ObjectiveTo investigate the potential mechanism of Danggui Buxuetang （DBT） in the treatment of vascular dementia （VAD）. MethodsSixty male SD rats were randomly assigned to the sham-operated group， model group， DBT low-， medium-， and high-dose groups， and the donepezil group. Except for the sham-operated group， rats in all other groups underwent bilateral common carotid artery ligation. After successful modeling， DBT was administered at doses of 9.2， 18.4， 36.8 g·kg^-1 for the low-， medium-， and high-dose groups， respectively， while the donepezil group received 3 mg·kg^-1 donepezil solution by gavage once daily. After 4 consecutive weeks of drug treatment， rats underwent the Morris water maze test， novel object recognition test， Nissl staining to observe hippocampal neurons， and immunofluorescence staining to detect the expression of neuronal nuclear protein （NeuN） in the hippocampus. Western blot was used to assess the expression of PTEN-induced kinase 1 （PINK1）， Parkin， microtubule-associated protein 1 light chain 3Ⅱ （LC3Ⅱ）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax）. Transmission electron microscopy was used to observe hippocampal neuronal ultrastructure. Real-time PCR was used to detect the expression of NADPH oxidase subunits p22^phox and p47^phox in hippocampal tissues. The levels of malondialdehyde （MDA）， glutathione （GSH）， superoxide dismutase （SOD）， and total antioxidant capacity were measured to evaluate oxidative stress levels. ResultsIn the Morris water maze test， escape latency changed significantly over time in all groups except the model group. Compared with the sham-operated group， the model group showed significantly prolonged escape latency （P<0.01）. Compared with the model group， rats in the DBT groups and the donepezil group exhibited significantly shorter escape latency （P<0.05， P<0.01）. The number of crossings over the original platform was significantly reduced in the model group compared with the sham-operated group （P<0.01）， whereas rats in the DBT and donepezil groups showed significantly increased platform crossings compared with the model group （P<0.05， P<0.01）. Compared with the sham-operated group， exploration time of new objects was significantly reduced in the model group （P<0.01）. Compared with the model group， exploration time of new objects increased significantly in the medium- and high-dose DBT groups and the donepezil group （P<0.05， P<0.01）， while no significant change was observed in the low-dose DBT group. Compared with the high-dose DBT group， rats in the donepezil group had significantly prolonged escape latency and reduced platform crossings and new-object exploration time （P<0.05）. Nissl staining showed decreased density of healthy neurons in the CA1 and CA3 regions of the hippocampus in the model group， with loss of Nissl bodies and nuclear atrophy or disappearance. In the high-dose DBT group， neuronal density in CA1 and CA3 increased， with neurons arranged closely and displaying normal morphology. Immunofluorescence showed that compared with the sham-operated group， the hippocampal NeuN⁺ cell count in the VAD model group was significantly decreased（P<0.01）， compared with the VAD model group， the hippocampal NeuN⁺ cell count in the high-dose DBT group was significantly increased（P<0.01）. Compared with the sham-operated group， the expression of PINK1， Parkin， LC3Ⅱ， and Bax proteins was significantly increased（P<0.01）， while the expression of Bcl-2 was significantly decreased in the VAD model group（P<0.01）. Compared with the VAD model group， the high-dose DBT group showed significantly decreased expression of PINK1， Parkin， LC3Ⅱ， and Bax proteins（P<0.01）and significantly upregulated Bcl-2 expression（P<0.01）. The medium-dose DBT group exhibited significantly reduced expression of Parkin， LC3Ⅱ， and Bax proteins（P<0.05，P<0.01） and significantly increased Bcl-2 expression（P<0.01）， while no statistically significant differences were observed in the low-dose DBT group. Transmission electron microscopy showed mitochondrial pyknosis， thickened cristae， increased electron density， and the presence of mitochondrial autophagy in the model group. In contrast， hippocampal neurons in the high-dose DBT group contained abundant mitochondria with intact morphology， clear cristae， and uniform matrix. Compared with the sham-operated group， total antioxidant capacity， SOD activity， and GSH levels were significantly decreased， while MDA levels were significantly increased in the model group （P<0.01）. Compared with the model group， total antioxidant capacity and antioxidant levels （SOD， GSH） increased significantly， and MDA decreased significantly in the medium- and high-dose DBT groups （P<0.01）， while no significant changes were observed in the low-dose DBT group. Compared with the sham-operated group， mRNA expression of p22^phox and p47^phox was significantly increased in the model group （P<0.01）. Compared with the model group， expression of p22^phox and p47^phox was significantly decreased in the DBT groups （P<0.05， P<0.01）. ConclusionDBT may exert neuroprotective effects by regulating PINK1/Parkin-mediated mitochondrial autophagy， thereby improving learning and memory abilities and treating VAD.

ObjectiveTo observe the effect of Qishao capsules on renal injury in db/db mice with diabetic kidney disease （DKD），and explore its mechanism of protecting the kidney by inhibiting podocyte apoptosis. Methodsdb/m mice （7 mice） were used as the normal group，and db/db mice （35 mice） were randomly divided into a model group，a dapagliflozin group （0.001 g·kg^-1·d^-1），and low-，medium-，and high-dose groups of Qishao capsules （0.341 3，0.682 5，and 1.365 g·kg^-1·d^-1，respectively）. Drug intervention lasted for 8 consecutive weeks. After sampling，the serum renal function indicators ［creatinine（SCr），and urea nitrogen（BUN）］，fasting blood glucose （FBG），24 h urinary protein quantification （24 h-UTP）， and other indicators of the mice were measured. The pathological tissue morphology of the kidney was observed by periodic acid-silver methenamine （PASM） and Masson's trichrome （Masson） staining. Immunohistochemical detection of cysteine-dependent aspartate-specific protease （Caspase）-3 and B-cell lymphoma 2 （Bcl-2） was performed. Western blot was used to detect the protein expression of Caspase-8，Caspase-7，Caspase-3， and other molecules. Terminal deoxynucleotidyl transferase dUTP nick End labeling （TUNEL） staining was used to observe apoptosis in renal tissue. Immunofluorescence staining of Wilms tumor suppressor gene-1 （WT-1） was used to observe podocyte injury. Real-time polymerase chain reaction （Real-time PCR） was employed to detect Caspase-8 and Caspase-3 mRNA expression in the kidneys of experimental mice. Data analysis was conducted using statistical software GraphPad Prism 10. ResultsCompared with the normal group，the model group showed significantly increased 24 h-UTP，SCr，BUN，and FBG （P<0.01）. Additionally， PASM staining of renal tissue showed increased glycogen deposition，glomerular hypertrophy，and thickening of the basement membrane. Masson staining showed collagen fiber proliferation in renal tissue. Transmission electron microscopy showed thickening of the renal tissue basement membrane and fusion or loss of foot processes in the model group. The immunohistochemical results showed that Caspase-3 in the kidneys of the mice in the model group significantly increased （P<0.01），while the Bcl-2 protein expression level decreased significantly （P<0.01）. The number of TUNEL positive cells in renal tissue significantly increased （P<0.01）. The positive expression of WT-1 in podocytes was significantly reduced （P<0.01）. Western blot analysis showed significant upregulation of Caspase-8，Caspase-7，and Caspase-3 protein expression in renal tissue （P<0.01）. The mRNA expression levels of Caspase-8 and Caspase-3 in the kidneys increased significantly （P<0.01）. Compared with the model group，the Qishao capsules groups can significantly reduce the levels of 24 h-UTP，SCr，BUN，and FBG （P<0.01）. The pathological damage of renal tissue and podocyte injury were improved to some extent. Immunohistochemistry in the kidney showed a significant decrease in Caspase-3 （P<0.01） and a significant increase in Bcl-2 protein expression level （P<0.01）. Additionally， there were a significant decrease in the number of TUNEL positive cells in renal tissue （P<0.01），a significant increase in WT-1 positive expression in podocytes （P<0.01），marked downregulation of Caspase-8，Caspase-7，and Caspase-3 protein expression in renal tissue （P<0.05，P<0.01），and a significant decrease in Caspase-8 and Caspase-3 mRNA expression levels （P<0.01）. ConclusionQishao capsules can inhibit podocyte apoptosis by regulating the expression of Caspase-8，Caspase-7， and Caspase-3，thereby improving the diabetic renal injury in db/db mice.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

AIM: To compare the preoperative ocular biometry between Pentacam AXL and IOL Master 700 in cataract patients.METHODS:Prospective study. A total of 150 patients(150 eyes)with cataracts who were treated in our hospital from May to December 2024 were selected. The IOL Master 700 and Pentacam AXL were preoperatively used to measure axial length(AL), corneal curvature(K1, K2 and Km), anterior chamber depth(ACD), and white-to-white(WTW). The difference and consistency of the results of the two instruments were compared.RESULTS: There was no significant difference between the two instruments in the AL, K1, K2, Km, ACD, and WTW(all P>0.05). The Spearman correlation analysis showed that the two instruments positively correlated with the AL, K1, K2, Km, ACD and WTW of the operated eye(all P<0.001). The Bland-Altman analysis showed that for the Pentacam AXL and IOL Master 700, there were 5/150(3.3%), 7/150(4.7%), 4/150(2.7%), 5/150(3.3%), and 0 points outside the 95%LoA for the AL, K1, K2, Km, ACD, and WTW of the examined eyes, respectively, with all of these values less than 5%, indicating good consistency.CONCLUSION:The AL, K1, K2, Km, ACD and WTW of Pentacam AXL and IOL Master 700 in cataract patients before cataract phacoemulsification combined with IOL implantation show no significant differences, and have good correlation and consistency. The two instruments can be used interchangeably.

ObjectiveTo evaluate the impact of yang-reinforcing and blood-activating therapy on the long-term prognosis for patients with dilated cardiomyopathy （DCM） of yang deficiency and blood stasis syndrome. MethodsA retrospective cohort study was conducted involving 371 DCM patients with yang deficiency and blood stasis syndrome. The yang-reinforcing and blood-activating therapy was defined as the exposure factor. Patients were categorized into exposure group （186 cases） and non-exposure group （185 cases） according to whether they received yang-reinforcing and blood-activating therapy combined with conventional western medicine for 6 months or longer. The follow-up period was set at 48 months， and the Kaplan-Meier survival analysis was used to assess the cumulative incidence of major adverse cardiovascular events （MACE） in both groups. Cox regression analysis was used to explore the impact of yang-reinforcing and blood-activating therapy on the risk of MACE， and subgroup analysis was performed. Changes in traditional Chinese medicine （TCM） syndrome score， left ventricular ejection fraction （LVEF）， left ventricular fractional shortening （LVFS）， left ventricular end-diastolic diameter （LVEDD）， and Minnesota Living with Heart Failure Questionnaire （MLHFQ） score were compared between groups at the time of first combined use of yang-reinforcing and blood-activating therapy （before treatment） and 1 year after receiving the therapy （after treatment）. ResultsMACE occurred in 31 cases （16.67%） in the exposure group and 47 cases （25.41%） in the non-exposure group. The cumulative incidence of MACE in the exposure group was significantly lower than that in the non-exposure group ［HR=0.559， 95%CI（0.361，0.895）， P=0.014］. Cox regression analysis showed that yang-reinforcing and blood-activating therapy was an independent factor for reducing the risk of MACE in DCM patients ［HR=0.623， 95%CI（0.396，0.980）， P=0.041］， and consistent results were observed in different subgroups. Compared with pre-treatment， the exposure group showed decreased TCM syndrome score and MLHFQ score， reduced LVEDD， and increased LVEF and LVFS after treatment （P＜0.05）； in the non-exposure group， TCM syndrome score decreased， LVEF and LVFS increased， and LVEDD reduced after treatment （P＜0.05）. After treatment， the exposure group had higher LVEF and LVFS， smaller LVEDD， and lower TCM syndrome score and MLHFQ score compared with the non-exposure group （P＜0.05）. ConclusionCombining yang-reinforcing and blood-activating therapy with conventional western medicine can reduce the risk of MACE in DCM patients with yang deficiency and blood stasis syndrome， meanwhile improving their clinical symptoms， cardiac function， and quality of life.

Objective: To investigate the current status of benefit finding among young and middle-aged patients with type 2 diabetes mellitus (T2DM) and analyze its influencing factors, so as to provide a reference for improving the level of benefit finding in this population. Methods: From November 2022 to May 2023, young and middle-aged patients with T2DM aged 18-59 years hospitalized in the endocrinology departments of 2 tertiary hospitals in Hengyang City, Hunan Province were selected as survey subjects by a convenience sampling method. Basic demographic information was collected using a general questionnaire survey. Benefit finding, resourcefulness, and stigma were evaluated using the Benefit Finding Scale, the Chinese Version of the Resourcefulness Scale, and the Type 2 Diabetes Stigma Assessment Scale, respectively. A multiple linear regression model was used to analyze the influencing factors of benefit finding among young and middle-aged patients with T2DM. Results: A total of 305 young and middle-aged patients with T2DM were investigated, including 222 males (72.79%) and 83 females (27.21%). There were 231 cases aged 45-59 years, accounting for 75.74%. The scores for benefit finding, resourcefulness, and stigma were (42.86±6.06), (75.12±11.30), and (41.20±10.10), respectively. Multiple linear regression analysis showed that young and middle-aged patients with T2DM who were male (β′=0.088), aged 18-<45 years (β′=0.083), absence of diabetes complications (β′=0.124), and had higher resourcefulness scores (β′=0.679) had higher levels of benefit finding, while patients with higher stigma scores (β′=-0.097) had lower levels of benefit finding. Conclusion The level of benefit finding among young and middle-aged patients with T2DM was moderate, and was related to gender, age, diabetes complications, resourcefulness, and stigma.

With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.

Objective To explore the recognition capabilities of electronic nose combined with machine learning in identifying the breath odor map of benign and malignant pulmonary nodules and Traditional Chinese Medicine (TCM) syndrome elements. Methods The study design was a single-center observational study. General data and four diagnostic information were collected from 108 patients with pulmonary nodules admitted to the Department of Cardiothoracic Surgery of Hospital of Chengdu University of TCM from April 2023 to March 2024. The patients' TCM disease location and nature distribution characteristics were analyzed using the syndrome differentiation method. The Cyranose 320 electronic nose was used to collect the odor profiles of oral exhalation, and five machine learning algorithms including random forest (RF), K-nearest neighbor (KNN), logistic regression (LR), support vector machine (SVM), and eXtreme gradient boosting (XGBoost) were employed to identify the exhaled breath profiles of benign and malignant pulmonary nodules and different TCM syndromes. Results (1) The common disease locations in pulmonary nodules were ranked in descending order as liver, lung, and kidney; the common disease natures were ranked in descending order as Yin deficiency, phlegm, dampness, Qi stagnation, and blood deficiency. (2) The electronic nose combined with the RF algorithm had the best efficacy in identifying the exhaled breath profiles of benign and malignant pulmonary nodules, with an AUC of 0.91, accuracy of 86.36%, specificity of 75.00%, and sensitivity of 92.85%. (3) The electronic nose combined with RF, LR, or XGBoost algorithms could effectively identify the different TCM disease locations and natures of pulmonary nodules, with classification accuracy, specificity, and sensitivity generally exceeding 80.00%.Conclusion Electronic nose combined with machine learning not only has the potential capabilities to differentiate the benign and malignant pulmonary nodules, but also provides new technologies and methods for the objective diagnosis of TCM syndromes in pulmonary nodules.

Objective: To investigate the awareness of knowledge about hepatitis C prevention and control among outpatients in Ningbo City, Zhejiang Province, and its influencing factors, so as to provide the evidence for strengthening health education on hepatitis C prevention and control. Methods: Based on sentinel surveillance of hepatitis C, the outpatients aged 15 to 65 years at seven hospitals in Yinzhou District, Cixi City and Xiangshan County of Ningbo City were selected using the convenient sampling method from April to June during 2020 and 2022. Demographic information, knowledge and behaviors related to hepatitis C prevention and control were collected through questionnaire surveys. The influencing factors for knowledge about hepatitis C prevention and control were analyzed using a multivariable logistic regression model. Results: A total of 2 792 participants were surveyed, including 1 157 males (41.44%) and 1 635 females (58.56%). The awareness rate of knowledge about hepatitis C prevention and control was 56.23%, and was lower in knowledge about hepatitis C vaccine and treatment. The awareness rates of knowledge about hepatitis C prevention and control among outpatients from 2020 to 2022 were 47.11%, 53.22% and 70.65%, respectively, showing an upward trend (P<0.05). Multivariable logistic regression analysis showed that participants aged 25 to <50 years (OR=1.358, 95%CI: 1.073-1.719), with an educational level of high school or junior college (OR=1.431, 95%CI: 1.134-1.806) or above junior college (OR=3.728, 95%CI: 2.958-4.699), with household monthly income per capita of 3 000 to <5 000 yuan (OR=1.828, 95%CI: 1.344-2.486) or ≥5 000 yuan (OR=1.858, 95%CI: 1.366-2.526), without a history of invasive treatments such as pedicure in public places (OR=1.287, 95%CI: 1.024-1.618), without a history of contact with family members' blood-contaminated items (OR=2.050, 95%CI: 1.552-2.707), and always using condoms during sexual contacts (OR=1.740, 95%CI: 1.273-2.378) had higher awareness of knowledge about hepatitis C prevention and control. Conclusions The awareness of knowledge about hepatitis C vaccine and treatment among outpatients in Ningbo City needs to be improved. Age, educational level, household monthly income per capita, history of invasive treatments such as pedicure in public places, history of contact with family members' blood-contaminated items and frequency of condom use during sexual contacts are associated with outpatients' awareness of knowledge about hepatitis C prevention and control.

Objective To understand the epidemiological and genotypic characteristics of norovirus (NoV) in Jingzhou area，and to design primers and probes covering the variant genomes in the NoV gene library. Methods A total of 556 fecal samples were collected from suspected NoV patients from the First People's Hospital of Jingzhou from January 2022 to May 2023. The positive rate of NoV nucleic acid in fecal samples was detected by commercial kits. The differences in positive rates among different seasons and five age groups were statistically analyzed. Primers covering the NoV variant genome were designed to genotype some positive specimens. Results The detection rate of NoV nucleic acid in the tested samples was 30.04% (167/556). The detection rate in spring and winter was higher than that in summer and autumn (χ²=20.411，P<0.01). There were statistical differences in the positive rates among the five age groups of <1 year, 1-5 years, 6-10 years, 11-19 years, and >19 years (χ²=17.192，P<0.01), and the positive rate in young children (1~5 years old) was the highest (39.29%, 88/224). In addition, all the positive samples were NoV GII. Conclusion The epidemic situation of NoV is serious in winter and spring in Jingzhou area, with a high infection rate in young children (1-5 years old), and NoV GII is the main prevalent genotype. The primers designed in this study can be used for genotyping of NoV GI and GII.