1.Study on the 90-day Feeding Experimental Background Data of SD Rats for Drug Safety Evaluation
Chao QIN ; Shuangxing LI ; Tingting ZHAO ; Chenchen JIANG ; Jing ZHAO ; Yanwei YANG ; Zhi LIN ; Sanlong WANG ; Hairuo WEN
Laboratory Animal and Comparative Medicine 2025;45(4):439-448
ObjectiveTo establish background data for a 90-day feeding trial of SD rats to ensure the reliability of research data. MethodsBackground data from six independent 90-day feeding trials of SD rats conducted by the National Center for Safety Evaluation of Drugs from 2020 to 2023 were summarized. These studies involved a blank control group of 120 SPF-grade 4-week-old SD rats, with an equal number of males and females, which were only given standard full-nutrient pelleted rat feed. After the quarantine period, the animals were observed for an additional 90 days, followed by intraperitoneal injection of Zoletil (50 mg/mL) for anesthesia, blood sampling, euthanasia, and necropsy. By analyzing the data from the blank control group, a relevant background database for SD rats was established. ResultsBoth male and female rats exhibited steady weight gain, with a more pronounced increase in male rats. Within 90 days, the average body weight of male and female rats increased to over 500 g and 300 g, respectively. Three weeks later, the average daily food intake of male rats stabilized at approximately 25~28 g per rat, while that of female rats remained stable at approximately 16~19 g per rat. The food utilization rate of all animals gradually decreased from the first week of the experiment. In the white blood cell (WBC) differential count results, significant differences were observed in the counts of WBCs, neutrophils (Neut), lymphocytes (Lymph), and monocytes (Mono) between males and females (P<0.001). However, there were no significant differences in the percentages of neutrophil (%Neut), lymphocyte (%Lymph), and monocyte (%Mono) between the sexes (P>0.05). The average red blood cell count (RBC), hemoglobin concentration (HGB), hematocrit (HCT), platelet count (PLT), prothrombin time (PT), and activated partial thromboplastin time (APTT) were higher in male animals than in female animals (P<0.05). The average values of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), creatine phosphokinase (CK), lactate dehydrogenase (LDH), glucose (GLU), and triglyceride (TG) in male rats were higher than those in female rats (P<0.05). The urinary pH range for male animals was 5.0 to 8.5, while for female animals it was 6.5 to 9.0. The majority of male animals had a urinary specific gravity lower than 1.020, and the majority of female animals had a urinary specific gravity lower than 1.015. The weights of various organs (excluding the adrenal glands and reproductive organs) in male animals were heavier than those in female animals (P<0.001), while the organ/body weight ratios (excluding the kidneys and reproductive organs) of female animals were higher than those of male animals (P<0.001). ConclusionThis study summarizes the background reference ranges for body weight, food intake, hematology, and serum biochemistry indicators in SPF-grade SD rats in the untreated control group from six 90-day feeding trials conducted by the National Center for Safety Evaluation of Drugs. It provides important reference data for related research. By summarizing the background and spontaneous histopathological changes in rats, this study aids in the standardization and normalization of subsequent research, as well as in the evaluation and analysis of abnormal results.
2.Background data of SD rats in embryo-fetal development toxicity study
Manman ZHAO ; Zihe LIANG ; Xiaomeng LIU ; Ying YANG ; Chao WANG ; Tingting ZHAO ; Xingchao GENG ; Xiaobing ZHOU ; Sanlong WANG
Chinese Journal of Pharmacology and Toxicology 2024;38(7):526-532
OBJECTIVE To set up normal ranges for indexes in embryo-fetal development toxicity studies in Sprague-Dawley(SD)rats and to establish a background database to provide reference for the embryo-fetal development toxicity evaluation of drugs.METHODS The data on embryonic develop-ment and fetal growth from embryo-fetal development toxicity studies(11 items)conducted by our center between 2013 and 2022 was statistically analyzed,involving 205 pregnant rats and 3037 fetuses in total,with the mean and standard deviation,coefficient of variation and 95%confidence interval calculated.The indexes included body mass,body mass gain and food consumption during pregnancy,pregnancy outcomes(pregnancy rate,average corpora lutea,average Implant sites,average live conceptuses,live conceptuse rate,resorption rate and dead conceptuse rate),fetal growth and development(fetal mass,placental mass and sex ratio),appearance abnormality rate,visceral abnormality rate,and skeletal abnormality rate.RESULTS The mass of pregnant rats trended up during gestation,with significant increases in the late period.Food consumption increased along with gestation.Caesarean section was conducted on gestation day 20,and the pregnancy rate was 93.2%.The average corpora lutea,Implant sites and live conceptuses were 18.0±3.2,15.9±2.8 and 14.8±3.0,respectively.The live conceptuse rate was 93.4%while the total dead embryo rate was 6.6%.The average mass of fetuses and placenta were respectively 3.6±0.3 and(0.6±0.3)g,and the fetal sex ratio(male/female)was 0.94.The incidence of fetal appearance abnormalities was about 0.2%,and that of soft tissue abnormalities was approximately 0.8%.The rate of skeletal abnormalities was about 1.2%,with higher incidence of non-ossification and incomplete ossification mostly identified on sternum and hyoid bone.The numbers of ossifications of metacarpal bones,metatarsal bones and sacrococcygeal vertebrae were 7.0±0.7,8.0±0.1 and 7.4±0.5,respectively.The rate of ossification of sternumⅠtoⅣwas higher,with an average of about 98.6%-99.9%.The ossification rates of sternum Ⅴ and Ⅵ were(68.0±28.4)%and(82.8±23.9)%.CONCLUSION The background database of indexes in the embryo-fetal development toxicity study on SD rats is established for our GLP laboratory,which provides reference for reproductive toxicity studies.
3.Clinical characters and risk factors for Henoch - Schonlein Purpura combined with cardiac damage in children
Rong WANG ; Sanlong ZHAO ; Guixia DING ; Fei ZHAO ; Huaying BAO ; Aihua ZHANG ; Songming HUANG
Chinese Journal of Applied Clinical Pediatrics 2015;(21):1619-1621
Objective To summarize the clinical characteristics and laboratory test results of children with Henoch - Schonlein purpura(HSP),and further to analyze the risk factors for HSP combined with cardiac damage. Methods The clinical and laboratory tests findings from 707 children diagnosed as HSP at Nanjing Children's Hospi-tal were retrospectively analyzed,who were recruited from November 2011 to December 2012. The possible risk factors for HSP with cardiac damage in children were recorded,including gender,age,predisposing causes,gastrointestinal symptoms,joint pain,kidney disorders,serum electrolytes,anti - streptolysin 〝O〝 test,erythrocyte sedimentation rate, and complement level were summarized. Chi - square test and Logistic regression were performed to analyze the risk fac-tors of cardiac damage in children with HSP. Results Among 707 cases,192(27. 2% )patients were combined with car-diac damage,115 male and 77 female,and the proportion of men to women was 1. 00: 0. 67;age ranged from 11 months to 15 years and 4 months(6 years and 5 months for median age),6 patients ﹤ 3 years old occupying 3. 1% ,103 patients≥3 - 7 years old occupying 53. 7% ,82 patients≥7 - 14 years old occupying 42. 7% ,1 patient≥14 years old occupying 0. 5% ,and the age of onset in preschool and school age. Electrocardiogram(ECG)abnormalities were found in 190 patients,the main manifestations including long Q - T interval,ST - T segment falling down and sinus bradycar-dia,and one or more items of abnormal myocardial enzymes existed in 24 cases;echocardiography was performed in 35 cases of children,but no abnormality was detected,no obvious symptoms such as flustered or chest tightness or precor-dial distress. Statistical analysis showed that gender,predisposing causes,mixed HSP,complement level were related to the incidence of cardiac damage in children with HSP(P ﹤ 0. 05). Furthermore binary Logistic regression identified that in male patients,the ratio of X1 vs OR ratio was 0. 654(95% CI 0. 462 - 0. 926,P ﹤ 0. 05),for predisposing causes,the ratio of X2 vs OR ratio was 2. 63(95% CI 1. 838 - 3. 765,P ﹤ 0. 001),for mixed HSP,the ratio of X3 vs OR ratio was 2. 452(95% CI 1. 301 - 4. 621,P ﹤ 0. 01),which were independent factors for cardiac damage in chil-dren with HSP. Conclusions ECG and/ or myocardial enzyme spectrum abnormalities are the main clinical ma-nifestations of cardiac damage in children with HSP. Male patients,predisposing causes of the respiratory tract infec-tion,mixed HSP and hypocomplementemia were high risk factors in the development of cardiac damage,which require special consideration clinically,and earlier ECG and myocardial enzymes examination,early diagnosis and treatment are necessary to avoid the occurrence of severe cases.
4.Establishment of a multiplex real time quantitative PCR method for CMV promoter nucleic acid sequences detection
Yufa MIAO ; Sanlong WANG ; Xiaobing ZHOU ; Yan HUO ; Xingchao GENG ; Jianjun LYU ; Jufeng WANG ; Bo LI
Chinese Journal of Pharmacology and Toxicology 2014;(2):296-301
OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.
5.Effects of inhaled nitric oxide on airway resistance in guinea pigs
Xiuxian YAN ; Sanlong LI ; Hong WANG ; Deyu GUO ; Shenghua DONG
Chinese Journal of Pathophysiology 1986;0(01):-
AIM: To observe the effect of continuous inhaled nitric oxide (NO) on airway resistance in guinea pigs. METHODS: 36 healthy male guinea pigs were divided into control group, isoproterenol group and two inhaled NO (20?10 -6 and 60?10 -6 ) groups. Respiratory resistance (R_E) and dynamic compliance(C_ dyn )were recorded before and after evoked by histamine at different doses. RESULTS: After injections of intravenous histamine at 80,120 and 160 ?g/kg, the R_E of inhaled NO groups were apparently lower than that of control group. Compared with control group, the C_ dyn of inhaled NO groups were significantly higher after administration of histamine at 80, 120 and 160 ?g/kg. After given histamine at more than 80 ?g/kg,the R_E of inhaled NO groups were higher and the C_ dyn lower than those of isoproterenol group. CONCLUSION: Inhalation of 20?10 -6 NO and 60?10 -6 NO can inhibit the increase in airway resistance induced by higher doses (80,120 and 160 ?g/kg )of intravenous histamine, but the effect of intravenous isoproterenol seems stronger.

Result Analysis
Print
Save
E-mail