1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Clinical rapid evaluation of proprotein convertase subtilisin/kexin type 9 inhibitors for hypercholesterolemia
Xin YAO ; Fengjiao KANG ; Qinan YIN ; Lizhu HAN ; Yuan BIAN
China Pharmacy 2026;37(2):149-154
OBJECTIVE To conduct a clinical rapid evaluation of the marketed proprotein convertase subtilisin/kexin type 9 (PCSK9) inhibitors in China, including evolocumab, tafolecimab, recaticimab, ebronucimab, ongericimab and inclisiran. METHODS Based on the Rapid Guide for Drug Evaluation and Selection in Chinese Medical Institutions (second edition), drug instructions, clinical diagnosis and treatment guidelines, and literature for six drugs were retrieved from CNKI, Wanfang Data, VIP, PubMed, Embase, Cochrane Library and related official websites. The clinical rapid evaluation was conducted from five aspects: pharmaceutical characteristics, effectiveness, safety, economy, and other attributes. RESULTS The pharmaceutical characteristics, effectiveness, safety, economy, other attributes, and total score of evolocumab scored 24, 27, 15.7, 10, 5.3, and 82 points, respectively. Tafolecimab scored 23.5, 23, 11.5, 9.97, 4.6, and 72.57 points, respectively. Recaticimab scored 20.5, 22, 15.5, 6.37, 3.5, and 67.87 points. Ebronucimab scored 20, 23, 11, 6.48, 3.5, and 63.98 points. Ongericimab scored 20.5, 23, 8.5, 4.83, 3.5, and 60.33 points. Inclisiran scored 25.5, 24, 13, 6.48, 5, and 73.98 points. CONCLUSIONS Evolocumab is the optimal choice for treating hypercholesterolemia and is recommended as the first-line option. Tafolecimab is the second-line option, and recaticimab is suitable for patients who are sensitive to drug adverse reactions. Inclisiran is suitable for patients with poor compliance. Ebronucimab and ongericimab are weakly recommended due to their later market introduction. Clinicians should make individualized drug selections based on factors such as patient risk level and compliance requirements.
3.Analysis and evaluation of platelet bank establishment strategy from the perspective of donor loss
Zheng LIU ; Yamin SUN ; Xin PENG ; Yiqing KANG ; Ziqing WANG ; Jintong ZHU ; Juan DU ; Jianbin LI
Chinese Journal of Blood Transfusion 2025;38(2):238-243
[Objective] To analyze the loss rate of platelet donors and evaluate the strategies for establishing a platelet donor bank. [Methods] A total of 1 443 donors who joined the HLA and HPA gene donor bank for platelets in Henan Province from 2018 to 2020 were included in this study. Data on the total number of apheresis platelet donations, annual donation frequency, age at enrollment, donation habits (including the number of platelets donated per session and whether they had previously donated whole blood), and enrollment location were collected from the platelet donor information management system. Donor loss was determined based on the date of their last donation. The loss rates of different groups under various conditions were compared to assess the enrollment strategies. [Results] By the time the platelet bank was officially operational in 2022, 421 donors had been lost, resulting in an loss rate of 29% (421/1 443). By the end of 2023, the overall cumulative loss rate reached 52% (746/1 443). The loss rate was lower than the overall level in groups meeting any of the following conditions: total apheresis platelet donations exceeding 50, annual donation frequency of 10 or more, age at enrollment of 40 years or older, donation of more than a single therapeutic dose per session, or a history of whole blood donation two or more times. Additionally, loss rates varied across different enrollment locations, with higher enrollment numbers generally associated with higher loss rates. [Conclusion] Through a comprehensive analysis of donor loss, our center has adjusted its strategies for establishing the donor pool. These findings also provide valuable insights for other blood collection and supply institutions in building platelet donor banks.
4.Bioinformatics Reveals Mechanism of Xiezhuo Jiedu Precription in Treatment of Ulcerative Colitis by Regulating Autophagy
Xin KANG ; Chaodi SUN ; Jianping LIU ; Jie REN ; Mingmin DU ; Yuan ZHAO ; Xiaomeng LANG
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(1):166-173
ObjectiveTo explore the potential mechanism of Xiezhuo Jiedu prescription in regulating autophagy in the treatment of ulcerative colitis (UC) by bioinformatics and animal experiments. MethodsThe differentially expressed genes (DEGs) in the colonic mucosal tissue of UC patients was obtained from the Gene Expression Omnibus (GEO), and those overlapped with autophagy genes were obtained as the differentially expressed autophagy-related genes (DEARGs). DEARGs were imported into Metascape and STRING, respectively, for gene ontology/Kyoto Encyclopedia of Genes and Genomics (GO/KEGG) enrichment analysis and protein-protein interaction (PPI) analysis. Finally, 15 key DEARGs were obtained. The core DEARGs were obtained by least absolute shrinkage and selection operator (LASSO) regression and receiver operating characteristic curve (ROC) analysis. The CIBERSORT deconvolution algorithm was used to analyze the immunoinfiltration of UC patients and the correlations between core DEARGs and immune cells. C57BL/6J mice were assigned into a normal group and a modeling group. The mouse model of UC was established by free drinking of 2.5% dextran sulfate sodium. The modeled mice were assigned into low-, medium-, and high-dose Xiezhuo Jiedu prescription and mesalazine groups according to the random number table method and administrated with corresponding agents by gavage for 7 days. The colonic mucosal morphology was observed by hematoxylin-eosin staining. The protein and mRNA levels of cysteinyl aspartate-specific proteinase 1 (Caspase-1), cathepsin B (CTSB), C-C motif chemokine-2 (CCL2), CXC motif receptor 4 (CXCR4), and hypoxia-inducing factor-1α (HIF-1α) in the colon tissue were determined by Western blot and real-time fluorescence quantitative polymerase chain reaction, respectively. ResultsThe dataset GSE87466 was screened from GEO and interlaced with autophagy genes. After PPI analysis, LASSO regression, and ROC analysis, the core DEARGs (Caspase-1, CCL2, CTSB, and CXCR4) were obtained. The results of immunoinfiltration analysis showed that the counts of NK cells, M0 macrophages, M1 macrophages, and dendritic cells in the colonic mucosal tissue of UC patients had significant differences, and core DEARGs had significant correlations with these immune cells. This result, combined with the prediction results of network pharmacology, suggested that the HIF-1α signaling pathway may play a key role in the regulation of UC by Xiezhuo Jiedu prescription. The animal experiments showed that Xiezhuo Jiedu prescription significantly alleviated colonic mucosal inflammation in UC mice. Compared with the normal group, the model group showed up-regulated protein and mRNA levels of caspase-1, CCL2, CTSB, CXCR4, and HIF-1α, which were down-regulated after treatment with Xiezhuo Jiedu prescription or mesalazine. ConclusionCaspase-1, CCL2, CTSB, and CXCR4 are autophagy genes that are closely related to the onset of UC. Xiezhuo Jiedu prescription can down-regulate the expression of core autophagy genes to alleviate the inflammation in the colonic mucosa of mice.
5.Mechanism of Xiezhuo Jiedu Formula in Treating Ulcerative Colitis Through Pyroptosis Regulation Based on Bioinformatics and Animal Experiments
Qiang CHUAI ; Wenjing ZHAI ; Shijie REN ; Xiaomeng LANG ; Xin KANG ; Wenli WEI ; Jingyuan LIU ; Jianping LIU ; Jie REN
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(16):105-113
ObjectiveThis study aims to explore the potential mechanism of the Xiezhuo Jiedu formula in regulating pyroptosis for the treatment of ulcerative colitis (UC) using bioinformatics and in vivo animal experiments. MethodsDifferentially expressed genes (DEGs) in colon tissues of UC patients were retrieved from the Gene Expression Omnibus (GEO) database. Pyroptosis-related genes were obtained from the GEO and GeneCards databases. The intersection of these datasets yielded pyroptosis-related DEGs (Pyro-DEGs). Pyro-DEGs were subjected to Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis using the Metascape database. A protein-protein interaction (PPI) network was constructed using the STRING database. Least absolute shrinkage and selection operator (LASSO) prediction model and receiver operating characteristic (ROC) analysis were conducted to identify core Pyro-DEGs with diagnostic and therapeutic potential. Immune infiltration analysis of the UC datasets was performed using the deconvolution method (CIBERSORT), along with correlation analysis with core Pyro-DEGs. Sixty male Sprague-Dawley (SD) rats were randomly divided into a control group, a model group, high-, medium-, and low-dose groups of Xiezhuo Jiedu formula (26.64, 13.32, 6.66 g·kg-1), and a mesalazine group (0.27 g·kg-1), with 10 rats in each group. UC was established by intrarectal administration of 3,5-trinitrobenzenesulfonic acid (TNBS) dissolved in ethanol. The control and model groups were given distilled water by gavage, while the treatment groups were administered the corresponding drugs for 7 consecutive days. Hematoxylin-eosin (HE) staining was used to observe the colon histopathology. Enzyme-linked immunosorbent assay (ELISA) was used to detect the levels of inflammatory factors such as interleukin-1β (IL-1β), IL-10, IL-18, and transforming growth factor-β (TGF-β). Immunohistochemistry (IHC) and Western blot were applied to detect the expression of Caspase-1, gap junction alpha-1 protein (GJA1), peroxisome proliferator-activated receptor gamma (PPARG), and S100 calcium-binding protein A8 (S100A8). Real-time quantitative polymerase chain reaction (Real-time PCR) was utilized to measure mRNA expression of Caspase-1, GJA1, PPARG, and S100A8. Western blot was performed to assess protein expression levels of Caspase-1, GJA1, PPARG, and S100A8. ResultsGEO datasets GSE87466 and GSE87473 yielded 64 Pyro-DEGs. KEGG analysis indicated that these genes were enriched in the NOD-like receptor signaling pathway, tumor necrosis factor (TNF) signaling pathway, and hypoxia-inducible factor 1 (HIF-1) signaling pathway. Four core Pyro-DEGs (Caspase-1, GJA1, PPARG, and S100A8) were identified. Immune infiltration analysis showed that expression of these genes was positively correlated with mast cells, neutrophils, M0 macrophages, M1 macrophages, and dendritic cells. Animal experimental results indicated that compared with the control group, the model group had significantly increased levels of IL-1β and IL-18, significantly decreased levels of IL-10 and TGF-β. The model group showed enhanced Caspase-1, GJA1, and S100A8 staining, and significantly increased mRNA and protein expression of Caspase-1, GJA1, and S100A8 (P<0.01). In contrast, the expression of PPARG was reduced in the model group (P<0.01). After treatment, all dosage groups showed varying degrees of improvement (P<0.05, P<0.01), with the high-dose group showing the most significant improvement (P<0.01). ConclusionCaspase-1, GJA1, PPARG, and S100A8 are core Pyro-DEGs closely associated with the pathogenesis of UC. These genes may collaborate with immune cells such as mast cells, neutrophils, and M0 macrophages to mediate disease development. The Xiezhuo Jiedu formula may regulate the expression of core Pyro-DEGs through the NOD-like receptor, TNF, and HIF-1 core signaling pathways, thereby modulating immune homeostasis in UC rats and effectively alleviating UC.
6.Mechanism of Mingshi Prescription in Regulating Opn4-dopamine Axis to Inhibit Endoplasmic Reticulum Stress and Delay Myopia Progression
Baohua LI ; Zefeng KANG ; Lulu WANG ; Xin YAN ; Jianquan WANG ; Xinyue HOU ; Bobiao NING ; Shanshan YE ; Mengyu LIU ; Yipeng SHI ; Danyu LI
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(18):58-67
ObjectiveTo investigate the mechanism by which Mingshi prescription regulates the retinal melanopsin-dopamine (Opn4-DA) axis in myopic mice to inhibit endoplasmic reticulum (ER) stress in the retina and sclera, thereby delaying axial elongation associated with myopia. MethodsSixty 4-week-old male SPF-grade C57BL/6J mice were randomly divided into a normal group, a form-deprived myopia group (FDM group), an intrinsically photosensitive retinal ganglion cells ablation group (ipRGCs group), a Mingshi Prescription group (MSF group, 5.2 g·kg-1), and an ipRGCs + MSF group (5.2 g·kg-1). Except for the normal group, all other groups underwent FDM modeling. Additionally, the ipRGCs and ipRGCs + MSF groups received retinal ipRGC ablation. Three weeks after modeling, the MSF and ipRGCs + MSF groups were administered Mingshi prescription via continuous gavage for six weeks. After refraction and axial length were measured in all mice, eyeballs were collected along with retinal and scleral tissues. Pathological and morphological changes in the retina, choroid, and sclera were observed using periodic acid-Schiff (PAS) staining. Western blot was employed to detect the relative protein expression levels of dopamine D1 receptor (DRD1), C/EBP homologous protein (CHOP), and glucose-regulated protein 78 (GRP78) in the retina, and CHOP and GRP78 in the sclera. Real-time PCR was used to detect the relative mRNA expression of Opn4, CHOP, and GRP78 in the retina, and CHOP and GRP78 in the sclera. Immunofluorescence staining (IF) was performed to detect the expression of Opn4 and DRD1 in retinal tissues. ResultsCompared with the normal group, the FDM group showed a significant myopic shift in refraction (P<0.05) and a significant increase in axial length (P<0.05). The retinal layers were thinner, the number of ganglion cells was reduced, and collagen fibers in the sclera were loosely arranged with evident gaps. Opn4 and DRD1 protein and mRNA expression in the retina were significantly decreased (P<0.05), while CHOP and GRP78 protein and mRNA expression in both retinal and scleral tissues were significantly increased (P<0.05). Compared with the FDM group, the ipRGCs group exhibited further increases in myopic refraction and axial length (P<0.05), more pronounced thinning and looseness in the retinal, choroidal, and scleral layers, lower expression of Opn4 and DRD1 protein and mRNA in the retina (P<0.05), and higher expression of CHOP and GRP78 protein and mRNA in the retina and sclera (P<0.05). Compared with the FDM group, the MSF group showed significantly reduced refractive error and axial length (P<0.05), with improved cellular number, arrangement, and thickness in ocular tissues, increased Opn4 and DRD1 protein and mRNA expression in the retina (P<0.05), and reduced CHOP and GRP78 protein and mRNA expression in both retina and sclera (P<0.05). Similarly, the ipRGCs + MSF group showed significant improvements in terms of the above items compared with the ipRGCs group (P<0.05). ConclusionMingshi Prescription delays myopic axial elongation and refractive progression by regulating the Opn4-DA axis in the retina of myopic mice, thereby inhibiting ER stress in the retina and sclera. This intervention promotes Qi and blood nourishment of the eyes, softens the fascia, and restores ocular rhythm.
7.Review, revision, and prospect of list of substances with both edible and medicinal values in China.
Xin-Yuan SUN ; Ya-Ping ZHENG ; Kang-Meng SUN ; Chun-Nian HE ; Pei-Gen XIAO
China Journal of Chinese Materia Medica 2025;50(2):346-355
The thought of medicine and food homology and substances with both edible and medicinal values are an important part of China's excellent traditional culture and medicine treasure, playing an important role in human diet and health maintenance for thousands of years. Substances with both edible and medicinal values are a standardized name governed by existing regulations, and many substances with both edible and medicinal values in the list lack important information such as original plants and edible and medicinal parts. Some substances change as the relevant regulations change, which confuses the use and regulation. According to the definition and inclusion conditions of substances with both edible and medicinal values in the Regulation of Substances with Both Edible and Medicinal Values Catalogue, this paper comprehensively reviewed the first batch of 87 substances with both edible and medicinal values published in 2002 by collecting information and investigating the practical application. Some substances supplemented, deleted, and revised were analyzed and discussed, and a complete revised list was compiled, encompassing a total of 90 substances, which were when combined with the 19 substances of the last three batches(published in 2019, 2023, and 2024), amounted to a total of 109 substances. In addition, the substances not currently in the published list but have both edible and medicinal values according to the latest definition were summarized, which revealed at least 27 other substances. Therefore, there were at least 136 substances with both edible and medicinal values. Additionally, the potential substances that could be included in the list of substances with edible and medicinal values were prospected, providing a focus for future expansion of the list. This paper systematically reviewed and revised the list of substances with both edible and medicinal values to lay a foundation for the regulatory authorities to revise the catalog of these substances and provide basic information for promoting the new quality productive forces in the health field and boosting the orderly and rapid development of the big health industry.
China
;
Humans
;
Drugs, Chinese Herbal/standards*
;
Plants, Medicinal/chemistry*
;
Medicine, Chinese Traditional
8.Pharmacokinetics study of Dayuanyin in normal and febrile rats.
Yu-Jie HOU ; Kang-Ning XIAO ; Jian-Yun BI ; Xin-Jun ZHANG ; Xin-Rui LI ; Yu-Qing WANG ; Ming SU ; Xin-Ru SUN ; Hui ZHANG ; Bo-Yang WANG ; Li-Jie WANG ; Shan-Xin LIU
China Journal of Chinese Materia Medica 2025;50(2):527-533
Based on the pharmacokinetics theory, this study investigated the pharmacokinetic characteristics of albiflorin, paeoniflorin, wogonoside, and wogonin in normal and febrile rats and summarized absorption and elimination rules of Dayuanyin in them to provide reference for further development and clinical application of Dayuanyin. Blood samples were taken from the fundus venous plexus of normal and model rats after intragastric administration of Dayuanyin at different time points. The concentration of each substance in blood was determined by ultra performance liquid chromatography-triple quadrupole mass spectrometry(UPLC-MS/MS) technique at different time points. DAS 2.0, a piece of pharmacokinetics software, was used to calculate the pharmacokinetic parameters of each component. The results show that the 4 components had good linear relationship in their respective ranges, and the results of methodological investigation met the requirements. The pharmacokinetic parameters of C_(max), T_(max), t_(1/2), AUC_(0-t), AUC_(0-∞), and MRT_(0-t) were calculated by the DAS 2.0 non-compartmental model. Compared with those in the normal group, C_(max) and AUC_(0-t) of the 4 components in the model group were significantly increased. There were significant differences in the pharmacokinetic characteristics between the normal and model groups, suggesting that the absorption and elimination of Dayuanyin may be affected by the changes of internal environment of the body in different physiological states.
Animals
;
Rats
;
Drugs, Chinese Herbal/administration & dosage*
;
Male
;
Rats, Sprague-Dawley
;
Fever/metabolism*
;
Tandem Mass Spectrometry
;
Chromatography, High Pressure Liquid
;
Glucosides/pharmacokinetics*
;
Monoterpenes
9.Outcome indicators in randomized controlled trials of traditional Chinese medicine treatment of post-stroke depression.
Jin HAN ; Yue YUAN ; Fang-Biao XU ; Yan-Bo SONG ; Yong-Kang SUN ; Xin-Zhi WANG
China Journal of Chinese Materia Medica 2025;50(2):542-559
This study systematically reviewed the randomized controlled trial(RCT) of traditional Chinese medicine(TCM) treatment of post-stroke depression(PSD) and analyzed the clinical study characteristics and outcome indicators, aiming to optimize the design and establish the core outcome set in the future clinical trials of the TCM treatment of PSD. PubMed, Web of Science, Cochrane Library, EMbase, CNKI, VIP, Wanfang, and SinoMed were searched for the relevant RCT published in recent 3 years. The basic characteristics, intervention measures, and outcome indicators of the included RCT were extracted, and the descriptive analysis was carried out. A total of 76 RCTs were eventually included, with the sample size concentrated in 80-100 cases. The most frequent TCM syndromes were liver depression and Qi stagnation(15 times, 31.91%) and phlegm combined with stasis(5 times, 10.63%). The frequency of intervention methods followed a descending trend of TCM decoction(35 times, 46.05%) and TCM decoction + acupuncture(4 times, 5.26%), Chinese patent medicine(3 times, 3.94%), and the intervention mainly lasted for 1 to 3 months(43 times, 60.56%). The adverse reactions of patients were mainly digestive system reaction(150 patients, 39.37%) and nervous system reaction(112 patients, 29.39%). Most of the included studies had unclear risk of bias, involving 84 outcome indicators, which belonged to 8 indicator domains. The RCTs of TCM treatment of PSD showed a variety of problems, such as non-standard TCM syndrome differentiation, inconsistent names of TCM syndrome scores and measurement tools, low quality, unclear risk of bias, neglect of endpoint indicators, unreasonable selection of substitute indicators, lack of differentiation between primary and secondary outcome indicators, non-standard reporting of safety indicators, insufficient attention to economic indicators, and lack of long-term prognosis evaluation. It is suggested that the future research should improve the quality of methodology and build a standardized core outcome set to promote the development of high-quality clinical research in this field.
Humans
;
Randomized Controlled Trials as Topic
;
Drugs, Chinese Herbal/administration & dosage*
;
Stroke/psychology*
;
Depression/etiology*
;
Treatment Outcome
;
Medicine, Chinese Traditional
10.Characteristics, microbial composition, and mycotoxin profile of fermented traditional Chinese medicines.
Hui-Ru ZHANG ; Meng-Yue GUO ; Jian-Xin LYU ; Wan-Xuan ZHU ; Chuang WANG ; Xin-Xin KANG ; Jiao-Yang LUO ; Mei-Hua YANG
China Journal of Chinese Materia Medica 2025;50(1):48-57
Fermented traditional Chinese medicine(TCM) has a long history of medicinal use, such as Sojae Semen Praeparatum, Arisaema Cum Bile, Pinelliae Rhizoma Fermentata, red yeast rice, and Jianqu. Fermentation technology was recorded in the earliest TCM work, Shen Nong's Classic of the Materia Medica. Microorganisms are essential components of the fermentation process. However, the contamination of fermented TCM by toxigenic fungi and mycotoxins due to unstandardized fermentation processes seriously affects the quality of TCM and poses a threat to the life and health of consumers. In this paper, the characteristics, microbial composition, and mycotoxin profile of fermented TCM are systematically summarized to provide a theoretical basis for its quality and safety control.
Fermentation
;
Mycotoxins/analysis*
;
Drugs, Chinese Herbal/analysis*
;
Fungi/classification*
;
Bacteria/genetics*
;
Drug Contamination
;
Medicine, Chinese Traditional

Result Analysis
Print
Save
E-mail