ObjectiveTo investigate the potential mechanism of Danggui Buxuetang （DBT） in the treatment of vascular dementia （VAD）. MethodsSixty male SD rats were randomly assigned to the sham-operated group， model group， DBT low-， medium-， and high-dose groups， and the donepezil group. Except for the sham-operated group， rats in all other groups underwent bilateral common carotid artery ligation. After successful modeling， DBT was administered at doses of 9.2， 18.4， 36.8 g·kg^-1 for the low-， medium-， and high-dose groups， respectively， while the donepezil group received 3 mg·kg^-1 donepezil solution by gavage once daily. After 4 consecutive weeks of drug treatment， rats underwent the Morris water maze test， novel object recognition test， Nissl staining to observe hippocampal neurons， and immunofluorescence staining to detect the expression of neuronal nuclear protein （NeuN） in the hippocampus. Western blot was used to assess the expression of PTEN-induced kinase 1 （PINK1）， Parkin， microtubule-associated protein 1 light chain 3Ⅱ （LC3Ⅱ）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax）. Transmission electron microscopy was used to observe hippocampal neuronal ultrastructure. Real-time PCR was used to detect the expression of NADPH oxidase subunits p22^phox and p47^phox in hippocampal tissues. The levels of malondialdehyde （MDA）， glutathione （GSH）， superoxide dismutase （SOD）， and total antioxidant capacity were measured to evaluate oxidative stress levels. ResultsIn the Morris water maze test， escape latency changed significantly over time in all groups except the model group. Compared with the sham-operated group， the model group showed significantly prolonged escape latency （P<0.01）. Compared with the model group， rats in the DBT groups and the donepezil group exhibited significantly shorter escape latency （P<0.05， P<0.01）. The number of crossings over the original platform was significantly reduced in the model group compared with the sham-operated group （P<0.01）， whereas rats in the DBT and donepezil groups showed significantly increased platform crossings compared with the model group （P<0.05， P<0.01）. Compared with the sham-operated group， exploration time of new objects was significantly reduced in the model group （P<0.01）. Compared with the model group， exploration time of new objects increased significantly in the medium- and high-dose DBT groups and the donepezil group （P<0.05， P<0.01）， while no significant change was observed in the low-dose DBT group. Compared with the high-dose DBT group， rats in the donepezil group had significantly prolonged escape latency and reduced platform crossings and new-object exploration time （P<0.05）. Nissl staining showed decreased density of healthy neurons in the CA1 and CA3 regions of the hippocampus in the model group， with loss of Nissl bodies and nuclear atrophy or disappearance. In the high-dose DBT group， neuronal density in CA1 and CA3 increased， with neurons arranged closely and displaying normal morphology. Immunofluorescence showed that compared with the sham-operated group， the hippocampal NeuN⁺ cell count in the VAD model group was significantly decreased（P<0.01）， compared with the VAD model group， the hippocampal NeuN⁺ cell count in the high-dose DBT group was significantly increased（P<0.01）. Compared with the sham-operated group， the expression of PINK1， Parkin， LC3Ⅱ， and Bax proteins was significantly increased（P<0.01）， while the expression of Bcl-2 was significantly decreased in the VAD model group（P<0.01）. Compared with the VAD model group， the high-dose DBT group showed significantly decreased expression of PINK1， Parkin， LC3Ⅱ， and Bax proteins（P<0.01）and significantly upregulated Bcl-2 expression（P<0.01）. The medium-dose DBT group exhibited significantly reduced expression of Parkin， LC3Ⅱ， and Bax proteins（P<0.05，P<0.01） and significantly increased Bcl-2 expression（P<0.01）， while no statistically significant differences were observed in the low-dose DBT group. Transmission electron microscopy showed mitochondrial pyknosis， thickened cristae， increased electron density， and the presence of mitochondrial autophagy in the model group. In contrast， hippocampal neurons in the high-dose DBT group contained abundant mitochondria with intact morphology， clear cristae， and uniform matrix. Compared with the sham-operated group， total antioxidant capacity， SOD activity， and GSH levels were significantly decreased， while MDA levels were significantly increased in the model group （P<0.01）. Compared with the model group， total antioxidant capacity and antioxidant levels （SOD， GSH） increased significantly， and MDA decreased significantly in the medium- and high-dose DBT groups （P<0.01）， while no significant changes were observed in the low-dose DBT group. Compared with the sham-operated group， mRNA expression of p22^phox and p47^phox was significantly increased in the model group （P<0.01）. Compared with the model group， expression of p22^phox and p47^phox was significantly decreased in the DBT groups （P<0.05， P<0.01）. ConclusionDBT may exert neuroprotective effects by regulating PINK1/Parkin-mediated mitochondrial autophagy， thereby improving learning and memory abilities and treating VAD.

ObjectiveTo observe the effect of Qishao capsules on renal injury in db/db mice with diabetic kidney disease （DKD），and explore its mechanism of protecting the kidney by inhibiting podocyte apoptosis. Methodsdb/m mice （7 mice） were used as the normal group，and db/db mice （35 mice） were randomly divided into a model group，a dapagliflozin group （0.001 g·kg^-1·d^-1），and low-，medium-，and high-dose groups of Qishao capsules （0.341 3，0.682 5，and 1.365 g·kg^-1·d^-1，respectively）. Drug intervention lasted for 8 consecutive weeks. After sampling，the serum renal function indicators ［creatinine（SCr），and urea nitrogen（BUN）］，fasting blood glucose （FBG），24 h urinary protein quantification （24 h-UTP）， and other indicators of the mice were measured. The pathological tissue morphology of the kidney was observed by periodic acid-silver methenamine （PASM） and Masson's trichrome （Masson） staining. Immunohistochemical detection of cysteine-dependent aspartate-specific protease （Caspase）-3 and B-cell lymphoma 2 （Bcl-2） was performed. Western blot was used to detect the protein expression of Caspase-8，Caspase-7，Caspase-3， and other molecules. Terminal deoxynucleotidyl transferase dUTP nick End labeling （TUNEL） staining was used to observe apoptosis in renal tissue. Immunofluorescence staining of Wilms tumor suppressor gene-1 （WT-1） was used to observe podocyte injury. Real-time polymerase chain reaction （Real-time PCR） was employed to detect Caspase-8 and Caspase-3 mRNA expression in the kidneys of experimental mice. Data analysis was conducted using statistical software GraphPad Prism 10. ResultsCompared with the normal group，the model group showed significantly increased 24 h-UTP，SCr，BUN，and FBG （P<0.01）. Additionally， PASM staining of renal tissue showed increased glycogen deposition，glomerular hypertrophy，and thickening of the basement membrane. Masson staining showed collagen fiber proliferation in renal tissue. Transmission electron microscopy showed thickening of the renal tissue basement membrane and fusion or loss of foot processes in the model group. The immunohistochemical results showed that Caspase-3 in the kidneys of the mice in the model group significantly increased （P<0.01），while the Bcl-2 protein expression level decreased significantly （P<0.01）. The number of TUNEL positive cells in renal tissue significantly increased （P<0.01）. The positive expression of WT-1 in podocytes was significantly reduced （P<0.01）. Western blot analysis showed significant upregulation of Caspase-8，Caspase-7，and Caspase-3 protein expression in renal tissue （P<0.01）. The mRNA expression levels of Caspase-8 and Caspase-3 in the kidneys increased significantly （P<0.01）. Compared with the model group，the Qishao capsules groups can significantly reduce the levels of 24 h-UTP，SCr，BUN，and FBG （P<0.01）. The pathological damage of renal tissue and podocyte injury were improved to some extent. Immunohistochemistry in the kidney showed a significant decrease in Caspase-3 （P<0.01） and a significant increase in Bcl-2 protein expression level （P<0.01）. Additionally， there were a significant decrease in the number of TUNEL positive cells in renal tissue （P<0.01），a significant increase in WT-1 positive expression in podocytes （P<0.01），marked downregulation of Caspase-8，Caspase-7，and Caspase-3 protein expression in renal tissue （P<0.05，P<0.01），and a significant decrease in Caspase-8 and Caspase-3 mRNA expression levels （P<0.01）. ConclusionQishao capsules can inhibit podocyte apoptosis by regulating the expression of Caspase-8，Caspase-7， and Caspase-3，thereby improving the diabetic renal injury in db/db mice.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

AIM: To compare the preoperative ocular biometry between Pentacam AXL and IOL Master 700 in cataract patients.METHODS:Prospective study. A total of 150 patients(150 eyes)with cataracts who were treated in our hospital from May to December 2024 were selected. The IOL Master 700 and Pentacam AXL were preoperatively used to measure axial length(AL), corneal curvature(K1, K2 and Km), anterior chamber depth(ACD), and white-to-white(WTW). The difference and consistency of the results of the two instruments were compared.RESULTS: There was no significant difference between the two instruments in the AL, K1, K2, Km, ACD, and WTW(all P>0.05). The Spearman correlation analysis showed that the two instruments positively correlated with the AL, K1, K2, Km, ACD and WTW of the operated eye(all P<0.001). The Bland-Altman analysis showed that for the Pentacam AXL and IOL Master 700, there were 5/150(3.3%), 7/150(4.7%), 4/150(2.7%), 5/150(3.3%), and 0 points outside the 95%LoA for the AL, K1, K2, Km, ACD, and WTW of the examined eyes, respectively, with all of these values less than 5%, indicating good consistency.CONCLUSION:The AL, K1, K2, Km, ACD and WTW of Pentacam AXL and IOL Master 700 in cataract patients before cataract phacoemulsification combined with IOL implantation show no significant differences, and have good correlation and consistency. The two instruments can be used interchangeably.

ObjectiveTo evaluate the impact of yang-reinforcing and blood-activating therapy on the long-term prognosis for patients with dilated cardiomyopathy （DCM） of yang deficiency and blood stasis syndrome. MethodsA retrospective cohort study was conducted involving 371 DCM patients with yang deficiency and blood stasis syndrome. The yang-reinforcing and blood-activating therapy was defined as the exposure factor. Patients were categorized into exposure group （186 cases） and non-exposure group （185 cases） according to whether they received yang-reinforcing and blood-activating therapy combined with conventional western medicine for 6 months or longer. The follow-up period was set at 48 months， and the Kaplan-Meier survival analysis was used to assess the cumulative incidence of major adverse cardiovascular events （MACE） in both groups. Cox regression analysis was used to explore the impact of yang-reinforcing and blood-activating therapy on the risk of MACE， and subgroup analysis was performed. Changes in traditional Chinese medicine （TCM） syndrome score， left ventricular ejection fraction （LVEF）， left ventricular fractional shortening （LVFS）， left ventricular end-diastolic diameter （LVEDD）， and Minnesota Living with Heart Failure Questionnaire （MLHFQ） score were compared between groups at the time of first combined use of yang-reinforcing and blood-activating therapy （before treatment） and 1 year after receiving the therapy （after treatment）. ResultsMACE occurred in 31 cases （16.67%） in the exposure group and 47 cases （25.41%） in the non-exposure group. The cumulative incidence of MACE in the exposure group was significantly lower than that in the non-exposure group ［HR=0.559， 95%CI（0.361，0.895）， P=0.014］. Cox regression analysis showed that yang-reinforcing and blood-activating therapy was an independent factor for reducing the risk of MACE in DCM patients ［HR=0.623， 95%CI（0.396，0.980）， P=0.041］， and consistent results were observed in different subgroups. Compared with pre-treatment， the exposure group showed decreased TCM syndrome score and MLHFQ score， reduced LVEDD， and increased LVEF and LVFS after treatment （P＜0.05）； in the non-exposure group， TCM syndrome score decreased， LVEF and LVFS increased， and LVEDD reduced after treatment （P＜0.05）. After treatment， the exposure group had higher LVEF and LVFS， smaller LVEDD， and lower TCM syndrome score and MLHFQ score compared with the non-exposure group （P＜0.05）. ConclusionCombining yang-reinforcing and blood-activating therapy with conventional western medicine can reduce the risk of MACE in DCM patients with yang deficiency and blood stasis syndrome， meanwhile improving their clinical symptoms， cardiac function， and quality of life.

Objective: To investigate the current status of benefit finding among young and middle-aged patients with type 2 diabetes mellitus (T2DM) and analyze its influencing factors, so as to provide a reference for improving the level of benefit finding in this population. Methods: From November 2022 to May 2023, young and middle-aged patients with T2DM aged 18-59 years hospitalized in the endocrinology departments of 2 tertiary hospitals in Hengyang City, Hunan Province were selected as survey subjects by a convenience sampling method. Basic demographic information was collected using a general questionnaire survey. Benefit finding, resourcefulness, and stigma were evaluated using the Benefit Finding Scale, the Chinese Version of the Resourcefulness Scale, and the Type 2 Diabetes Stigma Assessment Scale, respectively. A multiple linear regression model was used to analyze the influencing factors of benefit finding among young and middle-aged patients with T2DM. Results: A total of 305 young and middle-aged patients with T2DM were investigated, including 222 males (72.79%) and 83 females (27.21%). There were 231 cases aged 45-59 years, accounting for 75.74%. The scores for benefit finding, resourcefulness, and stigma were (42.86±6.06), (75.12±11.30), and (41.20±10.10), respectively. Multiple linear regression analysis showed that young and middle-aged patients with T2DM who were male (β′=0.088), aged 18-<45 years (β′=0.083), absence of diabetes complications (β′=0.124), and had higher resourcefulness scores (β′=0.679) had higher levels of benefit finding, while patients with higher stigma scores (β′=-0.097) had lower levels of benefit finding. Conclusion The level of benefit finding among young and middle-aged patients with T2DM was moderate, and was related to gender, age, diabetes complications, resourcefulness, and stigma.

Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.

BACKGROUND:Previous studies have found that neohesperidin can delay bone loss in ovariectomized mice and has the potential to treat osteoporosis,but its specific mechanism of action remains to be explored. OBJECTIVE:To explore the key targets and possible mechanisms of neohesperidin in the treatment of osteoporosis based on bioinformatics and cell experiments in vitro. METHODS:The gene expression dataset related to osteoporosis was obtained from GEO database,and the differentially expressed genes were screened and analyzed in R language.The osteoporosis-related targets were screened from GeneCards and DisGeNET databases,and the neohesperidin-related targets were screened from ChEMBL and PubChem databases,and the common targets were obtained by intersection of the three.The String database was used to construct the PPI network of intersection genes,and the key targets were screened.The DAVID database was used for GO and KEGG enrichment analysis.The AutoDock software was used to verify the molecular docking between the neohesperidin and the target protein.The effect of neohesperidin on osteogenic differentiation of C57 mouse bone marrow mesenchymal stem cells was detected.Complete medium was used as blank control group;osteogenic induction medium was used as the control group;and osteogenic induction medium containing different concentrations of neohesperidin(25,50 μmol/L)was used as experimental group.The expression of alkaline phosphatase,the degree of mineralization,the expression of osteogenic-related genes and target genes during osteogenic differentiation of cells were measured at corresponding time points. RESULTS AND CONCLUSION:(1)9 253 differentially expressed genes,2 161 osteoporosis-related targets,and 326 neohesperidin-related targets were screened.There were 53 common targets among the three.All 53 genes were up-regulated in osteoporosis samples.The PPI network screened the target gene PRKACA of research significance.GO function and KEGG pathway enrichment analysis showed that neohesperidin's treatment of osteoporosis through PRKACA target mainly depended on biological processes such as protein phosphorylation and protein autophosphorylation,acting on endocrine resistance,proteoglycan in cancer,and estrogen signaling pathway to play a therapeutic role.Molecular docking results showed that neohesperidin had a certain binding ability to the protein corresponding to the target PRKACA.(2)The results of alkaline phosphatase staining showed that neohesperidin could promote the expression of alkaline phosphatase in the early stage of osteogenic differentiation of mesenchymal stem cells.Alizarin red staining showed that neohesperidin could promote the mineralization of osteogenic differentiation of mesenchymal stem cells.RT-qPCR results showed that neohesperidin could increase the mRNA expression of alkaline phosphatase,PRKACA,and osteocalcin.(3)These results indicate that neohesperidin may promote osteogenic differentiation through PRKACA target on the estrogen signaling pathway to prevent and treat osteoporosis.

BACKGROUND:Currently,numerous experiments delve into the intricate anatomy and biomechanical behavior of distinct segments of the supraspinatus muscle.However,the impact of shoulder joint stress resulting from damage to various regions of this muscle remains a scarcely explored domain.Understanding the repercussions of supraspinatus muscle injuries across different regions on the stress distribution and magnitude of articular cartilage and the glenoid is crucial for providing some theoretical support for clinical diagnosis and treatment. OBJECTIVE:To ascertain the maximum stress values by simulating different degrees of supraspinatus muscle rupture on the humeral cartilage surface,glenoid lip,and glenoid cartilage joint surface using three-dimensional finite element software. METHODS:Normal and healthy shoulder joint CT or MRI scans were processed through Mimics and Geomagic to extract molds.Subsequently,models were constructed via Solidworks.Varying degrees of supraspinatus muscle damage were simulated for each model to mimic fractures in different regions.Finally,Ansys,mechanical software,was employed for three-dimensional finite element biomechanical analysis,calculating stress values for the humeral cartilage surface,glenoid lip,and glenoid cartilage joint surface. RESULTS AND CONCLUSION:(1)With worsening degrees of supraspinatus muscle injury,the stress on the shoulder joint cartilage surface and glenoid lip escalated.(2)Among various regions,the anterior part of the supraspinatus muscle exhibited paramount significance.(3)While supraspinatus muscle fractures of differing degrees impacted the magnitude of cartilage stress on the glenoid labial surface,the stress distribution remained constant.(4)It is indicated that during the initial stages of horizontal abduction of the shoulder joint,the anterior region assumes a pivotal role,followed by the posterior deep region.Injury to the anterior part of the supraspinatus muscle leads to a significant surge in stress within the shoulder joint's soft tissue,potentially causing damage to the top of the glenoid lip and the anterior part of the glenoid cartilage.

BACKGROUND:Various proteins,signaling pathways,and inflammatory mediators are involved in the pathophysiological process of osteoarthritis.The development of small molecule drugs targeting these proteins,signaling pathways,and inflammatory mediators can effectively delay the progression of osteoarthritis and ameliorate its clinical manifestations. OBJECTIVE:To review the research progress of small molecule drugs in the treatment of osteoarthritis based on the pathogenesis of osteoarthritis. METHODS:PubMed,CNKI,and WanFang databases were searched with English search terms"osteoarthritis,arthritis,osteoarthrosis,degenerative,arthritides,deformans,small molecule drugs,small molecule inhibitors,small molecule agents"and Chinese search terms"osteoarthritis,small molecule drugs,small molecule inhibitors."A total of 68 articles were included for review according to the inclusion and exclusion criteria. RESULTS AND CONCLUSION:(1)Currently,studies concerning the pathogenesis of osteoarthritis remain unclear.The occurrence and development of osteoarthritis are strongly associated with proteins,cytokines,and signal transduction pathways,so its therapeutic mechanism is relatively complex.Currently,targeting proteins,cytokines,and signal transduction pathways related to osteoarthritis with small molecule drugs has become a major research focus.(2)Small molecule drugs frequently possess visible intracellular or extracellular targets and efficacy,containing enhancing cartilage repair,resisting joint degradation,attenuating inflammation,and relieving pain.Other anti-osteoarthritis small molecule drugs have shown promise in promoting stem cell chondrogenic differentiation and cartilage matrix reconstruction.(3)At present,small molecule drugs targeting the pathophysiological process of osteoarthritis to delay the progression of osteoarthritis are still in the experimental stage,but most of these small molecule drugs have shown the expected results in the experimental process,and there are no relevant studies to illustrate the efficacy of small molecule drugs in the treatment of osteoarthritis.(4)Small molecule drugs for the treatment of osteoarthritis have reached the expected experimental results in the basic experimental stage.Numerous studies have exhibited that small molecule drugs can target the suppression of specific proteins,cytokines,and signal transduction pathways that cause osteoarthritis,so as to treat osteoarthritis.Nevertheless,its safety and effectiveness still need to be identified by further basic and clinical studies.This process needs to be investigated and studied by more scholars.(5)At present,many scholars in and outside China have made contributions to the treatment of osteoarthritis.Compared with traditional treatment methods,small molecule drugs reveal better efficacy and safety in the basic experimental stage,and it is expected to become an emerging method for the treatment of osteoarthritis in the future to rid patients of pain.