ObjectiveTo investigate the therapeutic effects and mechanism of decoctions from four kinds of processed products of Aconiti Radix Lateralis Praeparata（ARLP） in deficiency-cold syndrome. MethodsA total of 36 SD rats were randomly divided into the control group， model group， Shengfupian（SFP） group， Paofuzi（PFZ） group， Heishunpian（HSP） group and Paofupian（PFP） group with 6 rats in each group. Except for the control group， rats in other groups were administered hydrocortisone sodium succinate via intramuscular injection to induce a cold deficiency syndrome model. After 14 consecutive days， each ARLP decoction pieces was administered via continuous gastric lavage at a dose of 12 g·kg^-1·d^-1 for 7 d， while the control and model groups received an equivalent volume of physiological saline. After the end of administration， body weight， spleen weight and thymus weight were measured for calculating the spleen and thymus indexes. Hematoxylin-eosin（HE） staining was used to observe the pathological morphology of adrenal tissue. The fully automatic biochemistry analyzer was used to measure the total cholesterol（TC）， triglyceride（TG）， lactic dehydrogenase（LDH） and lactate（LAC） levels in serum. Enzyme-linked immunosorbent assay（ELISA） was employed to measure the contents of 17-hydroxycorticosteroid（17-OHCS）， cortisol（CORT）， triiodothyronine（T₃）， thyroxine（T₄）， thyrotropin（TSH）， immunoglobulin（Ig） M， IgG， cyclic adenosine monophosphate（cAMP） and cyclic guanosine monophosphate（cGMP）. Western blot was used to measure the protein expression levels of protein kinase A（PKA）， cAMP response element-binding protein（CREB）， silent information regulator 1（Sirt1） and peroxisome proliferator-activated receptor γ coactivator-1α（PGC-1α）. And high performance liquid chromatography（HPLC） was used to determine the content of major alkaloids， followed by Pearson correlation analysis with pharmacodynamic indicators. ResultsAfter modeling， compare with the control group， the model rats exhibited symptoms such as lethargy and loose stools， mild abnormalities were observed in adrenal tissue structure， and both spleen and thymus indices were significantly reduced（P<0.01）. Thyroid， adrenal and immune system functions were suppressed， with decreased serum cAMP level and significantly elevated cGMP level（P<0.01）. Compared with the model group， the adrenal injury by hydrocortisone sodium succinate were repaired and the spleen index were increased significantly in all four ARLP groups（P<0.05， P<0.01）. The thymus index in SFP and PFZ groups were increased significantly（P<0.05）. The contents of T₃， TSH， 17-OHCS and CORT were increased significantly in SFP and PFZ groups（P<0.05）. In addition， the content of IgG in SFP， PFZ and PFP groups were increased significantly（P<0.01）， while the content of IgM in PFZ and HSP groups were also increased significantly（P<0.05）. Regarding the cyclic nucleotide system， PFZ significantly elevated cAMP level while reducing cGMP level（P<0.05）， exhibiting the most pronounced effect among the four decoction pieces. For energy metabolism indicators， PFZ significantly improved abnormal markers including TC， TG， LDH， and LAC（P<0.05）. HSP showed marked improvement effects on TG， LDH， and LAC（P<0.05）. Both PFZ and SFP significantly elevated the expression levels of PKA， CREB， Sirt1， and PGC-1α proteins（P<0.01）. Additionally， the diester alkaloids in ARLP showed a strong positive correlation with TG， IgG， and CORT， a strong negative correlation with LAC， a moderate positive correlation with T₄， and moderate negative correlations with cAMP and spleen index. Monomeric alkaloids showed strong positive correlations with TG and IgG， strong negative correlations with LAC， moderate positive correlations with CORT and T₄， and moderate negative correlations with cAMP and spleen index. However， the content of water-soluble alkaloids showed strong positive correlations with TC， LDH， 17-OHCS， T₃， TSH， and thymus index， moderate positive correlations with cAMP， CORT， T₄， and spleen index， and moderate negative correlation with cGMP. ConclusionAmong different processed ARLP decoction pieces， PFZ processed according to ZHANG Zhongjing's method exhibits the most potent warming and cold-dispelling effects. Its pharmacological actions are mediated through regulating the thyroid， adrenal， immune， cyclic nucleotide systems， and material-energy metabolism pathways. Among these， water-soluble alkaloids show strong or moderate correlations with more indicators of deficiency-cold syndrome and exhibit the highest content in PFZ. Therefore， PFZ processed according to ZHANG Zhongjing's method may exert its warming and cold-dispelling effects through water-soluble alkaloids.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

OBJECTIVE To explore a model for constructing a platform for medical institution formulation and provide insights for promoting their development. METHODS By systematically reviewing the development status and challenges of medical institution preparations in China， and based on the theory of industry-university-research collaborative innovation， the organizational structure， collaborative processes， and safeguard mechanisms of the platform were designed. RESULTS & CONCLUSIONS Medical institution formulations in China mainly faced challenges such as weak research and development （R&D） capacity， uneven quality standards， and blocked transformation pathways. This study established a full-chain， whole- industry collaborative innovation network covering the government， medical institutions， universities/research institutes， pharmaceutical enterprises， and the market， forming a new “government-industry-university-research-application” five-in-one platform model for medical institution formulations. By establishing mechanisms such as multi-entity collaborative cooperation， full- chain intellectual property management， contribution-based benefit distribution， staged risk-sharing， and third-party evaluation， the model clarified the responsibilities and collaborative pathways of all parties. The new model highlights the whole-process transformation of clinical experience-based prescriptions， enabling precise alignment between clinical needs and technological R&D， as well as between preparation achievements and industrial transformation. While breaking down the barriers of traditional platform construction， it effectively achieves optimal resource allocation and complementary advantages， addresses problems emerging in the development of medical institution preparations， and provides reference value for the formulation of relevant systems.

Oral squamous cell carcinoma (OSCC) is a common head and neck malignancy. Approximately 50% to 60% of patients with OSCC are diagnosed at a locally advanced stage (clinical staging III-IVa). Even with comprehensive and sequential treatment primarily based on surgery, the 5-year overall survival rate remains below 50%, and patients often suffer from postoperative functional impairments such as difficulties with speaking and swallowing. Programmed death receptor-1 (PD-1) inhibitors are increasingly used in the neoadjuvant treatment of locally advanced OSCC and have shown encouraging efficacy. However, clinical practice still faces key challenges, including the definition of indications, optimization of combination regimens, and standards for efficacy evaluation. Based on the latest research advances worldwide and the clinical experience of the expert group, this expert consensus systematically evaluates the application of PD-1 inhibitors in the neoadjuvant treatment of locally advanced OSCC, covering combination strategies, treatment cycles and surgical timing, efficacy assessment, use of biomarkers, management of special populations and immune related adverse events, principles for immunotherapy rechallenge, and function preservation strategies. After multiple rounds of panel discussion and through anonymous voting using the Delphi method, the following consensus statements have been formulated: 1) Neoadjuvant therapy with PD-1 inhibitors can be used preoperatively in patients with locally advanced OSCC. The preferred regimen is a PD-1 inhibitor combined with platinum based chemotherapy, administered for 2-3 cycles. 2) During the efficacy evaluation of neoadjuvant therapy, radiographic assessment should follow the dual criteria of Response Evaluation Criteria in Solid Tumors (RECIST) version 1.1 and immune RECIST (iRECIST). After surgery, systematic pathological evaluation of both the primary lesion and regional lymph nodes is required. For combination chemotherapy regimens, PD-L1 expression and combined positive score need not be used as mandatory inclusion or exclusion criteria. 3) For special populations such as the elderly (≥ 70 years), individuals with stable HIV viral load, and carriers of chronic HBV/HCV, PD-1 inhibitors may be used cautiously under the guidance of a multidisciplinary team (MDT), with close monitoring for adverse events. 4) For patients with a poor response to neoadjuvant therapy, continuation of the original treatment regimen is not recommended; the subsequent treatment plan should be adjusted promptly after MDT assessment. Organ transplant recipients and patients with active autoimmune diseases are not recommended to receive neoadjuvant PD-1 inhibitor therapy due to the high risk of immune related activation. Rechallenge is generally not advised for patients who have experienced high risk immune related adverse events such as immune mediated myocarditis, neurotoxicity, or pneumonitis. 5) For patients with a good pathological response, individualized de escalation surgery and function preservation strategies can be explored. This consensus aims to promote the standardized, safe, and precise application of neoadjuvant PD-1 inhibitor strategies in the management of locally advanced OSCC patients.

ObjectiveTo investigate the effects of Maxing Kugan decoction （MKD） on inflammatory response and apoptosis in rats with oleic acid （OA）-induced acute lung injury （ALI） and explore its mechanism of action. MethodsSixty Sprague-Dawley （SD） rats were randomly assigned into six groups： a control group， a model group， a dexamethasone-treated group （2 mg·kg^-1）， and three MKD-treated groups at low， medium， and high doses （3.1， 6.2，12.4 g·kg^-1）. Each group was administered either an equivalent volume of normal saline or the corresponding concentration of MKD by gavage for seven consecutive days. The model group and each administration group were used to establish the ALI model by tail vein injection of OA （0.2 mL·kg^-1）. Twelve hours after modeling， blood gas analyses were conducted， and the wet-to-dry （W/D） weight ratio of lung tissue was measured for each group. Additionally， enzyme-linked immunosorbent assay （ELISA） was employed to quantify the levels of tumor necrosis factor-alpha （TNF-α）， interleukin-1β （IL-1β）， and interleukin-6 （IL-6） in the bronchoalveolar lavage fluid （BALF） of the rats. Cell damage and apoptosis in lung tissue were examined via hematoxylin-eosin （HE） staining and TdT-mediated dUTP-biotin nick end labeling （TUNEL） assays， and the results were subsequently scored. The expression levels of the p38 mitogen-activated protein kinase （p38 MAPK）/nuclear factor kappa-B （NF-κB） signaling pathway and apoptosis-related proteins and mRNAs were assessed using Western blot and real-time fluorescence quantitative polymerase chain reaction （Real-time PCR）. ResultsCompared with the control group， the model group exhibited a significant decrease in partial pressure of oxygen （PaO₂）， blood oxygen saturation （SaO₂）， and oxygenation index （PaO₂/FiO₂）， along with a marked increase in partial pressure of carbon dioxide （PaCO₂） and lung W/D ratio （P<0.01）. Additionally， levels of TNF-α， IL-6， and IL-1β in BALF were significantly elevated （P<0.01）. Histopathological analysis of lung tissue showed significant inflammatory infiltration， tissue edema， alveolar septal thickening， and apoptosis of lung tissue. Pronounced increases were observed in the mRNA expression levels of p38 MAPK， NF-κB p65， inhibitor of NF-κB （IκBα）， B-cell lymphoma-2 associated x protein （Bax）， and Caspases-3， as well as the protein expression levels of p-p38 MAPK， p-NF-κB p65， p-IκBα， Bax， Caspases-3， and cleaved Caspases-3， while the mRNA and protein expression of Bcl-2 was downregulated （P<0.01）. Compared with the model group， MKD significantly elevated PaO₂， SaO₂， and PaO₂/FiO₂ while reducing PaCO₂ and W/D ratio in rats （P<0.01）. It also greatly reduced TNF-α， IL-6， and IL-1β levels in BALF （P<0.01） and alleviated inflammatory infiltration， tissue edema， alveolar septal thickening， and apoptosis of lung tissue. Additionally， it downregulated the mRNA expression of p38 MAPK， NF-κB p65， IκBα， Bax， Caspases-3， as well as protein expression of p-p38 MAPK， p-NF-κB p65， p-IκBα， Bax， Caspases-3， and cleaved Caspases-3 in lung tissue （P<0.05， P<0.01）， while significantly upregulating mRNA and protein expression of Bcl-2 （P<0.01）. ConclusionMKD exerts a protective effect on OA-induced ALI rats， potentially through the regulation of the p38 MAPK/NF-κB signaling pathway to inhibit inflammation and apoptosis.

ObjectiveTo investigate the effects of Maxing Kugan decoction （MKD） on inflammatory response and apoptosis in rats with oleic acid （OA）-induced acute lung injury （ALI） and explore its mechanism of action. MethodsSixty Sprague-Dawley （SD） rats were randomly assigned into six groups： a control group， a model group， a dexamethasone-treated group （2 mg·kg^-1）， and three MKD-treated groups at low， medium， and high doses （3.1， 6.2，12.4 g·kg^-1）. Each group was administered either an equivalent volume of normal saline or the corresponding concentration of MKD by gavage for seven consecutive days. The model group and each administration group were used to establish the ALI model by tail vein injection of OA （0.2 mL·kg^-1）. Twelve hours after modeling， blood gas analyses were conducted， and the wet-to-dry （W/D） weight ratio of lung tissue was measured for each group. Additionally， enzyme-linked immunosorbent assay （ELISA） was employed to quantify the levels of tumor necrosis factor-alpha （TNF-α）， interleukin-1β （IL-1β）， and interleukin-6 （IL-6） in the bronchoalveolar lavage fluid （BALF） of the rats. Cell damage and apoptosis in lung tissue were examined via hematoxylin-eosin （HE） staining and TdT-mediated dUTP-biotin nick end labeling （TUNEL） assays， and the results were subsequently scored. The expression levels of the p38 mitogen-activated protein kinase （p38 MAPK）/nuclear factor kappa-B （NF-κB） signaling pathway and apoptosis-related proteins and mRNAs were assessed using Western blot and real-time fluorescence quantitative polymerase chain reaction （Real-time PCR）. ResultsCompared with the control group， the model group exhibited a significant decrease in partial pressure of oxygen （PaO₂）， blood oxygen saturation （SaO₂）， and oxygenation index （PaO₂/FiO₂）， along with a marked increase in partial pressure of carbon dioxide （PaCO₂） and lung W/D ratio （P<0.01）. Additionally， levels of TNF-α， IL-6， and IL-1β in BALF were significantly elevated （P<0.01）. Histopathological analysis of lung tissue showed significant inflammatory infiltration， tissue edema， alveolar septal thickening， and apoptosis of lung tissue. Pronounced increases were observed in the mRNA expression levels of p38 MAPK， NF-κB p65， inhibitor of NF-κB （IκBα）， B-cell lymphoma-2 associated x protein （Bax）， and Caspases-3， as well as the protein expression levels of p-p38 MAPK， p-NF-κB p65， p-IκBα， Bax， Caspases-3， and cleaved Caspases-3， while the mRNA and protein expression of Bcl-2 was downregulated （P<0.01）. Compared with the model group， MKD significantly elevated PaO₂， SaO₂， and PaO₂/FiO₂ while reducing PaCO₂ and W/D ratio in rats （P<0.01）. It also greatly reduced TNF-α， IL-6， and IL-1β levels in BALF （P<0.01） and alleviated inflammatory infiltration， tissue edema， alveolar septal thickening， and apoptosis of lung tissue. Additionally， it downregulated the mRNA expression of p38 MAPK， NF-κB p65， IκBα， Bax， Caspases-3， as well as protein expression of p-p38 MAPK， p-NF-κB p65， p-IκBα， Bax， Caspases-3， and cleaved Caspases-3 in lung tissue （P<0.05， P<0.01）， while significantly upregulating mRNA and protein expression of Bcl-2 （P<0.01）. ConclusionMKD exerts a protective effect on OA-induced ALI rats， potentially through the regulation of the p38 MAPK/NF-κB signaling pathway to inhibit inflammation and apoptosis.

Intraoperative cell salvage (IOCS) has been widely applied as an important blood conservation measure in surgical operations. However, there is currently a lack of clinical practice guidelines for the implementation of IOCS in patients with malignant tumors. This report aims to provide clinicians with recommendations on the use of IOCS in patients with malignant tumors based on the review and assessment of the existed evidence. Data were derived from databases such as PubMed, Embase, the Cochrane Library and Wanfang. The guideline development team formulated recommendations based on the quality of evidence, balance of benefits and harms, patient preferences, and health economic assessments. This study constructed seven major clinical questions. The main conclusions of this guideline are as follows: 1) Compared with no perioperative allogeneic blood transfusion (NPABT), perioperative allogeneic blood transfusion (PABT) leads to a more unfavorable prognosis in cancer patients (Recommended); 2) Compared with the transfusion of allogeneic blood or no transfusion, IOCS does not lead to a more unfavorable prognosis in cancer patients (Recommended); 3) The implementation of IOCS in cancer patients is economically feasible (Recommended); 4) Leukocyte depletion filters (LDF) should be used when implementing IOCS in cancer patients (Strongly Recommended); 5) Irradiation treatment of autologous blood to be reinfused can be used when implementing IOCS in cancer patients (Recommended); 6) A careful assessment of the condition of cancer patients (meeting indications and excluding contraindications) should be conducted before implementing IOCS (Strongly Recommended); 7) Informed consent from cancer patients should be obtained when implementing IOCS, with a thorough pre-assessment of the patient's condition and the likelihood of blood loss, adherence to standardized internally audited management procedures, meeting corresponding conditions, and obtaining corresponding qualifications (Recommended). In brief, current evidence indicates that IOCS can be implemented for some malignant tumor patients who need allogeneic blood transfusion after physician full evaluation, and LDF or irradiation should be used during the implementation process.

Surgical treatment is one of the key approaches for non-small cell lung cancer (NSCLC). Regular postoperative follow-up is crucial for early detection and timely management of tumor recurrence, metastasis, or second primary tumors. A scientifically sound and reasonable follow-up strategy not only extends patient survival but also significantly improves quality of life, thereby enhancing overall prognosis. This consensus aims to build upon the previous version by incorporating the latest clinical research advancements and refining postoperative follow-up protocols for early-stage NSCLC patients based on different treatment modalities. It provides a scientific and practical reference for clinicians involved in the postoperative follow-up management of NSCLC. By optimizing follow-up strategies, this consensus seeks to promote the standardization and normalization of lung cancer diagnosis and treatment in China, helping more patients receive high-quality care and long-term management. Additionally, the release of this consensus is expected to provide insights for related research and clinical practice both domestically and internationally, driving continuous development and innovation in the field of postoperative management for NSCLC.

OBJECTIVE To systematically evaluate risk prediction models for chemotherapy-induced myelosuppression in breast cancer， and provide a scientific reference for clinical healthcare workers in selecting or developing effective predictive models. METHODS A systematic search was conducted for studies on predictive models of the risk of chemotherapy-induced myelosuppression in breast cancer across the CNKI， VIP， Wanfang， PubMed， Web of Science， Cochrane Library， Embase， and Scopus databases， with a time frame of the establishment of the database to May 7， 2024. Literature was independently screened by 2 investigators， data were extracted according to critical appraisal and data extraction for systematic reviews of predictive model studies， and the risk of bias evaluation tool for predictive model studies was used to analyze the risk of bias and applicability of the included studies. RESULTS There were totally 7 studies， comprising 12 models. Among them， 11 models indicated an area under the subject operating characteristic curve of 0.600-0.908； 2 models indicated calibration. The common predictor variables of the included models were age， pre-chemotherapy neutrophil count， pre-chemotherapy lymphocyte count， and pre-chemotherapy albumin. The overall risk of bias of the 7 studies was high， which was mainly attributed to the flaws in the study design， insufficient sample sizes， inappropriate treatment of variables， non-reporting of missing data， and the lack of indicators for the assessment of the models， but the applicability was good. CONCLUSIONS The predictive performance of risk predictive models for chemotherapy-induced myelosuppression in breast cancer remains to be further enhanced， and the overall risk of model bias is high. Future studies should follow the specifications of model development and reporting， then combine machine learning algorithms to develop risk predictive models with good predictive performance， high stability， and low risk of bias， so as to provide a decision-making basis for the clinic.

ObjectiveTo study the pharmacological substances and mechanisms through which sesquiterpene ZH-13 from Aquilariae Lignum Resinatum improves neuroinflammation. MethodsBV-2 microglial cells were stimulated with lipopolysaccharide （LPS） to induce neuroinflammation. The cells were divided into the normal group， the model group， and the ZH-13 low- and high-dose treatment groups （10， 20 μmol·L^-1）. The model group was treated with 1 μmol·L^-1 LPS. Cell viability was assessed using the cell proliferation and activity assay （CCK-8 kit）. Nitric oxide （NO） release in the cell supernatant was measured using a nitric oxide kit （Griess method）. The mRNA expression levels of interleukin-1β （IL-1β）， tumor necrosis factor-α （TNF-α）， inducible nitric oxide synthase （iNOS）， and interleukin-6 （IL-6） were detected by real-time fluorescence quantitative polymerase chain reaction （Real-time PCR）. The phosphorylation of mitogen-activated protein kinase （MAPK） pathway proteins was assessed by Western blot. ResultsCompared with the model group， ZH-13 dose-dependently reduced NO release from BV-2 cells under LPS stimulation （P<0.05， P<0.01）. In the 20 μmol·L^-1 ZH-13 treatment group， the mRNA expression levels of IL-1β， TNF-α， iNOS， and IL-6 were significantly reduced compared to the model group （P<0.05， P<0.01）. In both the low- and high-dose ZH-13 groups， the expression of the inflammatory factor TNF-α and the phosphorylation of c-Jun N-terminal kinase （JNK） in the upstream MAPK pathway were significantly reduced （P<0.05）. After stimulation with the JNK agonist anisomycin （Ani）， both low- and high-dose ZH-13 treatment groups showed reduced phosphorylation of JNK proteins compared to the Ani-treated group （P<0.01）. ConclusionThe sesquiterpene compound ZH-13 from Aquilariae Lignum Resinatum significantly ameliorates LPS-induced neuroinflammatory responses in BV-2 cells by inhibiting excessive JNK phosphorylation and reducing TNF-α expression. These findings elucidate the pharmacological substances and mechanisms underlying the sedative and calming effects of Aquilariae Lignum Resinatum.