[Objective] To explore the predictive value of HALP score for prognosis in patients with multiple myeloma (MM). [Methods] A retrospective analysis was conducted on laboratory indicators and related clinical data of newly diagnosed multiple myeloma (NDMM) patients, treated at the Affiliated Hospital of North Sichuan Medical College from January 2016 to October 2023, prior to their first treatment. The HALP score was calculated, and the optimal cutoff value for HALP was determined using X-tile software. Survival analysis was performed using Kaplan-Meier curves for high HALP and low HALP groups. Univariate and multivariate analyses were conducted using the Cox regression model, and a forest plot was generated using Graphpad Prism to illustrate factors that may impact patient prognosis. The predictive ability of HALP score combined with β2-microglobulin and ECOG score for prognosis in MM patients was evaluated using receiver operating characteristic curve (ROC) analysis. [Results] A total of 203 MM patients were included, with the optimal cutoff value for HALP score being 29.15 (P<0.05). Among them, 101 patients were in the low HALP score group, and 102 patients were in the high HALP score group. The results of univariate and multivariate analysis using the Cox regression model showed that a HALP score <29.15 was an independent risk factor for progression-free survival (PFS) and overall survival (OS) (P<0.05). ROC curve analysis indicated that the combination of HALP score with β2-microglobulin and ECOG score had a higher predictive value for prognosis in MM patients compared to using HALP score alone. [Conclusion] The HALP score is closely related to the prognosis of patients with NDMM. A low HALP score indicates a poorer prognosis, while the combination of HALP score with β2-microglobulin and ECOG score provides a higher predictive value when assessed together.

Objective By organizing and implementing a laboratory proficiency validation plan for air change rate testing, this study aims to explore proficiency testing approaches in laboratory animal facilities, assess the current status of relevant laboratories regarding standard application and test capabilities, standardize air change rate testing methods, and ensure the accuracy and reliability of test results. Methods From September to November 2023, the National Institutes for Food and Drug Control (NIFDC) organized a laboratory proficiency validation plan for air change rate testing in laboratory animal facilities (Plan Number: NIFDC-PT-417). The proficiency testing was conducted on-site and consisted of two parts: a written test and practical operation. The written test was open-book. True/false questions focused on participants' understanding of specific clauses in relevant standards, while application-based questions assessed their ability to handle data processing in simulated testing scenarios. The practical operation was conducted according to the relevant criteria of the China National Accreditation Service for Conformity Assessment (CNAS). Two laboratory animal rooms were prepared as proficiency testing samples using a sample splitting approach. These rooms underwent uniformity and stability testing according to CNAS requirements and were approved. Participating laboratories were required to conduct three tests on each of the two laboratory animal rooms, complete the testing and calculation of air change rate within the specified timeframe, and submit their test result reports and original records. Results A total of 27 laboratories registered and participated in the proficiency testing. All participating laboratories submitted their results within the designated timeframe, and the outcomes of all tested laboratories were rated as satisfactory. Conclusion This proficiency validation program objectively and scientifically evaluates the air change rate testing capabilities of selected domestic laboratories, effectively promoting the overall improvement of testing capabilities in the industry. It provides technical support for regulatory authorities to standardize testing institutions and offers reliable references for the purchase of testing services. Through this activity, it was identified that some laboratories need to further enhance their calibration of instruments and the utilization of calibration results. Future efforts should focus on refining related standards to improve the accuracy and reliability of testing.

Objective: To explore the effects of Cldn14 gene knockout on renal metabolism and stone formation in rats，so as to provide reference for research in the field of urinary calium metabolism and stone formation. Methods: Cldn14 gene knockout homozygous rats and wild-type rats of the same age were randomly divided into 4 groups：wild-type control (WC) group，wild-type ethylene glycol (WE) group，gene knockout control (KC) group and gene knockout ethylene glycol (KE) group，with 10 rats in each group.The WE and KE groups were induced with ethylene glycol + ammonium chloride to form kidney stones，while the WC and KC groups received normal saline gavage.After 4 weeks of standard maintenance feeding，the urine samples were collected to detect the venous blood.The kidneys were collected for HE，Pizzolatto's staining and transmission electron microscopy.The protein in renal tissues was extracted to detect the expressions of Claudin16 and Claudin19. Results: Crystal deposition was observed in the renal tubular lumen of the WE and the KE groups，and more crystals were detected in the KE group.The WE group had a large number of intracytoplasmic black crystalline inclusions observed in renal tubular epithelial cells under transmission electron microscope，followed by the KE and KC groups.Compared with WC and WE groups，KC and KE groups had significantly decreased serum calcium and magnesium levels but significantly increased urinary calcium level.In addition，the urinary calcium level was higher in the WE group than in the WC group and higher in the KE group than in the KC group.The KE group had lower level of Claudin16，but there was no significant difference in the level of Claudin19 among the 4 groups(P>0.05). Conclusion: Knockout of Cldn14 gene alone cannot effectively reduce urinary calcium excretion or reduce the risk of stone formation in rats，which may be related to the decrease of Claudin16 level.

Objective To construct an in vitro"metabolic memory"cell model of HT-22 mouse hippocampal neurons induced by high glucose,and to investigate the effect of"metabolic memory"on apoptosis and histone acetylation in HT-22 cells.Methods HT-22 cells were cultured in high glucose medium(glucose concentration was 55 mmol/L)and conventional glucose medium(glucose concentration was 25 mmol/L),and cells were divided into the control group(NG 4,6 and 8 groups,25 mmol/L glucose was cultured for 4,6 and 8 days,respectively),the high glucose group(HG 4,6 and 8 groups,respectively)and the metabolic memory group(HG2NG2,HG2NG4,HG2NG6,HG4NG2 and HG4NG4 groups,high glucose culture for 2 days to 25 mmol/L glucose culture for 2,4 or 6 days,high glucose culture for 4 days to 25 mmol/L glucose culture for 2 or 4 days).Cell viability was detected by CCK-8 method.The release of lactate dehydrogenase(LDH)in cell culture supernatant was detected,and the optimal time to establish a"metabolic memory"model was selected.Subsequently,cells were divided into the NG4 group,the NG8 group,the HG4 group,the HG4NG4 group and the HG8 group,and the cell morphology of each group was observed by optical microscope.The apoptosis rate was detected by flow cytometry.The activities of deacetylase(HDAC)and histone acetyltransferase(HAT)were detected by enzyme-linked immunosorbent assay(ELISA).Western blot assay was used to detect expression levels of histone deacetylase 4(HDAC4),B lymphocyte tumor 2(Bcl-2),Bcl-2 related X protein(Bax)and Caspase-3 protein.Results The HG4NG4 group was the ideal cell model with high glucose metabolic memory.Cells of the NG4 group and the NG8 group were interwoven into a dense network,growing well,with spindle shaped cells and distinct synaptic structures.However,in the HG4 group and the HG8 group,the cell body became round,synaptic structure disappeared and growth was inhibited.In the HG4NG4 group,the number of cells increased but their morphology was damaged.Results of flow cytometry showed that compared with the NG8 group,the apoptosis rates were significantly increased in the HG8 group and the HG4NG4 group(P＜0.05).ELISA results showed that compared with the NG8 group,the expression levels of HDAC4,Bax,and Caspase-3 proteins increased in the HG8 group and the HG4NG4 group,while the expression level of Bcl-2 protein significantly decreased(P＜0.05).Compared with the HG8 group,there were no significant differences in protein expression levels of HAT and HDAC in the HG4NG4 group.Western blot reslts showed that compared with the NG8 group,the levels of HDAC4,Bax and Caspase-3 protein increased in the HG8 group and the HG4NG4 group(P＜0.05).Compared with the HG8 group,there were no significant differences in protein expression levels in the HG4NG4 group.Conclusion HT-22 mouse hippocampal neurons cultured with 55mmol/L high glucose for 4 days,and then cultured with 25 mmol/L glucose for 4 days are the ideal"metabolic memory"cell model.The mechanism may be related to the increased activity of HDAC,HAT and HDAC4 expression in the hyperglycemic model.

Objective:By analyzing the curative cost of treatment for children in Beijing,it provided recommendations for further optimizing child health management policies in Beijing.Methods:The System of Health Accounts 2011(SHA 2011)was used to calculate the CCE of children in Beijing's medical institutions.Results:The CCE of children under the age of 15 in Beijing were 92.29 billion yuan,97.54 billion yuan,and 105.72 billion yuan in 2017-2019,with an average annual growth rate of 4.67%;the financing structure of children's CCE is dominated by family health expenditure,accounting for about 65%;children's outpatient and inpatient CCE primarily flew to secondary and tertiary hospitals;respiratory diseases account for the largest share of the disease categories of the CCE,with a share of 25.96%,followed by digestive diseases with a share of 10.26%.Conclusion:The financing structure needs to be optimized to lessen the financial burden of medical care on the families of child patients;the capacity of grass-roots pediatric services should be strengthened,and reasonably guide the flow of adolescent patients to institutions;financial investment should be increased for pre-pregnancy,prenatal screening and other preventive services.It needs to give careful consideration to children's safety education and encourage the implementation of children's commercial accidental injury insurance.

Primary hypertrophic osteoarthropathy(PHO)is a rare disease also known as pachydermo-periostosis.We reported a painless case whose diagnosis was confirmed by genetic test.A 24-year-old male presented a series of symptoms that first began at 14.He suffered from progressive clubbed-fingers accompa-nied by swelling of the wrist and ankle joints.Facial skin concentric thickening and alar nose broadening ap-peared simultaneously and increased progressively.He was also prone to acne and hyperhidrosis.X-rays showed thickening of the metacarpal and phalangeal bones,as well as symmetrical periosteal ossification of both the tibia and fibula.Clinical diagnosis of PHO is difficult because of the variable features.With acromeg-aly excluded,the diagnosis was confirmed by a genetic test.Whole exome sequencing revealed a heterozygous SLCO2A1 c.611C＞T(p.Ser204Lue)and SLCO2A1 c.1602C＞A(p.Asn534Lys)mutation from each par-ent.It suggests that primary hypertrophic osteoarthropathy should be considered for young limb hypertrophic patients especially when periosteal thickening signs were showed in X-ray.A confirmatory diagnosis can be made through the genetic test.

Placental diseases may affect the outcome of pregnancy and long-term health of the mother and fetus. Fetal fraction is a key indicator for the success of non-invasive prenatal testing, and has been associated with gestational age, body mass index and fetal chromosomal aneuploidies. Many studies have found that fetal fraction is also related to placenta-derived diseases and may become a new predictor for such diseases. This article has summarized the association between the two, with an aim to provide new ideas for the prediction of placental diseases.

Objective By studying the changes in the institutional distribution of curative care expenditure(CCE)of the elderly population before and after the comprehensive reform medical-pharmaceutical separation and linkage of medical consumption,it provided data reference for the next step of accurately optimizing the elderly patients flow.Methods A multi-stage stratified whole-group sampling survey was used to select the sample.A System of Health Accounts 2011 was used to calculate the CCE of elderly patients in medical institutions.Results The CCE of medical institutions for the elderly population in Beijing increased from 60.457 billion yuan to 797.54 billion yuan,with an average annual growth rate of 6.83%,the fastest growth rate of 24.04%for community-based health treat-ment center.The percentage of CCE in the community increased from 11.31%to 17.71%,while the percentage of CCE in tertiary hospitals decreased by 4.39 percentage points.The flow of CCE for outpatient patients was obviously opti-mized.Younger elderly outpatient patients are more willing to seek treatment in the community,but the flow di-rection of outpatient treatment for elderly patients is more optimized.The CCE fpr elderly outpatient patients with chronic diseases such as endocrine,nutritional and metabolic diseases and nervous system diseases have been substantially transferred to the community-based health center.Conclusion The reform has different impacts on the treatment of elderly patients with different genders,ages and diseases.It is necessary to strengthen the service capacity building of primary medical institutions,highlight the development characteristics of secondary hospitals,and accurately improve the hierarchical diagnosis and treatment system for elderly patients.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

Objective:By analyzing the curative cost of treatment for children in Beijing,it provided recommendations for further optimizing child health management policies in Beijing.Methods:The System of Health Accounts 2011(SHA 2011)was used to calculate the CCE of children in Beijing's medical institutions.Results:The CCE of children under the age of 15 in Beijing were 92.29 billion yuan,97.54 billion yuan,and 105.72 billion yuan in 2017-2019,with an average annual growth rate of 4.67%;the financing structure of children's CCE is dominated by family health expenditure,accounting for about 65%;children's outpatient and inpatient CCE primarily flew to secondary and tertiary hospitals;respiratory diseases account for the largest share of the disease categories of the CCE,with a share of 25.96%,followed by digestive diseases with a share of 10.26%.Conclusion:The financing structure needs to be optimized to lessen the financial burden of medical care on the families of child patients;the capacity of grass-roots pediatric services should be strengthened,and reasonably guide the flow of adolescent patients to institutions;financial investment should be increased for pre-pregnancy,prenatal screening and other preventive services.It needs to give careful consideration to children's safety education and encourage the implementation of children's commercial accidental injury insurance.