Neurofibromatosis type 1 (NF1) presents with a diverse range of symptoms that can affect the skin, bones, eyes, central nervous system, and other organs. This article reports the diagnosis and treatment process of a patient with NF1 complicated by bilateral severe-to-profound sensorineural hearing loss. Genetic testing revealed a heterozygous variant of NF1 NM_ 000267.3: c.4054_ 4058del(p.Ser1352LeufsTer20, supporting the diagnosis of NF1. After thorough evaluation, a right cochlear implantation was performed, yielding satisfactory postoperative results. This case suggests that NF1 patients may exhibit phenotypic heterogeneity and atypicality, providing a reference for clinicians in the diagnosis and treatment of such patients.

Objective　: To verify the feasibility of using a homemade lung phantom for quality control of Cyberknife by comparing the measurement results of the homemade lung phantom and CIRS dynamic phantom in E2E testing of Cyberknife lung tracking.  Methods　 : The patient treatment process was simulated, including CT positioning, plan design, irra- diation implementation, film scanning, and analysis using the homemade phantom and CIRS phantom. The two phantoms were measured five times using MLC under the S7 generation Cyberknife and five times using Iris under the M6 generation Cyberknife. The differences in measurement results between the two phantoms were analyzed using independent sample t-test. Results　: For the S7 generation Cyberknife, the statistical analysis of differences between the two phantoms in the detection values on the X-axis, Y-axis, Z-axis, and total deviation showed P values of 0.236, 0.175, 0.289, and 0.668, respect- ively. For the M6 generation Cyberknife, the statistical analysis showed P values of 0.880, 0.891, 0.573, and 0.433, respect- ively. The P values were all > 0.05. Therefore, there were no statistically significant differences in the detection results between the homemade lung phantom and the CIRS phantom under the S7 and M6 generation Cyberknife. The total deviation values were <1.5 mm. Conclusion　 The homemade lung phantom and CIRS phantom have consistent measurement results in the E2E testing of Cyberknife lung tracking and meet the requirements of Report of AAPM TG-135 and WS 667- 2019 standard. Therefore, the homemade lung phantom is feasible for clinical quality control of Cyberknife.

Schimke immuno-osseous dysplasia (SIOD)caused by SMARCAL1 gene mutations is a rare genetic disorder characterized by multi-system involvement, including T-cell dysfunction, skeletal dysplasia, disproportionate short stature, nephrotic syndrome, and kidney failure. This multidisciplinary consultation involved a 9-year-old boy with intrauterine growth retardation, presenting with short stature, T-cell lymphopenia, proteinuria, and degenerative bone and joint disease. Treatment primarily focused on symptomatic and supportive care. Through the multidisciplinary rare disease consultation, holistic support was provided to the patient, offering comprehensive care from various specialtiesx.We also aim to use this case report to enhance clinicians′ under-standing of SIOD and improve the management and treatment of rare diseases.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

Glycogen storage diseases (GSDs)refer to a group of metabolic disorders caused by congenital enzyme deficiencies. This group of diseases are characterized by abnormal glycogen metabolism. Most subtypes can lead to increased glycogen accumulation in tissues of the liver, muscles, kidneys etc. GSD type Ⅰ (GSDⅠ) is the most common type of the liver glycogen storage diseases that are caused by a deficiency in glucose-6-phosphatase in the liver, kidneys, and intestines. This typle has two subtypes: type Ⅰa and type Ⅰb(GSDⅠb). Recently, research into the molecular mechanisms of GSD Ⅰb made further progress, leading to significant improvements in clinical diagnosis and the new treatment methods based on the pathogenesis. This article summarizes the current research status of diagnosis and screening, molecular genetic mechanisms, and treatment of GSD Ⅰb. The article also points out the opportunities, the challenges and future possibilities.

Objective To establish testing and evaluation methods for radiation shielding performance of a self-shielded radiotherapy system by measuring the radiation levels around the self-shielded head and neck radiotherapy system. Methods A total of 14 monitoring points were selected outside the restricted zone of the system. Under radiation conditions from five different fixed directions, an ion chamber survey meter was used to measure and identify the maximum ambient dose equivalent rate at the 14 points. The time-averaged dose rate was then calculated based on the workload. In accordance with relevant radiation protection standards, an instantaneous dose rate of 10 μSv/h and a time-averaged dose rate of 2.0 μSv/h were proposed as the criteria for shielding protection evaluation. Results Based on the ambient dose equivalent rates at the 14 monitoring points outside the restricted zone, the maximum instantaneous dose rate outside the restricted zone was 7.4 μSv/h. With a workload of 15 patients per day, the maximum time-averaged dose rate was 1.0 μSv/h, which can be used as the criteria for shielding protection evaluation. Conclusion By considering both instantaneous dose rate and time-averaged dose rate, a comprehensive safety assessment of the radiation shielding performance of a self-shielded radiotherapy system can be conducted.

Prader-Willi syndrome(PWS)is a genetically imprinted disorder characterized by intellec-tual impairment,obesity,metabolic disorders,and behavioral abnormalities.The pathological mechanisms of metabolic disorders and behavioral abnormalities are not yet clear,and the treatment effect up to now is not satisfactory.In recent years,the role of gut microbiota in metabolic regulation has gradually been recognized.This article will systematically review the research progress of gut microbiota in PWS.Compared to healthy in-dividuals or other simply obese individuals.PWS patients show changes in the gut microbiota.The changes are related to metabolic disorders and inflammatory status in PWS patients.Intervention of gut microbiota through diet or probiotics has played a certain role in controlling weight and improving behavioral abnormalities in PWS patients.

Glycogen storage disease type Ⅰb（GSD Ⅰb）is an autosomal recessive genetic disease characterized by abnormal glycogen metabolism.The clinical manifestations include signs of metabolic abnormality of the typical GSD I，and the patients with GSD Ⅰb also have neutropenia and symptoms including recurrent infection，oral and intestinal mucosal ulcers，inflammatory bowel diseases and autoimmune thyroiditis.However，the detailed mechanism of GSD Ⅰb has not been clarified.Treatment with sodium-dependent glucose transporters 2（SGLT2）inhibitors improves both neutropenia and neutrophil function through reducing 1，5-anhydroglucitol（1，5-AG）in plasma，as well as alleviates the related clinical symptoms，so SGLT2 inhibitors are increasingly used in the treatment of GSD Ⅰb.Here it reviews the neutropenia mechanism and recent advances in animal-based research and clinical application of SGLT2 inhibitor therapy for GSD Ⅰb.

Objective To investigate the clinical characteristics of the hepatolenticular degeneration in children,and to clarify the significance of gene diagnosis in children with hepatolenticular degeneration.Methods A total of 75 patients with hepatolenticular degeneration were enrolled in the Department of Pediatrics,Peking Union Medical College Hospital from 2011 to 2018.All of them carried out a generation of gene sequencing for ATPase Cu2+trans-porting beta polypeptide(ATP7B)gene and multiplex ligation-dependent probe amplification(MLPA)analysis.Results Among the 75 pediatric patients,55 patients were asymptomatic and had elevated aminotransferases as the incidental findings.All the pediatric patients had decreased ceruloplasmin.Seventy-two of pediatric patients had 24-hour urinary copper＞40 μg/d.There were 16 cases that had Kayser-Fleischer(K-F)rings.Sixteen six out of 75(21.33%)cases were diagnosed clinically and 15 cases were＞7 years old.All the remaining patients needed genetic diagnosis.Sixty-six patients had two mutations and 9 patients had only one mutation,1 had no mutation.Forty eight different mutations were found to be localized in ATP7B gene.These mutations included 32 missense mutations,6 splice mutations,5 deletion mutations,2 repeated mutations,2 insert mutations and 1 nonsense muta-tions.The most frequently three mutations were c.2333G＞T,p.R778L,c.2621C＞T,p.A874V,c.2975C＞T,p.P992L,whose allele frequencies were 30.49%,14.89%,9.92%.Conclusions The research showed that in young aged patients,the nervous system symptoms are not obvious and the positive rate of laboratory tests are lower than adults so is a challenge to clinical diagnosis.So Genetic testing is of great significance for the early diagnosis and early treatment of disease in pediatric patients.

Objective:To investigate the safety, efficacy and effective dose of empagliflozin in the treatment of glycogen storage disease type Ⅰb (GSD Ⅰb).Method:This was a cross sectional study. A total of 28 children with GSDⅠb who started oral empagliflozin treatment from January 2021 to June 2023 in the WeChat group of patients with glycogen storage disease were selected as the study objects. Clinical data such as general situation, current situation of medication and adverse reactions of the children were collected through questionnaires from June 18 to 30, 2023. The differences of symptoms and laboratory tests before and after empagliflozin treatment were compared by using paired chi-square test and Wilcoxon signed rank sum test.Results:Totally 28 children with GSD Ⅰb were from 12 different provinces, autonomous regions and municipalities in China. There were 14 males and 14 females. Empagliflozin treatment was started at the age of 4.8 (2.4, 10.8) years, the time of treatment was 14.5 (11.3, 21.5) months, the initial dosage was (0.23±0.11) mg/(kg·d), and the maintenance dosage was (0.28±0.12) mg/(kg·d). Empagliflozin showed positive effects on neutropenia, severity of inflammatory bowel disease like symptoms( Z=-3.70 , -2.65, both P<0.05), The proportion of recurrent oral ulcers, recurrent bacterial infections and anemia was significantly lower than that before medication (18% (5/28) vs. 46% (13/28), 14% (4/28) vs. 46% (13/28), 21% (6/28) vs. 46% (13/28), χ2=4.05, 5.26, 3.05 , all P<0.05). Granulocyte colony-stimulating factor (GCSF) was once used in 5 children with GSD Ⅰb, all of them had completely stopped GCSF after empagliflozin treatment. The most common adverse events during empagliflozin treatment were hypoglycemia (5 children) and urinary infection (3 children). All 28 patients had no serious adverse reactions. Conclusions:Empagliflozin can increase the neutrophil count of children with GSD Ⅰb, and had a favorable effect on symptoms such as recurrent oral ulcers, and recurrent infection. The common adverse events during empagliflozin treatment were hypoglycemia and urinary infection.