Esophageal cancer is one of the malignant tumors that poses a threat to human health, with both high incidence and malignancy. Currently, surgery following neoadjuvant chemoradiotherapy is the standard treatment for locally advanced esophageal cancer; however, the long-term prognosis remains unsatisfactory. In recent years, inhibitors of programmed death protein-1 (PD-1) and its ligand (programmed death ligand-1, PD-L1) have achieved breakthrough progress in other solid tumors, and research on esophageal cancer is gradually being conducted. With the demonstration of good efficacy of PD-1/PD-L1 inhibitors in the first-line and second-line treatment of advanced unresectable esophageal cancer, their incorporation into neoadjuvant treatment regimens has become a hot topic. Therefore, this article reviews the mechanism of action of PD-1/PD-L1 inhibitors and their application in the neoadjuvant treatment of esophageal cancer.

Background Sleep is a crucial physiological activity for the human body, and research has shown that air pollution can affect sleep quality. However, the association between polycyclic aromatic hydrocarbons (PAHs) exposure, neurotoxic compounds in air pollutants, and sleep quality remains uncertain. Objective To evaluate the association of PAHs exposure with sleep quality, and to provide evidence for improving sleep quality. Methods This study used a cross-sectional design. We selected 632 workers from a coking plant of a large state-owned enterprise as the exposure group, and 477 workers from the energy and power plant of the same enterprise as the control group. All workers worked in three shifts. A questionnaire survey was conducted to collect basic information including gender, years of service, age, educational level, smoking, alcohol consumption, consumption of fried foods, cooking frequency, types of cooking fuels. Worker's post-shift morning midstream urine was sampled to determine the concentrations of eight PAHs metabolites (OH-PAHs) using gas chromatography-tandem mass spectrometry (GC-MS). Worker's sleep quality was assessed using Pittsburgh Sleep Quality Index (PSQI). A higher PSQI score indicated a lower sleep quality. Associations of urinary OH-PAHs levels with sleep quality in the workers were analyzed using linear regression, Bayesian kernel-machine regression (BKMR), and quantile g-computation. Results The median (P₂₅, P₇₅) concentration of total OH-PAHs in the exposure group [88.84 (46.27, 151.96) μg·L⁻¹] was higher than that in the control group [54.33 (24.86, 97.97) μg·L⁻¹]. Additionally, the PSQI score (\begin{document}$ \overline{x}\pm {s} $\end{document}) in the exposure group (5.16±3.84) was higher than that in the control group (4.60±3.17). The multiple linear regression revealed that an increase in the sum of the concentrations of eight OH-PAHs after natural logarithmic transformation (lnΣ₈OH-PAHs) was associated with an increase of 0.3646 (95%CI: 0.1337, 0.5955) in PSQI score, and an increase in lnΣlow-ring OH-PAHs was associated with an increase of 0.2954 (95%CI: 0.0941, 0.4967) in PSQI score. The BKMR analysis demonstrated that PSQI score was gradually increased as the increasing of lnΣ₈OH-PAHs concentration. The quantile g-computation analysis indicated that a quantile increase in lnΣ₈OH-PAHs concentration was associated with an increase of 0.4062% (95%CI: 0.1176%, 0.6949%) in PSQI score. Conclusion Compared to the controls, the coking workers show a higher concentration of urinary OH-PAHs and report worse sleep quality. The concentration of OH-PAHs is significantly negatively associated with sleep quality.

Objective:To investigate the current situation of the use of transjugular intrahepatic portosystemic shunt (TIPS) for portal hypertension, which should aid the development of TIPS in China.Methods:The China Portal Hypertension Alliance (CHESS) initiated this study that comprehensively investigated the basic situation of TIPS for portal hypertension in China through network research. The survey included the following: the number of surgical cases, main indications, the development of Early-TIPS, TIPS for portal vein cavernous transformation, collateral circulation embolization, intraoperative portal pressure gradient measurement, commonly used stent types, conventional anticoagulation and time, postoperative follow-up, obstacles, and the application of domestic instruments.Results:According to the survey, a total of 13 527 TIPS operations were carried out in 545 hospitals participating in the survey in 2021, and 94.1% of the hospital had the habit of routine follow-up after TIPS. Most hospitals believed that the main indications of TIPS were the control of acute bleeding (42.6%) and the prevention of rebleeding (40.7%). 48.1% of the teams carried out early or priority TIPS, 53.0% of the teams carried out TIPS for the cavernous transformation of the portal vein, and 81.0% chose routine embolization of collateral circulation during operation. Most of them used coils and biological glue as embolic materials, and 78.5% of the team routinely performed intraoperative portal pressure gradient measurements. In selecting TIPS stents, 57.1% of the hospitals woulel choose Viator-specific stents, 57.2% woulel choose conventional anticoagulation after TIPS, and the duration of anticoagulation was between 3-6 months (55.4%). The limitation of TIPS surgery was mainly due to cost (72.3%) and insufficient understanding of doctors in related departments (77.4%). Most teams accepted the domestic instruments used in TIPS (92.7%).Conclusions:This survey shows that TIPS treatment is an essential part of treating portal hypertension in China. The total number of TIPS cases is far from that of patients with portal hypertension. In the future, it is still necessary to popularize TIPS technology and further standardize surgical indications, routine operations, and instrument application.

Coronary artery calcifications (CAC) is an independent risk factor for cardiovascular disease (CVD). It has been revealed that this condition can be automatically quantified through computerize tomographic (CT) scan contained in radiotherapy plan for patients with breast cancer, with which, physicians can identify the patients with increased risk of CVD after radiotherapy prematurely and take intervention measures in advance. In this article, the current literature and research progress on the correlation between CAC and cardiotoxicity in patients with breast cancer after radiotherapy were reviewed, expecting to provide a strategy to reduce the CVD risk in patients with breast cancer after radiotherapy.

【Objective】 To explore how to identify rare unexpected antibodies using routine serology methods in blood transfusion department of grassroots hospitals. 【Methods】 A patient with gastrointestinal bleeding with inconsistent forward and reverse blood typing, positive antibody screening and incompatible blood matching in our hospital was selected as the research object. Mixed human O cell absorption method was used for blood type identification, and 10-panel reagent red blood cells, manual polybrene test, 2-mercaptoethanol(2-ME) test, blind match and pedigree study were used to explore the antibody characteristics. 【Results】 The serological test results of the patient′s serum were as follows: The blood group was type B and RhD positive, and negative for direct antiglobulin test; The antibody was IgM; The likelihood of this antibody being anti-s, anti-Fy^a or anti-k was low, and compound antibodies could not be excluded; The blood of the patient did not match with blood samples of 20 blood donors in the major side, while it matched with all the blood samples of her three sisters. 【Conclusion】 When the antibodies of high-prevalence antigen series in plasma cannot be identified, the matched blood may be found tthrough family survey for irradiation and transfusion.

[Abstract] [Objective] To analyze the detection ability of one imported and three domestic microcolumn agglutination anti-human globulin cards in unexpected antibody screening test. [Methods] A total of 104 positive samples from antibody screening test conducted at our hospital from July to September 2022 were selected. Microcolumn agglutination antiglobulin tests were performed in parallel with antibody screening tests using one imported card (A Card) and three domestic cards (B, C and D Cards ) to analyze the differences in the sensitivity, specificity and agglutination intensity scores. [Results] The sensitivity of the four anti-human globulin cards was as follows: D card 88.51% (131/148) > C card 83.22% (124/149) > B card 81.63% (120/147) > A card 80.54% (120/149); the specificity was A card 97.79% (133/136) > B card 95.65% (132/138) > D card 95.62% (131/137) > C card 93.38% (127/136); and the average agglutination intensity score (points) was D card 214.57 > C card 191.90 > A Card 179.69 > B Card 175.83, and the H value of Kruskal-Wallis test was 7.221, with no statistically significant difference (P > 0.05). Among them, C card was prone to false positives, accounting for 3.16% (9/285), and A card was prone to false negatives, accounting for 10.18% (29/285). [Conclusion] There were differences in the detection ability of anti-human globulin cards of different manufacturers, and some domestic cards have higher detection performance than imported cards. It is recommended to use anti-human globulin cards of two manufacturers routinely in clinical practice, that is, to use cards with high detection sensitivity for antibody screening tests to avoid antibody missed detection as much as possible, and to use cards with high specificity for cross-matching blood tests to avoid delays in transfusion due to false positives, which could hinder transfusion treatment.

Inborn errors of immunity (IEI) are immune system disorders caused by genetic mutations, often presenting with varying degrees of infection, immune dysregulation, lymphoproliferation, and tumor susceptibility. Initially, IEIs were typically diagnosed in patients with recurrent and unusual infections. However increasing research has shown that noninfectious manifestations can also be the initial or even primary presentation of IEI. Over the past ten years, more and more IEIs associated with autoinflammatory symptoms have been identified. Although these diseases are rare, relevant research suggests that immune deficiency and autoinflammation are not opposing conditions but rather interconnected aspects of the immune system, influencing each other in a complementary and inseparable manner. This article reviews the mechanisms involved in IEI with autoinflammation, and proposes some clues for identifying IEI manifested as autoinflammation. It also summarizes the current progress in the diagnosis and treatment of IEI manifested as autoinflammation, and presents prospects for future research on IEI.

Kidney is one of the key target organs involved in autoinflammatory diseases (AIDs). The clinical manifestations of renal impairment associated with AIDs are diverse, including hematuria, proteinuria, nephrotic syndrome, hypertension, renal artery stenosis, renal insufficiency, and others. The pathogenesis is mostly renal amyloidosis and/or renal vasculitis/vasculopathy caused by inflammasome activation. Whether or not the kidney is involved and its degree is closely related to the prognosis of AIDs patients. This article introduces the pathogenesis of AIDs-related renal impairmen and highlights the clinical characteristics of renal damage in some AIDs, aiming to enhance clinicians′ understanding of AIDs-related renal damage, and to implement early diagnosis and treatment to improve patients′ quality of life and prognosis.

Schimke immuno-osseous dysplasia (SIOD)caused by SMARCAL1 gene mutations is a rare genetic disorder characterized by multi-system involvement, including T-cell dysfunction, skeletal dysplasia, disproportionate short stature, nephrotic syndrome, and kidney failure. This multidisciplinary consultation involved a 9-year-old boy with intrauterine growth retardation, presenting with short stature, T-cell lymphopenia, proteinuria, and degenerative bone and joint disease. Treatment primarily focused on symptomatic and supportive care. Through the multidisciplinary rare disease consultation, holistic support was provided to the patient, offering comprehensive care from various specialtiesx.We also aim to use this case report to enhance clinicians′ under-standing of SIOD and improve the management and treatment of rare diseases.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.