Purpose To evaluate the differential diagnostic value of conventional ultrasound in the ureteral polyps and ureteral carcinoma via continuous observation.Materials and Methods The conventional ultrasound of patients with ureteral polyps and ureteral carcinoma treated in Shaanxi Provincial People's Hospital were retrospectively analyzed from June 2015 to June 2022.According to the pathological results,all participants were divided into the ureteral polyp group(98 cases)and the ureteral carcinoma group(151 cases).All clinical and ultrasound data were recorded,and the differences of echo,blood flow and peristalsis were compared between the two groups.Results There were significant differences in ureteral peristalsis,color Doppler flow distribution,periureteral tissue thickening,increased echo,and hydronephrosis(χ2=197.50,138.89,26.97,36.13,all P<0.05)between the two groups.Low echo was predominant in both groups[67(68.37)vs.114(75.50)],with no significant difference(χ2=1.52,P>0.05).In the ureteral polyp group,67 cases were found in the upper ureter,89 cases were observed continuously with common peristalsis,and 73 cases with color blood flow were mostly central blood flow,while in the ureteral cancer group,85 cases were found in the middle and lower ureter,148 cases showed almost no peristalsis,and 122 cases with color blood flow were mostly peripheral blood flow.Conclusion There are some differences in clinical features such as the location as well as whether hydronephrosis between ureteral polyps and carcinoma.Peristalsis can provide the differential diagnosis for ureteral polyps and ureteral carcinoma via continuous observation.

Ultrasound contrast agent is widely used in the diagnosis and treatment of kidney diseases.Connecting specific ligands on the surface of ultrasound contrast agent to construct targeted ultrasound contrast agent is a development trend.Targeted ultrasound contrast agent can specifically gather in kidney lesions,significantly enhance the ultrasound imaging of kidney lesions and the therapeutic effect of drug or gene,and achieve the early diagnosis and targeted therapy of kidney diseases at the gene,molecular and cell levels.The research progress of targeted ultrasound contrast agent in molecular imaging and targeted therapy of kidney diseases are reviewed in this paper.

Objective:To retrospectively analyze clinical efficacy and safety of omalizumab in the treatment of chronic urticaria (CU) in southern Zhejiang, China.Methods:A retrospective observational study was conducted on CU patients who received omalizumab treatment at the First Affiliated Hospital of Wenzhou Medical University from January 1st, 2018 to August 1st, 2021. Through the outpatient follow-up visits, the disease activity, condition control, and quality of life were evaluated using the 7-day urticaria activity score (UAS7) , urticaria control test (UCT) , and dermatology life quality index (DLQI) . In addition, changes in disease condition, recurrence after withdrawal, and adverse events were assessed. Independent-sample t test was used for intergroup comparisons of normally distributed measurement data, Wilcoxon signed-rank sum test or Kruskal-Wallis H test was used for comparisons of non-normally distributed measurement data, and chi-square test or Fisher′s exact test was used for comparisons of enumeration data. Results:A total of 252 CU patients with poor response to antihistamines were included, with a baseline UCT score of 5.0 ± 2.4 points, a UAS7 score of 25.6 ± 6.2 points, and a DLQI score of 17.5 ± 4.7 points; among them, 204 (81.0%) were treated with omalizumab at an initial dose of 300 mg, and 48 (19.0%) with omalizumab at an initial dose of 150 mg. At the end points (12.0 ± 1.4 months after the start of treatment) , an overall control rate of 90.3% (224/248) was achieved after the omalizumab treatment; concretely, 137 (55.2%) patients achieved complete control (UCT = 16 points) , 87 (35.1%) achieved partial control (12 points ≤ UCT < 16 points) , and 24 (9.7%) showed no response (UCT < 12 points) , while 10 with partial response shifted to complete control after dose increase. During the treatment period, recurrence occurred in 50 patients (36.5%) , of whom 32 patients opted for retreatment with omalizumab, and then 30 (93.8%) achieved partial or complete control. Adverse events were reported in 8 patients (3.2%) , and all were mild or moderate.Conclusion:Omalizumab was effective in the real-world treatment of CU, and could improve patients′ quality of life, with a favorable safety profile.

We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.

Objective:To explore the clinical efficacy and safety of different surgical procedures of Mayo level Ⅳ inferior vena cava tumor thrombus(IVC-TT).Methods:The clinical and pathological data of 36 patients with Mayo level Ⅳ tumor thrombus were collected in three large clinical centers in China, including 18 cases in PLA General Hospital, 7 cases in Nanfang Hospital, and 11 cases in Renji Hospital. There were 25 males and 11 females.The median age was 56.5 years (53-67 years old). The average body mass index was 24.18±2.55 kg/m 2. The average diameter of renal tumors was 8.24±3.25 cm. The average length of inferior vena cava tumor thrombus was 12.89±2.50 cm. Mayo level Ⅳ tumor thrombus were divided into level Ⅳa and level Ⅳb (301 classification) based on the criterion of whether the proximal end of the thrombus has invaded the right atrium. Among them, level Ⅳa patients underwent robot-assisted inferior vena cava thrombectomy without cardiopulmonary bypass(CPB-free group, 6 cases). Level Ⅳb patients underwent robot-assisted inferior vena cava thrombectomy with cardiopulmonary bypass(CPB group, 12 cases) or cardiopulmonary bypass with deep hypothermic circulatory arrest assisted inferior vena cava thrombectomy(CPB/DHCA group, 18 cases). The baseline data of the three groups of patients were comparable. The perioperative results and long-term survival data after surgery were compared with different surgical methods for grade Ⅳcancer thrombosis. Results:All operations were successfully completed. Compared with the CPB group, the CPB-free group had a shorter first portal blocking time[17.5(15-36)min vs. 36.5(12-102)min, P=0.044], less intraoperative bleeding [2 350(1 000-3 000)ml vs. 3 500 (1 500-12 000)ml, P=0.043] and a lower allogeneic blood transfusion [1 250(500-2 000)ml vs. 2 185(700-5 800)ml, P=0.049]. Compared with the CPB/DHCA group, the CPB-free group had an advantage in reducing intraoperative allogeneic blood transfusion [1 250(500-2 000)ml vs. 2 700(1 200-10 000)ml, P=0.003]. There were no significant differences between groups in terms of duration of surgery and postoperative hospital stay. Among the 36 patients in this group, 23(64%) developed major complications (level Ⅲ or above), including 9 (25%) grade Ⅲ, 12 (33%) grade Ⅳ, and 2 (6%) grade Ⅴ. The CPB-free group had a relatively low complication rate of grade Ⅳ or above [ 17% (1/6) vs.42% (5/12) vs.44% (8/18)]. There were no statistical differences in median progression-free survival (16.4 vs.12.3 vs.18.0 months, P=0.695) and overall survival (30.1 vs.30.2 vs.37.7 months, P=0.674) between the groups. Conclusions:Robot-assisted inferior vena cava thrombectomy without cardiopulmonary bypass has the advantages of short ischemia time of organs, less intraoperative bleeding, and low incidence of major complications, which can be used as a safe and feasible surgical strategy for selected level Ⅳ tumor thrombus.

Acute kidney injury (AKI) is common in critically ill patients and it is directly related to the patient's prognosis and survival. Despite remaining uncertainties regarding the prevalence of AKI in intensive care unit (ICU), the overall incidence of AKI is relatively high, and prompt recognition is necessary to ensure the risk assessment, early diagnosis, clinical outcome, and treatment of critically ill patients. Doppler-based renal resistive index (RRI) mainly reflects vascular bed resistance state, which can be indirect to the extent of the damage of renal parenchyma. It is a relatively objective and quantitative evaluation, and is widely used in clinical prognosis of acute or chronic renal damage evaluation and judgment. This paper reviews the definition of RRI, the measurement methods of RRI, the application and progress of RRI in the field of AKI, the advantages and disadvantages of ultrasonic measurement of RRI, the long-term application of RRI, the effectiveness of RRI in predicting AKI, and the progress in clinical application.

Objective:To explore the feasibility and safty of robot assisted trans-diaphragmatic intropericardial inferior vena cava occlusion and thrombectomy in treatment of Ⅳa grade tumor thrombus without cardiopulmonary bypass and thoracotomy.Methods:The clinical data of 4 patients with renal cell carcinoma and Ⅳa grade tumor thrombus by robot assisted trans-diaphragmatic intropericardial inferior vena cava occlusion and thrombectomy from January 2013 to June 2019 were retrospectively analyzed. The median age was 53.5 (53-70) years. The average body mass index was 23.25 (20.7-26.3) kg/m 2. The tumors were located on the right side in 2 cases. The average maximum diameter of the tumor was 8.1 (3.6-11.2) cm.Preoperative tumor thrombus of all patients was classified as Ⅳa. The average preoperative length of tumor thrombus in vena cava was 12.3 (11.8-18.0) cm. All the operations were performed under multidisciplinary cooperation of urology, hepatobiliary, cardiovascular, ultrasound and anesthesiologist team. Surgical procedure: Robot assisted liver mobilization was used to expose the inferior vena cava. Under the guidance of intraoperative ultrasound, the central tendon and pericardium of diaphragm were dissected until the inferior vena cava and right atrium in the superior pericardium were exposed. The first porta hepatis and inferior vena cava were blocked in turn.The vena cava thrombectomy and inferior vena cava reconstruction were performed. Results:All the operations were completed without conversion. The median operation time was 553.5 (338-642) minutes, and the median time of the first porta hepatis occlusion was 18.1 (14-32)minutes. The median blood loss was 1 900(1 000-2 600)ml. All patients were transferred to ICU after operation. The median length of stay in ICU was 7(4-8) days, and the median time of indwelling drainage tube was 8(4-12) days. The average postoperative hospital stay was 13(11-20) days. There were 1 case of grade Ⅱ and 3 cases of grade Ⅲ complications (Clavien classification). One case had paroxysmal supraventricular tachycardia, one case had lymphatic fistula, one case had pleural effusion with atelectasis, and one case had hepatic and renal insufficiency and lymphatic fistula. The complications were improved after treatment. There was no perioperative death.Conclusions:Robot assisted trans-diaphragmatic intropericardial inferior vena cava occlusion and thrombectomy is an alternative method for the treatment of Ⅳa grade inferior vena cava tumor thrombus. Using this method, Ⅳa grade tumor thrombus can be treated without cardiopulmonary bypass and thoracotomy, with controllable complications and zero perioperative mortality.

Coronary artery disease (CAD) is a chronic disease but causes the highest mortality and morbidity among the cardiovascular diseases worldwide. Correlations between CAD and gut microbiota have been observed. This suggests that the gut microbiota could become a vital diagnostic marker of CAD, and restoring the gut habitat may become a promising strategy for CAD therapy. The elevated level of trimethylamine-N-oxide (TMAO), a gut microbiota-derived metabolite, was found to be associated with the increased risk of cardiovascular disease and the all-cause mortality. Preclinical studies have shown that it has pro-arteriosclerosis properties. It is likely that regulating the production of TMAO by gut microbiota may become a promising strategy for anti-atherosclerosis therapy. This review summarizes the clinical and preclinical researches on the intervention of CAD by regulating the gut microbiota and the microbiota-derived metabolite TMAO, with the aim to provide new target for the therapy of CAD.
Coronary Artery Disease ; Gastrointestinal Microbiome ; Humans ; Methylamines ; Oxides

Objective To explore the feasibility of robot-assisted laparoscopic inferior vena cava (IVC) thrombectomy in treating renal tumor with Mayo level Ⅲ-Ⅳ inferior vena cava thrombus.Methods From November 2014 to January 2017,5 cases of renal tumor with Mayo level Ⅲ-Ⅳ inferior vena cava tumor thrombus were treated with robot-assisted surgery.There were 4 males and 1 female with the median age of 59 years (range 54-71 years).Four cases had the renal tumor on the right side and one on the left side.The mean tumor size was 6.8 cm (range 5-9 cm) with 3 cases of T3b and 2 cases of T3c.There were 4 cases of level Ⅲ and 1 case of level Ⅳ inferior vena cava thrombus with the median length of 9 cm (range 7-11 cm).The surgical procedure for Mayo level Ⅲ inferior vena cava thrombus included mobilization of both left and right robes of liver,subsequently controlling the suprahepatic infradiaphramatic IVC and first porta hepatis simultaneously.The surgical procedure for Mayo level Ⅳ inferior vena cava thrombus included cardiopulmonary bypass by multi-disciplinary cooperation among urologists,hepatobiliary and cardiovascular surgeons.The procedures included live mobilization,control of the superior vena cava and first porta hepatis and remove thrombus in the atrium and IVC respectively.Results All operations were completed successfully.The median operative time was 440 min (320-630 min).The blood recovery device was used and the intraoperative estimated blood loss was 2 500 ml (500-6 000 ml) and all cases required intraoperative blood transfusion.The median time of intraoperative occlusion of IVC was 35 min (25-50 min).All patients were transferred to the intensive care unit for median of 4 days (2-8 days) after surgery.The median time to remove the postoperative drainage tube was 9 days (7-12 days).Postoperative pathological diagnosis revealed 5 cases of clear cell carcinoma.Postoperative renal dysfunction occurred in 3 patients and liver dysfunction occurred in 2 patients who improved after medical therapy.During median 19.6 months (12-48 months) of follow-up,1 patient died and 1 patient progressed.Conclusions Despite the high risk of surgery,robot-assisted laparoscopic IVC thrombectomy for renal tumor with Mayo level Ⅲ-Ⅳ thrombus is feasible for experienced surgeons in selected patients.However,the oncological outcomes need further investigation.

We reported a case of monochorionic monoamniotic twins discordant for anencephaly diagnosed by second-trimester ultrasonography at the First Affiliated Hospital of Fujian Medical University.Ultrasound at seven weeks of gestation showed only one gestational sac with an embryo inside.Another 12 gestational weeks' ultrasound scan performed at another hospital found one gestational sac and one fetus (crown-rump length was 6.11 cm and nuchal translucency was 0.11 cm) in the upper-middle uterine cavity.The ultrasound examination at 22+6 gestational weeks identified one placenta and two fetuses without obvious diaphragm echo in between.Although no structural abnormality was observed in one fetus,frog-like eyes,absence of skull image and brain tissue echo were presented in the other fetus.The patient was transferred to a higher level hospital and was successfully performed radiofrequency ablation for selective reduction at 23+4 weeks of gestation.At 35 weeks,a premature live boy and an anencephalic stillbirth fetus were born vaginally after premature rupture of membranes.The baby boy was healthy at follow-up at four months old.