3 times)is a risk factor for COPD.