OBJECTIVE: To detect potential variants in eight Chinese pedigrees affected with autosomal dominant polycystic kidney disease (ADPKD) and provide prenatal diagnosis for two of them. METHODS: Whole exome sequencing and high-throughput sequencing were carried out to detect variants of PKD1 and PKD2 genes in the probands. Sanger sequencing was used to validate the variants, and their pathogenicity was predicted by searching the ADPKD and protein variation databases. RESULTS: Eight PKD1 variants were detected, which have included five nonsense mutations and three missense mutations. Among these, four nonsense variants (PKD1: c.7555C>T, c.7288C>T, c.4957C>T, c.11423G>A) were known to be pathogenic, whilst one missense variant (PKD1: c.2180T>G) was classified as likely pathogenic. Three novel variants were detected, which included c.6781G>T (p.Glu2261*), c.109T>G (p.Cys37Gly) and c.8495A>G (p.Asn2832Ser). Prenatal testing showed that the fetus of one family has carried the same mutation as the proband, while the fetus of another family did not. CONCLUSION PKD1 variants, including three novel variants, have been identified in the eight pedigrees affected with ADPKD. Based on these results, prenatal diagnosis and genetic counseling have been provided.
DNA Mutational Analysis/methods* ; Female ; Humans ; Mutation ; Pedigree ; Polycystic Kidney, Autosomal Dominant/genetics* ; Pregnancy ; Prenatal Diagnosis ; TRPP Cation Channels/genetics*

OBJECTIVE: To explore the genetic etiology for 17 pedigrees affected with autosomal dominant polycystic kidney disease (ADPKD). METHODS: Peripheral blood samples were derived from the probands and their parents with informed consent. Following DNA extraction, targeted capture and next generation sequencing were carried out in search for potential disease-causing variants. Sanger sequencing was used to validate candidate pathogenic variants co-segregating with the disease in each pedigree. Prenatal diagnosis was provided for one family. RESULTS: Among the 17 probands, 14 PKD1 mutations and 3 PKD2 mutations were detected, which included 6 missense mutations, 4 nonsense mutations and 7 frameshift mutations. Of these, 8 have been associated with ADPKD previously and 9 were novel, which included c.7625G>T (p.Gly2542Val), c.3673C>T (p.Gln1225*), c.11048dupT (p.Thr3684Aspfs*38), c.9083_9084delAG (p.Glu3028Glyfs*40), c.10560delG (p.Pro3521Hisfs*6), c.7952_7974del TGTCCCTGAGGGTCCACACTGTG (p.Val2651Glyfs*2) of PKD1, and c.662T>G (p.Leu221*), c.1202_1203 insCT (p.Glu401Aspfs*2), and c.919 delA (p.Ser307Valfs*10) of PKD2. Prenatal testing showed that the fetus did not carry the same mutation as the proband. CONCLUSION Identification of causative mutations in the 17 pedigrees affected with ADPKD has provided a basis for genetic counseling and reproductive guidance. The novel findings have enriched the mutational spectrum of the PKD1 and PKD2 genes.
DNA Mutational Analysis ; Female ; Humans ; Mutation ; Pedigree ; Polycystic Kidney, Autosomal Dominant ; Pregnancy ; Prenatal Diagnosis ; TRPP Cation Channels

Compressive femoral neuropathy is a disabling condition accompanied by difficulty in hip flexion and knee extension. It may result from retroperitoneal hematoma or bleeding, or from complications associated with pelvic, hip surgery, and renal transplants. A 55-year-old female with autosomal dominant polycystic kidney disease presented with proximal muscle weakness in lower extremities. The patient experienced recurrent renal cyst infection, with aggravated weakness during each event. Electromyography and nerve conduction study revealed bilateral femoral neuropathy. Computed tomography and magnetic resonance images were added to further identify the cause. As a result, a diagnosis of femoral neuropathy caused by enlarged polycystic kidney was made. Cyst infection was managed with antibiotics. Renal function was maintained by frequent regular hemodialysis. While avoiding activities that may increase abdominal pressure, rehabilitation exercises were provided. Motor strength in hip flexion and knee extension improved, and was confirmed via electrodiagnostic studies.
Anti-Bacterial Agents ; Diagnosis ; Electromyography ; Exercise ; Female ; Femoral Neuropathy* ; Hematoma ; Hemorrhage ; Hip ; Humans ; Knee ; Lower Extremity ; Middle Aged ; Muscle Weakness ; Neural Conduction ; Polycystic Kidney Diseases ; Polycystic Kidney, Autosomal Dominant* ; Rehabilitation ; Renal Dialysis

ObjectiveAutosomal dominant polycystic kidney disease (ADPKD) is one of the most common genetic renal diseases, which may cause oligoasthenospermia and azoospermia and result in male infertility. This study aimed to analyze the outcomes of preimplantation genetic diagnosis (PGD) in male patients with ADPKD-induced infertility.

METHODSWe retrospectively analyzed the clinical data on 7 male patients with ADPKD-induced infertility undergoing PGD from April 2015 to February 2017, including 6 cases of oligoasthenospermia and 1 case of obstructive azoospermia, all with the PKD1 gene heterozygous mutations. Following intracytoplasmic sperm injection (ICSI), we performed blastomere biopsy after 5 or 6 days of embryo culture and subjected the blastomeres to Sureplex whole-genome amplification, followed by haplotype linkage analysis, Sanger sequencing, array-based comparative genomic hybridization to assess the chromosomal ploidy of the unaffected embryos, and identification of the unaffected euploid embryos for transfer.

RESULTSOne PGD cycle was completed for each of the 7 patients. Totally, 26 blastocysts were developed, of which 12 were unaffected and diploid. Clinical pregnancies were achieved in 6 cases following 7 cycles of frozen embryo transplantation, which included 5 live births and 1 spontaneous abortion.

CONCLUSIONSFor males with ADPKD-induced infertility, PGD may contribute to high rates of clinical pregnancy and live birth and prevent ADPKD in the offspring as well. This finding is also meaningful for the ADPKD patients with normal fertility.

Abortion, Spontaneous ; genetics ; Biopsy ; Blastocyst ; Comparative Genomic Hybridization ; Embryo Transfer ; Female ; Humans ; Infertility, Male ; etiology ; genetics ; Male ; Mutation ; Polycystic Kidney, Autosomal Dominant ; complications ; diagnosis ; genetics ; prevention & control ; Pregnancy ; Pregnancy Outcome ; Preimplantation Diagnosis ; Retrospective Studies ; Sperm Injections, Intracytoplasmic

Autosomal dominant polycystic kidney disease (ADPKD) is the most common inherited renal disease. Hypertension is common and occurs before decline in renal function. However, the coexistence of hypertension and hypokalemia is rare in ADPKD patients. We report on a 32-year-old woman with secondary aldosteronism. Magnetic resonance imaging of the renal arteries revealed multiple cysts of varying sizes in both the kidneys and the liver, compatible with ADPKD. Increased reninangiotensin-aldosterone system activity was secondary to cyst expansion. After initiation of angiotensin II receptor blocker, her blood pressure was controlled without additional requirement of potassium.
Adult ; Angiotensin Receptor Antagonists ; Blood Pressure ; Diagnosis* ; Female ; Humans ; Hyperaldosteronism ; Hypertension* ; Hypokalemia ; Kidney ; Liver ; Magnetic Resonance Imaging ; Polycystic Kidney, Autosomal Dominant* ; Potassium ; Receptors, Angiotensin ; Renal Artery

BACKGROUND: Autosomal dominant polycystic kidney disease (ADPKD) is the most common genetic renal disorder caused by mutation in 2 genes PKD1 and PKD2. Thus far, no mutation is identified in approximately 10% of ADPKD families, which can suggest further locus heterogeneity. Owing to the complexity of direct mutation detection, linkage analysis can initially identify the responsible gene in appropriate affected families. Here, we evaluated an Iranian ADPKD family apparently unlinked to both PKD1 and PKD2 genes. This is one of the pioneer studies in genetic analysis of ADPKD in Iranian population. METHODS: Linkage reanalysis was performed by regenotyping of flanking microsatellite markers in 8 individuals of the ADPKD family. Direct mutation analysis was performed by Sanger sequencing. RESULTS: Mutation analysis revealed a pathogenic mutation (c.1094+1G>A) in the PKD2 gene in the proband. Analyzing 2 healthy and 4 clinically affected members confirmed the correct segregation of the mutation within the family and also ruled out the disease in 1 suspected individual. Misinterpretation of the linkage data was due to the occurrence of 1 crossing over between the PKD2 intragenic and the nearest downstream marker (D4S2929). Homozygosity of upstream markers caused the recombination indistinguishable. CONCLUSION: Although analysis of additive informative polymorphic markers can overcome the misleading haplotype data, it is limited because of the lack of other highly polymorphic microsatellite markers closer to the gene. Direct mutation screening can identify the causative mutation in the apparently unlinked pedigree; moreover, it is the only approach to achieve the confirmed diagnosis in individuals with equivocal imaging results.
Crossing Over, Genetic ; Diagnosis ; Haplotypes ; Humans ; Mass Screening ; Microsatellite Repeats ; Pedigree ; Polycystic Kidney, Autosomal Dominant* ; Population Characteristics ; Recombination, Genetic

No abstract available.
Diagnosis* ; Polycystic Kidney, Autosomal Dominant*

Recent advances in dialysis and a multidisciplinary approach to pregnant patients with advanced chronic kidney disease provide a better outcome. A 38-yr-old female with autosomal dominant polycystic kidney disease (ADPKD) became pregnant. She was undergoing hemodialysis (HD) and her kidneys were massively enlarged, posing a risk of intrauterine fetal growth restriction. By means of intensive HD and optimal management of anemia, pregnancy was successfully maintained until vaginal delivery at 34.5 weeks of gestation. We discuss the special considerations involved in managing our patient with regard to the underlying ADPKD and its influence on pregnancy.
Adult ; Female ; Fetal Growth Retardation/etiology ; Humans ; Kidney Failure, Chronic/therapy ; Polycystic Kidney, Autosomal Dominant/*diagnosis ; Pregnancy ; Renal Dialysis ; Risk Factors ; Tomography, X-Ray Computed

Posttransplant lymphoproliferative disorder (PTLD) is a life-threatening complication from organ transplantation. PTLD usually manifests as a mass in the lymph node or an extranodal mass in solid organs, such as the liver, transplanted kidney, tonsil, bone marrow, or spleen. PTLD rarely involves the central nervous system (CNS); however, here we report a case of PTLD that manifested as a brain tumor after kidney transplantation. A 52-year-old man who started peritoneal dialysis due to autosomal dominant polycystic kidney disease, underwent kidney transplantation 4 years ago. After kidney transplantation, he took tacrolimus, mycophenolate mofetil, and steroids. He was admitted to our hospital, complaining of a severe headache. Brain magnetic resonance imaging showed a multifocal, irregular, and round enhancing mass in the left basal ganglia. He underwent a needle biopsy for the enhancing mass and the pathological diagnosis was diffuse large B cell lymphoma. After this mass was confirmed as PTLD by histologic diagnosis, the patient had a reduction in his immunosuppression regimen (including a change from tacrolimus to sirolimus) and was treated with chemotherapy for PTLD. After 20 days, the patient expired from sepsis. PTLD involving the CNS is a rare and serious complication associated with solid organ transplantation. PTLD should be included in the differential diagnosis of brain tumors in recipients of solid organ transplants.
Basal Ganglia ; Biopsy, Needle ; Bone Marrow ; Brain ; Brain Neoplasms ; Central Nervous System ; Diagnosis, Differential ; Headache ; Humans ; Immunosuppression ; Kidney ; Kidney Transplantation ; Liver ; Lymph Nodes ; Lymphoma, B-Cell ; Lymphoproliferative Disorders ; Magnetic Resonance Imaging ; Mycophenolic Acid ; Organ Transplantation ; Palatine Tonsil ; Peritoneal Dialysis ; Polycystic Kidney, Autosomal Dominant ; Sepsis ; Spleen ; Steroids ; Tacrolimus ; Transplants

Adolescent ; Child ; Child, Preschool ; DNA Mutational Analysis ; Diagnosis, Differential ; Humans ; Infant ; Infant, Newborn ; Liver Diseases ; diagnosis ; genetics ; pathology ; Lung Diseases ; diagnosis ; genetics ; pathology ; Magnetic Resonance Imaging ; Mutation ; Polycystic Kidney, Autosomal Dominant ; diagnosis ; genetics ; pathology ; Polycystic Kidney, Autosomal Recessive ; diagnosis ; genetics ; pathology ; Prenatal Diagnosis ; Receptors, Cell Surface ; genetics ; Tomography, X-Ray Computed