Schimke immuno-osseous dysplasia (SIOD)caused by SMARCAL1 gene mutations is a rare genetic disorder characterized by multi-system involvement, including T-cell dysfunction, skeletal dysplasia, disproportionate short stature, nephrotic syndrome, and kidney failure. This multidisciplinary consultation involved a 9-year-old boy with intrauterine growth retardation, presenting with short stature, T-cell lymphopenia, proteinuria, and degenerative bone and joint disease. Treatment primarily focused on symptomatic and supportive care. Through the multidisciplinary rare disease consultation, holistic support was provided to the patient, offering comprehensive care from various specialtiesx.We also aim to use this case report to enhance clinicians′ under-standing of SIOD and improve the management and treatment of rare diseases.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

Objective:To summarize the clinical phenotype and genetic characteristics of deficiency in ELF4 gene X-linked (DEX).Methods:A case series study was conducted to retrospectively analyze the clinical data and genetic testing results of 2 cases of DEX treated at Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and the First Hospital of Jilin University from January 2023 to April 2024. And literature up to April 2024 was searched from the PubMed database, as well as CNKI and Wanfang databases, using keywords such as "ELF4 deficiency" "deficiency in ELF4, X-linked""ELF4 gene". The main clinical manifestations and genotypes of DEX were summarized.Results:Both patients were male, with onset ages of 3 months and 3 years, respectively. Both patients presented with recurrent oral ulcers and abdominal pain. And the laboratory examination showed a significant increase in inflammatory markers. Intestinal examinations showed multiple intestinal ulcers, and both patients developed intestinal fistulas. Whole exome sequencing found ELF4 c.799C>T, p Arg267Trp and ELF4 c. 248-7G>A, both maternal variants. Based on clinical and genetic results, DEX were diagnosed. In terms of treatment, both patients underwent surgical treatment during the acute phase of the disease and received anti-tumor necrosis factor α therapy, but recurrent gastrointestinal symptoms were still observed in Patient 1, while the clinical effect in Patient 2 was still acceptable. However, the inflammatory markers in both patients were not normal even after treatment. Literature review found 18 patients including 2 patients in this study, reported in 5 English articles and no Chinese reports. Thirteen patients had disease onset age before 5. The main clinical manifestations were fever (12/17), oral ulcers (14/18), abdominal pain (8/18), diarrhea (6/18), perianal ulcers (5/17), ileum ulcers (6/16), colon ulcers (7/16), skin involvement (7/17) and recurrent infections (7/18); laboratory examinations found increased erythrocyte sedimentation rate (13/15) as well as C-reactive protein (9/9), and anemia (13/15); in terms of immunological function, there is a decrease in natural killer cells (9/15) as well as a decrease in class switching memory B cells (8/9). The main types of gene variantions were missense variantions (6/18), nonsense variantions (4/18) or frameshift variantions (3/18).Conclusions:DEX should be considered when an early-onset male patient manifested with recurrent fever, oral ulcers or mucosal ulcers, with elevated inflammatory markers, with or without recurrent infection. It is recommended to perform lymphocyte subsets analysis, gastrointestinal endoscopy and genetic testing to support the diagnosis.

Objective:To provide reference for establishing the testing method for quality control of neutron beam in boron neutron capture therapy (BNCT) equipment in China by testing the radiation characteristic parameters and dosimetry characteristic parameters of epithermal neutron beam in hospital neutron irradiator (IHNI).Methods:By comparing the uncertainties in the result of various test items with the deviation values recommended by the European Joint Research Center (EC-JRC), the feasibility of the relevant of testing method was analyzed and evaluated.Results:The uncertainty in epithermal neutron fluence rate was 2.7%. The uncertainty in ratio of thermal to epithermal neutron fluence rate was 3.1%. The uncertainty in ratio of fast neutron air kerma to epithermal neutron fluence rate was 9.3%. The uncertainty in ratio of gamma air kerma to epithermal neutron fluence rate was 8.7%. The uncertainty in spatial distribution of neutron fluence rate was 2.7%. The uncertainty in thermal neutron fluence rate in phantom was 1.8%. The uncertainty in neutron and gamma-ray dose rate in phantom was 17.1% and 4.0%, respectively.Conclusions:The uncertainty in neutron dose rate measurement result in phantom is higher, and further research is needed to improve the accuracy of the testing method. The uncertainty in the measurement result of other test items is lower, and the accuracy of the test result is expected to meet the allowable deviation value recommended by the European Joint Research Center, and the test method is feasible.

Objective:To establish the detection method for the interferon stimulated genes(ISGs), calculate the cut-off value and test it in clinical practice.Methods:Patients with type I interferonopathies who were admitted to Peking Union Medical College Hospital from November 2017 to September 2021 were chosen as the disease group, and healthy children were included as the control group. A total of 18 children were in the disease group, including 8 males and 10 females, with a median age of 8.5 years for the first test. From them 25 blood specimens were collected. A total of 28 healthy children, aged 1 to 18 years, with a median age of 10.5 years, including 15 males and 13 females, were included in the control group. Blood samples of 34 controls and 18 interferonopathies patients were collected, then total RNA extraction and cDNA synthesis were performed. Real-time quantitative polymerase chain reaction assays were run in duplicate to measure the expression of six ISGs: interferon induced protein with tetratricopeptide repeats 1 (IFIT1), interferon α inducible protein 27 (IFI27), interferon induced protein 44 like (IFI44L), interferon stimulated genes 15 (ISG15), sialic acid binding Ig like lectin 1 (SIGLEC1), and radical S-adenosyl methionine domain containing 2 (RSAD2). The relative abundances of each target transcript was normalized to the expression level of β-Actin and OAZ. The median fold change of the six ISGs was used to create an interferon score (IS) for each individual. Samples with abnormal expressions were removed and the cDNA mix of the remaining samples was used as a calibrator to calculate the IS. We define an abnormal IS as being greater than+2 standard deviations above the mean of controls. Differences in IS between groups were compared using t-test or Mann-Whitney U-test. Results:The mean IS of controls was 1.046, standard 0.755, and the cut-off value was 2.556. A total of 25 samples from 18 interferonopathies patients were tested. The mean value was 27.010 with a 15/18 abnormality rate. Compared with the control group, IS in patients was significantly higher, t=4.247( P=0.000 1). The accuracy, precision, sensitivity, and specificity were 91.30% (42/46), 7.47%(0.084/1.124), 15/18, and 96.43% (27/28), respectively. Conclusion:This study provides a new and reliable method for clinical screening and dynamic monitoring of type Ⅰ interferonopathies by detecting ISGs expression and creating an IS.

A 15-year-old female was referred to the hospital with intermittent fever, where multiple systemic abnormalities were found, such as splenomegaly, secondary hypersplenism, retinitis pigmentosa, and ectodermal dysplasia. Medical history revealed that she had suffered recurrent respiratory infections, blurred vision at night, and dysplasia of teeth and nail beds since childhood. Then she was suspected to be experiencing ROSAH syndrome, a rare disease newly recognized in recent years, which was finally confirmed by gene sequencing results. During a course of treatment with tumor necrosis factor inhibitors, recurrent fever with elevated inflammatory markers reappeared, and the child developed headaches. To guide the comprehensive treatment and improve the patient's quality of life, the multidisciplinary team in Peking Union Medical College Hospital discussed together and directed the following treatment.

Objective:To enhance the early recognition of Prader-Willi syndrome by summarizing the clinical characteristics of Prader-Willi syndrome (PWS) during perinatal period.Methods:Through a nationwide cross-sectional study in the Department of Pediatrics, Peking Union Medical College Hospital, Peking Union Medical College, Chinese Academy of Medical Sciences,226 children diagnosed as PWS by molecular genetics were recruited from September 2019 to March 2020. Clinical data including fetuses Age, birth weight, fetal movement, fetal position, amniotic fluid, mode of bith, crying, muscle tension, feeding, and cryptorchidism were collected to analyze the clinical characteristics of Chinese PWS patients in the perinatal period, and according to the mode of birty, birth weight and genotypes to perform subgroup analysis. The clinical manifestations of different subtypes were statistically analyzed by t test, χ 2 test or Mann-Whitney U test. Results:Among the 226 PWS patients, 120 were males, and 106 were females. Among them, 100 (44.2%) patients were small for gestational age. Decreased fetal movement was the most common manifestation 202 cases (89.4%) during pregnancy, and other manifestations included polyhydramnios 71 cases (31.4%) and abnormal fetal position 58 cases (25.7%). One hundred and eighty-five (81.9%) patients were delivered by cesarean section and the frequency of abnormal fetal position was significantly higher (30.8%(57/185) vs. 2.4%(1/41),χ2=14.161, P<0.01). As for abnormal manifestations after birth included hypotonia 221 cases (97.8%),220 cases (97.3%) showing weak crying, 116 cases among the total 120 males patients (96.7%) wanifested with cryptordnildism and 206 feeding difficulties (91.2%). In terms of genetic subtype, most of them (184/226, 81.4%) had a paternal deletion, while maternal age (35±5 vs. 29±5, t=-6.591, P<0.01) and the frequency of polyhydramnios (47.6% (20/42) vs. 27.7% (51/185), χ2=6.286, P=0.012) were significantly higher in the non-deletion group. Conclusions:The main manifestations of PWS patients during the perinatal period are hypotonia, weak crying, feeding difficulties, decreased fetal movement, cryptorchidism and those patients are more likely to be born by cesarean section. In newborns with these characteristics, pediatricians should be aware of the possibility of PWS. In terms of the relationship between genotypes and phenotypes, polyhydramnios is more frequently observed in the non-deletion group.

Objective:To summarize the clinical characteristics of type I interferonopathies and provide clues for early identification and diagnosis.Methods:Clinical data of 20 patients admitted to Department of Pediatrics, Peking Union Medical College Hospital and 5 patients admitted to Department of Rheumatology and Immunology, Shenzhen Children′s Hospital from January 2016 to September 2021 were retrospectively analyzed. The data included gene results, clinical manifestations and auxiliary examination results.Results:Of the 25 cases, 12 were males and 13 were females. Age of onset ranged from 1 day to 11 years. And 84% of them had the onset before the age of 3 years. The cases consisted of 14 cases of Aicardi-Goutières syndrome (AGS), 6 cases of adenosine deaminase 2 deficiency (DADA2), 3 cases of stimulator of interferon genes (STING)-associated vasculopathy with onset in infancy (SAVI), and 2 cases of Spondyloenchondrodysplasia with immune dysregulation (SPENCDI). Eighteen patients (72%) experienced neurologic disorder, among whom 16 (64%) showed intracranial calcification, 11 (44%) had dystonia, 10 (40%) had leukodystrophy, 6 (24%) had epilepsy, 5 (20%) had brain atrophy and 5 (20%) had early-onset cerebrovascular events. Skin involvement occurred in 15 cases (60%), among whom 8 cases (32%) had chilblain-like rash, 4 cases (16%) had livedo reticularis, 3 cases (12%) had erythema, 2 cases (8%) had erythema nodosum and 2 cases (8%) had Raynaud′s phenomenon. In addition, 12 cases (48%) had positive autoimmune antibodies, 10 cases (40%) manifested as developmental retardation, 8 cases (32%) experienced lung interstitial lesions, and 7 cases (28%) demonstrated thyroid dysfunction. And 1 died (4%) at 11 years of age.Conclusions:Type Ⅰinterferonopathies can involve multiple organs, and share the characteristics of systemic inflammatory and autoimmune diseases. The early-onset neurological symptoms (early-onset cerebrovascular events, intracranial calcification, leukodystrophy and cerebral atrophy), rashes (chilblain-like rash, livedo reticularis and erythema), positive autoimmune antibodies, developmental delay, interstitial lung disease and thyroid dysfunction may indicate type Ⅰ interferonopathies.

The clinical laboratory department practice in hospital is very important in the teaching process of medical laboratory science and medical laboratory technology science .It is the transition link of guiding the students to go to the clinical job .This paper analyzes the problems and challenges in the process of clinical teaching and management of the trainees majored in medical laboratory science and medical laboratory technology science .Then summarizes the countermeasures to effectively cultivate these trainees , including setting up a teaching group , doing the overall quality control for the process of practice teaching using ISO15189 quality control methods for reference , establishing the evaluation mechanism for both trainees and tutors , founding virtual laboratory to improve the teaching effect of morphology , strengthening the consciousness of quality control , expanding the professional vision of interns and strengthening the cultivation of the scientific research ability of interns .

Objective To summarize the clinical characteristics and treatment efficacy of the first reported case of a Chinese boy with stimulator of interferon genes (STING) associated vasculopathy with onset in infancy (SAVI).Methods Sanger sequencing of the gene TMEM173 was performed based on systemic evaluation and clinical analysis of a highly suspected SAVI child admitted to Peking Union Medical College Hospital.A literature search (search terms included'STING''SAVI''autoinflammatory diseases' and'interferonopathy') was conducted using Chinese literature database,EMBASE and PubMed to include recently published SAVI studies (searched from January 2010 to December 2017).Results A 14-year-old boy who had a history of chronic dry cough along with decreased activity tolerance after birth presented with growth retardation,chilblain lesions on the ear,telangiectasia of multiple skin areas and long clubbed fingers.His C-reactive protein was 21 mg/L,erythrocyte sedimentation rate was 78 mm/1h,and IgG was 22.16 g/L.The high-resolution computed tomography (HRCT) revealed interstitial lung diseases and echocardiography showed pulmonary artery hypertension,with a level of 61 mmHg (1 mmHg=0.133 kPa).Genetic mutation of TMEM173 (c.463G＞A,p.V155M) was confirmed by Sanger sequencing.His activity tolerance increased to some extent after treatment with tofacitinib at a dose of 5 mg twice a day.Our review yielded 8 publications (8 English and 0 Chinese).To date 20 cases have been reported worldwide,who mostly presented with skin and lung involvement as well as growth retardation.Conclusions SAVI has been included within the spectrum of interferonopathy,which is a kind of autoinflammatory diseases as well.Typical clinical features include chilblain skin lesions,interstitial lung disease,growth retardation,elevated IgG levels,and increased inflammation markers.Janus kinase (JAK) inhibitors may offer benefit for SAVI patients.