Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

BACKGROUND:A network-based pharmacological approach has identified multifunctional effects of the main bioactive compounds in the Trichosanthis Fructus-Allii Macrostemonis Bulbus on coronary heart disease;however,the mechanism of its therapeutic effect on coronary heart disease has not been fully elucidated. OBJECTIVE:To investigate the role and mechanism of Trichosanthis Fructus-Allii Macrostemonis Bulbus in improving coronary heart disease by regulating the composition of gut microbiota. METHODS:Forty Sprague-Dawley rats were randomly divided into four groups:blank control group(n=10),model group(n=10),positive drug group(n=10),and medicine pair group(n=10).A rat model of coronary heart disease was established by continuous gastric perfusion of fat emulsion and injection of pituitrin.After modeling,rats in the model group were gavaged with distilled water(10 mL/kg)for control,rats in the positive drug group were gavaged with simvastatin 4 mg/kg per day,and rats in the medicine pair group were gavaged with Trichosanthis Fructus-Allii Macrostemonis Bulbus pairs 7.56 g/kg per day.All interventions lasted for 14 days.Electrocardiograms and myocardial pathology were observed,and blood lipid levels were measured.The structure of gut microbiota was analyzed using 16S rDNA sequencing technology. RESULTS AND CONCLUSION:Electrocardiogram results showed ST segment elevation in the model group.There were no significant abnormalities in the electrocardiograms of the positive drug group and medicine pair group.Compared with the blank control group,the levels of total cholesterol,triacylglycerol,and low-density lipoprotein cholesterol were significantly higher in the model group(P<0.05).Compared with the model group,the levels of total cholesterol,triacylglycerol,and low-density lipoprotein cholesterol were significantly lower in the positive drug group and medicine pair group(P<0.05).Compared with the blank control group,focal myocardial cell necrosis was observed in the model group,while partial myocardial cell disarray was observed in the positive drug group and medicine pair group.Compared with the blank control group,the Ace,Shannon,and Chao indices were increased(P<0.05)and the Simpson index was decreased(P<0.05)in the model group,positive drug group and medicine pair group.Compared with the model group,the Ace and Chao indices were decreased(P<0.05),while the Shannon index showed no significant difference(P>0.05)and the Simpson index was also decreased(P<0.05)in the positive drug group and medicine pair group.Compared with the blank control group,the relative abundances of Desulfovibrionia,Muribaculaceae_norank,etc.were increased in the model group,while those of Clostridia,[Eubacterium]_coprostanoligenes_group_norank,etc.were decreased.Compared with the model group,the relative abundances of WPS-2_norank,Muribaculaceae_norank,etc.were increased in the medicine pair group,while those of Clostridia,[Eubacterium]_coprostanoligenes_group_norank,etc.were decreased;the relative abundances of Desulfobacterota,[Eubacterium]_coprostanoligenes_group_norank,etc.were increased in the positive drug group,while those of Firmicutes,Muribaculaceae_norank,etc.were decreased.Compared with the positive drug group,the relative abundances of Desulfobacterota,Bacteroides,etc.were increased in the medicine pair group,while those of Firmicutes,[Eubacterium]_coprostanoligenes_group_norank,etc.were decreased.The LEfSe results showed that the medicine pair group had the highest microbial enrichment,followed by the blank control group and positive drug group,with the model group having the lowest microbial enrichment.To conclude,Trichosanthis Fructus-Allii Macrostemonis Bulbus pairs can improve the development of coronary heart disease by regulating gut microbiota composition,providing new insights for further research and development of Trichosanthis Fructus-Allii Macrostemonis Bulbus pairs.

Objective To investigate the changes in eosinophil counts and the activation of microglial cells in the brain tissues of mice at different stages of Angiostrongylus cantonensis infection, and to examine the role of microglia in regulating the progression of angiostrongyliasis and unravel the possible molecular mechanisms. Methods Fifty BALB/c mice were randomly divided into the control group and the 7-d, 14-d, 21-day and 25-d infection groups, of 10 mice in each group. All mice in infection groups were infected with 30 stage III A. cantonensis larvae by gavage, and animals in the control group was given an equal amount of physiological saline. Five mice were collected from each of infection groups on days 7, 14, 21 d and 25 d post-infection, and 5 mice were collected from the control group on the day of oral gavage. The general and focal functional impairment was scored using the Clark scoring method to assess the degree of mouse neurological impairment. Five mice from each of infection groups were sacrificed on days 7, 14, 21 d and 25 d post-infection, and 5 mice from the control group were sacrificed on the day of oral gavage. Mouse brain tissues were sampled, and the pathological changes of brain tissues were dynamically observed using hematoxylin and eosin (HE) staining. Immunofluorescence staining with eosinophilic cationic protein (ECP) and ionized calcium binding adaptor molecule 1 (Iba1) was used to assess the degree of eosinophil infiltration and the counts of microglial cells in mouse brain tissues in each group, and the morphological parameters of microglial cells (skeleton analysis and fractal analysis) were quantified by using Image J software to determine the morphological changes of microglial cells. In addition, the expression of M1 microglia markers Fcγ receptor III (Fcgr3), Fcγ receptor IIb (Fcgr2b) and CD86 antigen (Cd86), M2 microglia markers Arginase 1 (Arg1), macrophage mannose receptor C-type 1 (Mrc1), chitinase-like 3 (Chil3), and phagocytosis genes myeloid cell triggering receptor expressed on myeloid cells 2 (Trem2), CD68 antigen (Cd68), and apolipoprotein E (Apoe) was quantified using real-time quantitative reverse transcription PCR (RT-qPCR) assay in the mouse cerebral cortex of mice post-infection. Results A large number of A. cantonensis larvae were seen on the mouse meninges surface post-infection, and many neuronal nuclei were crumpled and deeply stained, with a large number of bleeding points in the meninges. The median Clark scores of mouse general functional impairment were 0 (interquartile range, 0), 0 (interquartile range, 0.5), 6 (interquartile range, 1.0), 14 (interquartile range, 8.5) points and 20 (interquartile range, 9.0) points in the control group and the 7-d, 14-d, 21-d and 25-d groups, respectively (H = 22.45, P < 0.01), and the median Clark scores of mouse focal functional impairment were 0 (interquartile range, 0), 2 (interquartile range, 2.5), 7 (interquartile range, 3.0), 18 (interquartile range, 5.0) points and 25 (interquartile range, 6.5) points in the control group and the 7-d, 14-d, 21-d and 25-d groups, respectively (H = 22.72, P < 0.01). The mean scores of mice general and focal functional impairment were all higher in the infection groups than in the control group (all P values < 0.05). Immunofluorescence staining showed a significant difference in the eosinophil counts in mouse brain tissues among the five groups (F = 40.05, P < 0.000 1), and the eosinophil counts were significantly higher in mouse brain tissues in the 14-d (3.08 ± 0.78) and 21-d infection groups (5.97 ± 1.37) than in the control group (1.00 ± 0.28) (both P values < 0.05). Semi-quantitative analysis of microglia immunofluorescence showed a significant difference in the counts of microglial cells among the five groups (F = 17.66, P < 0.000 1), and higher Iba1 levels were detected in mouse brain tissues in 14-d (5.75 ± 1.28), 21-d (6.23 ± 1.89) and 25-d infection groups (3.70 ± 1.30) than in the control group (1.00 ± 0.30) (all P values < 0.05). Skeleton and fractal analyses showed that the branch length [(162.04 ± 34.10) μm vs. (395.37 ± 64.11) μm; t = 5.566, P < 0.05] and fractal dimension of microglial cells (1.30 ± 0.01 vs. 1.41 ± 0.03; t = 5.266, P < 0.05) were reduced in mouse brain tissues in the 21-d infection group relative to the control group. In addition, there were significant differences among the 5 groups in terms of M1 and M2 microglia markers Fcgr3 (F = 48.34, P < 0.05), Fcgr2b (F = 55.46, P < 0.05), Cd86 (F = 24.44, P < 0.05), Arg1 (F = 31.18, P < 0.05), Mrc1 (F = 15.42, P < 0.05) and Chil3 (F = 24.41, P < 0.05), as well as phagocytosis markers Trem2 (F = 21.19, P < 0.05), Cd68 (F = 43.95, P < 0.05) and Apoe (F = 7.12, P < 0.05) in mice brain tissues. Conclusions A. cantonensis infections may induce severe pathological injuries in mouse brain tissues that are characterized by massive eosinophil infiltration and persistent activation of microglia cells, thereby resulting in progressive deterioration of neurological functions.

Background Air pollution remains a critical public health issue, with persistent exposure to air pollutants continuing to pose significant health risks. Currently, research investigating the association between air pollution and myocardial infarction mortality in Shenzhen remains inadequate. Objective To quantitatively assess the association between air pollutants and myocardial infarction mortality in residents. Methods Based on the mortality surveillance system of Shenzhen Center for Disease Control and Prevention, we conducted a time-stratified case-crossover study of 10089 permanent residents who died from myocardial infarction in Shenzhen between 2013 and 2022. Using residential address information, we obtained individual-level exposure data for air pollutants from the China High Air Pollutants dataset and meteorological factors from the China Meteorological Administration Land Data Assimilation System. A time-stratified case-crossover study design was employed to construct a conditional logistic regression model to assess the association between short-term exposure to air pollutants and myocardial infarction mortality. The exposure-response relationship was visualized, and a comprehensive health risk assessment was performed. Results This study included a total of 10 089 cases of myocardial infarction deaths in Shenzhen. The median [interquartile range (IQR)] concentrations of fine particulate matter (PM_2.5), inhalable particulate matter (PM₁₀), sulfur dioxide (SO₂), nitrogen dioxide (NO₂), carbon monoxide (CO), and ozone (O₃) in Shenzhen from 2013 to 2022 were 24.59 (20.19) μg·m⁻³, 42.85 (28.42) μg·m⁻³, 8.53 (3.39) μg·m⁻³, 29.47 (13.56) μg·m⁻³, 0.77 (0.27) mg·m⁻³, and 86.53 (51.39) μg·m⁻³, respectively. The moving average concentrations of PM_2.5 and PM₁₀ over the current day and the previous 2 days (lag02) showed the highest risk of myocardial infarction mortality, with an odds ratio (OR) and 95% confidence interval (95%CI) of 1.004 (1.001, 1.007) and 1.004 (1.002, 1.006), respectively. At lag05, SO₂ demonstrated the strongest association with the risk of myocardial infarction mortality, with an OR (95%CI) of 1.042 (1.019, 1.065). The exposure-response relationships of PM_2.5, PM₁₀, and SO₂ with myocardial infarction mortality were approximately linear, whereas NO₂ exhibited a nonlinear relationship. At lag05, the highest risk of myocardial infarction mortality associated with NO₂ exposure was observed when the NO₂ concentration was ≤21.92 μg·m⁻³, with an OR (95% CI) of 1.024 (1.003, 1.046). The health risk assessment indicated that, using the WHO Air Quality Guidelines as the reference, the local PM_2.5 and NO₂ exposure led to an excess mortality of 398 and 298 cases, respectively. The sensitivity analysis revealed that after adjusting for O₃ and restricting the study period to 2013—2019, the effect estimates for PM_2.5, PM₁₀, NO₂, and SO₂ on myocardial infarction mortality slightly increased. Conclusion Short-term exposure to air pollutants, including PM_2.5, PM₁₀, NO₂, and SO₂, could increase the risk of myocardial infarction mortality. This study provides important scientific evidence for environmental health risk assessment and environmental management in Shenzhen.

Genitourinary system tumors, as a major clinical challenge posing a serious threat to human health, urgently require breakthroughs in the construction of a precision diagnosis and treatment system. The innovative application of molecular imaging technologies, particularly the development of novel molecular probes, is revolutionizing the diagnostic and therapeutic paradigms for urinary tumors. The application of novel molecular probes in the early diagnosis and staging of genitourinary tumors, the role of multimodal molecular imaging probes in guiding precision surgery/radiotherapy, and the clinical translation challenges and strategies for theranostic-integrated probes are systematically reviewed in this article to provide valuable insights and references for related research and clinical practice.

OBJECTIVE: To identify phytochemical constituents present in the extract of flowers of Xanthoceras sorbifolia and evaluate their anti-oxidant and anti-hyperglycemic capacities. METHODS: The AlCl₃ colorimetric method and Prussian Blue assay were used to determine the contents of total flavonoids and total phenolic acids in extraction layers, and the bioactive layers was screened through anti - oxidative activity in vitro. The Waters ACQUITY UPLC system and a Waters ACQUITY UPLC BEH C₁₈ column (2.0 mm × 150 mm, 5 μm) were used to identify the ingredients. And anti-oxidative ingredients were screened by off-line UPLC-QTOF-MS/MS-free radical scavenging. The ameliorative role of it was further evaluated in a high-fat, streptozotocin-induced type 2 diabetic rat model and the study was carried out on NADPH oxidase (PDB ID: 2CDU) by molecular docking. RESULTS: Combined with the results of activity screening in vitro, the anti - oxidative part was identified as the ethyl acetate layer. A total of 24 chemical constituents were identified by liquid chromatography-mass spectrometry in the ethyl acetate layer and 13 main anti-oxidative active constituents were preliminarily screened out through off-line UPLC-QTOF-MS/MS-free radical scavenging. In vivo experiments showed that flowers of X. sorbifolia could significantly reduce the blood glucose level of diabetic mice and alleviate liver cell damage. Based on the results of docking analysis related to the identified phytocompounds and oxidase which involved in type 2 diabetes, quercetin 3-O-rutinoside, kaempferol-3-O-rhamnoside, isorhamnetin-3-O-glucoside, and isoquercitrin showed a better inhibitory profile. CONCLUSION The ethyl acetate layer was rich in flavonoids and phenolic acids and had significant anti-oxidant activity, which could prevent hyperglycemia. This observed activity profile suggested X. sorbifolia flowers as a promising new source of tea to develop alternative natural anti-diabetic products with a high safety margin.

Lipotoxicity is a pivotal factor that initiates and exacerbates liver injury and is involved in the development of metabolic-associated fatty liver disease (MAFLD). However, there are few reported lipotoxicity inhibitors. Here, we identified a natural anti-lipotoxicity candidate, HN-001, from the marine fungus Aspergillus sp. C1. HN-001 dose- and time- dependently reversed palmitic acid (PA)-induced hepatocyte death. This protection was associated with IRE-1α-mediated XBP-1 splicing inhibition, which resulted in suppression of XBP-1s nuclear translocation and transcriptional regulation. Knockdown of XBP-1s attenuated lipotoxicity, but no additional ameliorative effect of HN-001 on lipotoxicity was observed in XBP-1s knockdown hepatocytes. Notably, the ER stress and lipotoxicity amelioration was associated with PLA2. Both HN-001 and the PLA2 inhibitor MAFP inhibited PLA2 activity, reduced lysophosphatidylcholine (LPC) level, subsequently ameliorated lipotoxicity. In contrast, overexpression of PLA2 caused exacerbation of lipotoxicity and weakened the anti-lipotoxic effects of HN-001. Additionally, HN-001 treatment suppressed the downstream pro-apoptotic JNK pathway. In vivo, chronic administration of HN-001 (i.p.) in mice alleviated all manifestations of MAFLD, including hepatic steatosis, liver injury, inflammation, and fibrogenesis. These effects were correlated with PLA2/IRE-1α/XBP-1s axis and JNK signaling suppression. These data indicate that HN-001 has therapeutic potential for MAFLD because it suppresses lipotoxicity, and provide a natural structural basis for developing anti-MAFLD candidates.

Liver regeneration following injury aids the restoration of liver mass and the recovery of liver function. In the present study we investigated the contribution of megakaryocytic leukemia 1 (MKL1), a transcriptional modulator, to liver regeneration. We report that both MKL1 expression and its nuclear translocation correlated with hepatocyte proliferation in cell and animal models of liver regeneration and in liver failure patients. Mice with MKL1 deletion exhibited defective regenerative response in the liver. Transcriptomic analysis revealed that MKL1 interacted with E2F1 to program pro-regenerative transcription. MAPKAPK2 mediated phosphorylation primed MKL1 for its interaction with E2F1. Of interest, phospholipase d2 promoted MKL1 nuclear accumulation and liver regeneration by catalyzing production of phosphatidic acid (PA). PA administration stimulated hepatocyte proliferation and enhanced survival in a MKL1-dependent manner in a pre-clinical model of liver failure. Finally, PA levels was detected to be positively correlated with expression of pro-regenerative genes and inversely correlated with liver injury in liver failure patients. In conclusion, our data reveal a novel mechanism whereby MKL1 contributes to liver regeneration. Screening for small-molecule compounds boosting MKL1 activity may be considered as a reasonable approach to treat acute liver failure.

Objective: To assess the nutritional status of primary and secondary school students in Beijing City and to analyze the related factors, so as to provide a scientific basis for improving the nutritional status of primary and secondary school students in a targeted manner. Methods: Based on the 2021 Beijing Student Common Diseases and Health Influencing Factors Surveillance Project, a stratified random cluster sampling method was used to conduct a physical examination and questionnaire survey on 25 487 primary and secondary school students from September to November 2021. The Chi square test was used for comparison of nutritional status detection rates, and disordered multi classification Logistic regression analysis was used to explore the factors associated with students nutritional status. Results: The detection rates of malnutrition, overweight and obesity among primary and secondary school students in Beijing City were 4.7%, 18.0% and 23.8% respectively. The detection rates of malnutrition, overweight and obesity were higher among male students (5.1%, 20.4%, 29.7%) than female students (4.2%, 15.5%, 17.4%) ( χ 2= 12.23, 101.71, 526.99, P <0.01). The detection rate of obesity was higher in the suburbs than urban areas(26.6%, 19.8%), and the detection rate of malnutrition was lower in the suburbs than urban areas (4.2%,5.5%)( χ 2=157.25, 23.61, P <0.01). The results of disordered multi classification Logistic regression showed that the related factors for malnutrition, overweight and obesity were gender, residence, moderate to vigorous exercise ≥60 min per day and lack of sleep( OR =1.70, 1.88,2.48; 1.14, 0.87, 0.67; 0.85, 0.92, 0.81 ; 0.83, 1.08, 1.07); frequency of fried food intake daily was a related factor for overweight ( OR =0.70); whether eating breakfast daily or not was a related factor for overweight and obesity ( OR =0.91, 0.84); academic level (middle and high school) was a related factor for malnutrition and obesity ( OR =1.38, 1.37; 0.77, 1.40)( P <0.05). Conclusions The problem of overweight and obesity among primary and secondary school students in Beijing City continues to be serious, especially among boys and suburban areas. It is recommended that society, schools, families and individuals should work together to improve the nutritional status of primary and secondary school students by adopting a graded and classified approach.

Walking downstairs and running are common actions in daily life;however,older adults with functional decline are prone to falls or injuries.To cope with various situations and avoid falls,the first neuroprotective motor mechanism activated by the body is the regulation of lower limb stiffness.Hence,this study retrieved and collected relevant research results from databases such as China Knowledge,Wanfang,Google Scholar,and Web of Science,using key words such as elderly and lower limb stiffness,and summarized the similarities and differences in changes in lower limb stiffness in different action tasks.The findings show that interventions on controllable factors can improve changes in lower limb stiffness to prevent falls in older adults.However,owing to the small number of related studies,it is necessary to further investigate the effects of action interventions on lower limb stiffness in older adults to obtain reliable regularity features and references.