Ulcerative colitis （UC） is a chronic inflammatory bowel disease with complex etiology. The pathogenesis of this disease， due to a combination of factors， is complex and has not yet been elucidated. Among them， intestinal mucosal barrier damage is the basic pathological change of UC. As a non-destructive response of cells， autophagy regulates intestinal mucosal immunity， inflammation， oxidative stress， and bacterial homeostasis through degradation and reabsorption to actively repair damaged intestinal mucosal barrier， exerting a key role in the occurrence and development of UC. The disease is mainly treated clinically with aminosalicylic acid preparations， glucocorticoids， and immunosuppressants. Western medicine treatment of the disease has a fast onset of effect， and the short-term efficacy is definite， but the long-term application is easy to be accompanied by more adverse reactions. Moreover， some drugs are expensive， bringing great physical and mental pain and economic burden to patients. Therefore， it is urgent to explore new therapies with stable efficacy and mild adverse effects. In recent years， a large number of studies have shown that Chinese medicine can regulate autophagy of the intestinal mucosa with multiple targets and effects and repair the intestinal mucosal barrier function， thereby inhibiting the development of UC. Many experiments have shown that the active ingredient or monomers and compound formulas of Chinese medicine can improve the immunity of the intestinal mucosa， inflammation， oxidative stress， and flora by regulating the level of autophagy to maintain the normal function of the intestinal mucosal barrier to effectively intervene in UC， providing a new measure for the prevention and treatment of UC. However， there is a lack of systematic review of Chinese medicine in regulating the level of autophagy in the intestinal mucosa for the prevention and treatment of UC. Therefore， based on the current research on UC， autophagy process， and Chinese medicine treatment， this article reviewed the relationship of autophagy and its key target proteins with UC to clarify the key role of autophagy in UC production and systematically summarized Chinese medicines targeting the regulation of autophagy to treat UC in recent years to provide new ideas for the treatment and drug development of UC.

Objective To develop a Psychological Birth Trauma Assessment Scale and to test its reliability and validity.Methods Through literature review,semi-structured interview,expert conference,Delphi expert enquiry and preliminary investigation,a pre-test scale was formed.From March to May 2023,postpartum women from 38 hospitals of different levels in 15 provinces(Jiangsu,Anhui,Zhejiang,Fujian,Tibet,and Shanghai,etc.)were conveniently selected for investigation.The sample size of the first-round survey was 547,which was used for reliability and validity test.The sample size of the second-round survey was 550,which was used for confirmatory factor analysis.Results The psychological birth trauma assessment scale consisted of 2 parts,with a total of 29 items in 6 dimensions.The intrapartum feeling part included 4 dimensions,with a cumulative variance contribution rate of 63.992％,and the postpartum effect part included 2 dimensions,with a cumulative variance contribution rate of 68.208％.The content validity index of the scale was 0.947,and the content validity index of each item was 0.809～1.000.The total score of the scale and the scores of each dimension were significantly negatively correlated with the total score of the calibration scale(r=-0.784～-0.533,P＜0.001).The total Cronbach's α coefficient was 0.941,and the split-half reliability coefficient was 0.883.Confirmatory factor analysis showed that the main evaluation indicators were all within the acceptable range.Conclusion The Psychological Birth Trauma Assessment Scale has good reliability and validity,and it can be used as an assessment tool for the degree of maternal psychological birth trauma.

Objectives:To identify the two-dimensional speckle tracking imaging (2D-STI)-derived longitudinal strain indices that reflect the myocardial functional characteristics of patients with apical hypertrophic cardiomyopathy (AHCM). Methods:This retrospective study included 30 patients with typical AHCM diagnosed at the First Affiliated Hospital of Fujian Medical University from January 2015 to May 2019 (AHCM group),35 patients with essential hypertensive left ventricular hypertrophy (HTLVH group),and 45 healthy volunteers (normal control group) were also included.Two-dimensional echocardiography was used to measure the cardiac chamber size and wall thickness,and 2D-STI was used to analyze the longitudinal strain during the left ventricular systolic phase,the global longitudinal strain (GLS) and the longitudinal strain of the apical,mid,and basal segments (LSA,LSM,LSB) were assessed.The ratios of the apical to the overall and other segmental longitudinal strains were used as the apical relative longitudinal strain indices,including the apical to basal longitudinal strain ratio (ABLR,LSA/LSB),the apical to global longitudinal strain ratio (AGLR,LSA/GLS),and the apical to basal-mid segment longitudinal strain ratio (ABMLR,LSA/[LSB+LSM]). Results:GLS was significantly lower in the AHCM group and HTLVH group than in the normal control group (both P<0.05),and was similar between the AHCM group and HTLVH group (P>0.05).The LSA,LSM,and LSB were also significantly lower in the AHCM group and HTLVH group than in the normal control group,LSA decrease was more significant in the AHCM group as compared to the HTLVH group,while the HTLVH group was mainly characterized by a decrease in LSB,which was significantly lower as compared to the AHCM group (all P<0.05).Compared with the normal control group,the ABLR,AGLR,and ABMLR were significantly reduced in the AHCM group,while significantly increased in the HTLVH group (all P<0.05).The ROC curve showed that the AUC of ABLR,AGLR,ABMLR,and LSA was 0.873 to 0.916,using<1.28 as the cutoff value of ABLR,the sensitivity was 90.0％ and specificity was 88.7％ for diagnosing AHCM. Conclusions:The apical relative longitudinal strain indices can reflect the myocardial functional characteristics of AHCM patients,which are better than single apical longitudinal strain value.As the most representative indice,ABLR may be useful in distinguishing AHCM from left ventricular hypertrophy caused by other diseases,and can be used as a parameter for the evaluation of myocardial function damage in AHCM.

Colorectal cancer is a common malignant tumor in gastrointestinal tract. Its onset and development are associated with its own characteristics as well as the tumor microenvironment (TME) in which tumor-associated macrophages (TAMs) are the most abundant immune cells. After being recruited to the tumor site and stimulated by different signals in TME, TAMs can grow into two different subtypes, namely M1 and M2. TAMs are mainly manifested as M1 macrophages in the early stage of colorectal cancer, mediating the immune response to inhibit tumor growth. In the late stage, TAMs mainly grow into M2 macrophages, showing the ability to suppress immunity, stimulate the proliferation of tumor cells and tumor angiogenesis, and promote the invasion and metastasis of tumor cells. It has been found that intervention in TAMs polarization can regulate its relationship with the onset and development of colorectal cancer.
Humans ; Tumor-Associated Macrophages ; Macrophages ; Tumor Microenvironment ; Colorectal Neoplasms

H 1-antihistamines are widely used in the treatment of various allergic diseases, but there are still many challenges in the safe and rational use of H 1-antihistamines in pediatrics, and there is a lack of guidance on the prescription review of H 1-antihistamines for children.In this paper, suggestions are put forward from the indications, dosage, route of administration, pathophysiological characteristics of children with individual difference and drug interactions, so as to provide reference for clinicians and pharmacists.

Anti-seizure medications (ASMs) are the main therapy for epilepsy.There are many kinds of ASMs with complex mechanism of action, so it is difficult for pharmacists to examine prescriptions.This paper put forward some suggestions on the indications, dosage forms/routes of administration, appropriateness of usage and dosage, combined medication and drug interaction, long-term prescription review, individual differences in pathophysiology of children, and drug selection when complicated with common epilepsy, for the reference of doctors and pharmacists.

Objective:To study the effects of Zuogui Pills on the expressions of miR-133b-3p and RhoA in osteoclasts of postmenopausal osteoporosis rats; To discuss its potential mechanism.Methods:SD female rats were randomly divided into normal group, model group, sham-operation group, and Zuogui Pills group using a random number table method, with 6 rats in each group. The model group and Zuogui Pills group were treated with oophorectomy to construct a rat model of osteoporosis. Zuogui Pills group was orally administered with Zuogui Pills decoction at a concentration of 10 g/kg for 12 consecutive weeks. Colorimetric method was used to measure the serum calcium and phosphorus levels of rats, and ELISA method was used to detect ALP levels. Bone density meter was used to measure the bone density of the femurs of rats in each group. The osteoclast of each group were cultured, and the expressions of RANKL and RUNX2 protein were detected by Western blot. MiRNA sequencing and differential expression analysis were performed on bone tissues of rats. Osteoclasts were treated with miR-133b-3p mimic and its negative control. The cell proliferation activity of osteoclasts was detected by cell counting kit-8 (CCK-8). The osteoclast differentiation activity was detected by the tartrate-resistant acid phosphatase staining. The dual-luciferase reporter assay was used to detect the relationship between miR-133b-3p and RhoA. The "rescue" experiment of miR-133b-3p mimic and RhoA co-expression were used to study the molecular regulatory mechanism of Zuogui Pills on osteoclast activity.Results:Compared with the model group, the bone mineral density of Zuogui Pills group significantly increased ( P<0.05, P<0.01), the levels of calcium and phosphorus in serum increased, the level of alkaline phosphatase ALP decreased ( P<0.05), the expression of RANKL protein decreased, and the expression of RUNX2 protein increased. Sequencing results showed that rno-miR-133b-3p was down-regulated in osteoclasts of postmenopausa osteoporosis rats treated with Zuogui Pills with the maximum difference ( P<0.01). Q-PCR results showed that the expression of miR-133b-3p in osteoclasts of Zuogui Pills group was significantly lower than that of the model group. The upregulation of miR-133b-3p could significantly promote the cell proliferation and differentiation of osteoclasts. RhoA overexpression could reverse the excessive proliferation and differentiation of osteoclasts caused by miR-133b-3p overexpression. Conclusions:RhoA is the target gene regulated by miR-133b-3p. Zuogui Pills can inhibit the activity of osteoclasts by regulating miR-133b-3p/RhoA axis, relieving the symptoms of osteoporosis.

Gastric cancer （GC） is a digestive tract tumor that occurs in the epithelial tissues of the gastric mucosa， seriously affecting the life and health of patients， and its mortality rate ranks the third among malignancies. Although medical technology has made great progress in recent years， the progression of GC still cannot be effectively controlled by surgery， chemotherapy， and targeted therapy. The pathogenesis of GC is extremely complex and is closely related to the tumor microenvironment， chronic inflammation， and immune escape， among which the reduction of tumor cell apoptosis is one of the important mechanisms for the occurrence and development of GC. Apoptosis refers to the process of spontaneous termination of cell life caused by genes under specific physiological or pathological conditions， which is of great significance for maintaining the stability of the internal environment. Researchers have found that in the GC state， mitochondrial endogenous apoptosis， endoplasmic reticulum stress， external death receptors， and other apoptosis pathways are regulated by multiple signaling pathways and genes， which together lead to the decline of GC cell apoptosis rate and thus promote the progression of GC. Chinese medicine is advantageous and characterized by multiple components， multiple targets， synergistic effect， and few adverse reactions. A large number of studies have shown that polysaccharide components， as effective components of Chinese medicine， have biological activities such as cancer inhibition， blood sugar control， anti-inflammation， antioxidant damage， and anti-virus， and can effectively inhibit the deterioration of GC by inducing cell apoptosis， gradually becoming a hot spot in GC drug research and development. However， systematic reviews on the apoptosis of GC induced by Chinese medicine polysaccharides are rarely reported. Therefore， this paper analyzed and summarized the studies of Chinese medicine polysaccharides in promoting apoptosis and interfering with GC， in order to provide a theoretical basis for the basic research， new drug development， and clinical application of Chinese medicine polysaccharides in the intervention of GC.

Objective:To investigate the pharmacokinetics of cerebrospinal fluid pemetrexed following intrathecal injection chemotherapy in patients with leptomeningeal metastasis (LM) from lung adenocarcinoma and provide a basis for clinical intrathecal injection chemotherapy.Methods:A total of 21 patients with lung adenocarcinoma LM who underwent pemetrexed intrathecal injection chemotherapy via Ommaya capsule at Nanjing Drum Tower Hospital, Aiffilitated Hospital of Nanjing University Medical School from November 2019 to November 2022 were collected, and divided into 30, 40 and 50 mg groups ( n=10, n=4, n=7) according to pemetrexed dose. Cerebrospinal fluid was collected at 0, 0.5, 1, 2, 4, 6, 12, 24 and 48 h after the first intrathecal injection chemotherapy, and day 8 of each cycle for three groups. Reversed phase high performance liquid chromatography was used to determine the drug concentration in cerebrospinal fluid, to clarify the drug-related pharmacokinetic parameters, and to compare the differences in pemetrexed concentration among groups. Finally, cerebrospinal fluid pemetrexed concentration changes were observed and compared after different intrathecal injection chemotherapy cycles. Results:There were statistically significant differences in cerebrospinal fluid drug concentrations of patients in three groups at 0, 0.5, 1, 2, 4, 6, 12, 24 and 48 h after the first intrathecal injection chemotherapy (30 mg group: F=20.56, P<0.001; 40 mg group: F=27.06, P<0.001; 50 mg group: F=28.63, P<0.001), and there were statistically significant differences in the concentration of cerebrospinal fluid drugs in each dose group at 0.5, 1, 2, 4, 6 and 12 h compared to 0 h after intrathecal injection chemotherapy (all P<0.05). Compared to the 30 mg group, cerebrospinal fluid drug concentrations in the 50 mg group increased at 1, 2, 4, 6, 12 and 24 h after intrathecal injection chemotherapy, with statistically significant differences (all P<0.05). Pharmacokinetic analysis of cerebrospinal fluid pemetrexed showed that area under the concentration-time curve (AUC) 0-∞ of the 30, 40 and 50 mg groups were (5 696.12±283.32), (7 886.29±396.57), and (14 202.70±440.19) h·mg/L, respectively, with a statistically significant difference ( F=1 159.00, P<0.001) ; AUC 0-∞ increased in the 50 mg group compared to the 30 and 40 mg groups (both P<0.05) ; AUC 0-∞ increased in the 40 mg group compared to the 30 mg group ( P<0.05). The half-lives of three groups were (8.75±0.23), (11.29±0.59) and (16.42±1.23) h, respectively, with a statistically significant difference ( F=206.80, P<0.001) ; half-life was longer in the 50 mg group compared to the 30 and 40 mg groups (both P<0.05) ; half-life was longer in the 40 mg group compared to the 30 mg group ( P<0.05). The peak time of three groups were (1.55±0.10), (1.00±0.01), (1.43±0.11) h, respectively, with a statistically significant difference ( F=48.11, P<0.001) ; the peak time was shorter in the 40 and 50 mg groups compared to the 30 mg group (both P<0.05). Clearance of three groups were (7.02±2.46), (5.80±1.25) and (3.66±1.32) L/h, respectively, with a statistically significant difference ( F=6.02, P=0.009) ; clearance was decreased in the 50 mg group compared to the 30 mg group ( P<0.05). The peak concentration of three groups were (540.45±32.25), (820.75±46.47) and (1 014.78±64.96) mg/L, respectively, with a statistically significant difference ( F=207.70, P<0.001) ; peak concentration increased in the 50 mg group compared to the 30 and 40 mg groups (both P<0.05) ; peak concentration increased in the 40 mg group compared to the 30 mg group ( P<0.05). Cerebrospinal fluid drug concentrations were dynamically monitored after 4 cycles of intrathecal injection chemotherapy, in which cerebrospinal fluid pemetrexed concentrations in 30 mg group were (13.76±4.79), (11.41±7.08), (9.41±2.59) and (7.86±4.02) mg/L, respectively; 40 mg group were (14.45±6.59), (12.87±15.73), (11.24±2.48) and (9.09±3.38) mg/L, respectively; 50 mg group were (12.94±10.34), (9.72±7.62), (8.15±8.17) and (4.34±4.21) mg/L, respectively. There was a statistically significant difference in cerebrospinal fluid drug concentrations among different intrathecal injection chemotherapy cycles in 30 mg group ( F=4.04, P=0.016), and the cerebrospinal fluid drug concentration decreased in cycles 3 and 4 compared to cycle 1 (both P<0.05). There were no statistically significant differences in cerebrospinal fluid drug concentrations among different treatment cycles in 40 and 50 mg groups ( F=0.28, P=0.837; F=3.57, P=0.066) . Conclusion:Reversed phase high performance liquid chromatography method can effectively detect the pemetrexed concentration in cerebrospinal fluid; dynamic monitoring of cerebrospinal fluid pemetrexed concentration can provide a basis for the dosage and the treatment cycle of intrathecal injection chemotherapy in LM patients with lung adenocarcinoma.

We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.