Abstract： ObjectiveThe study aims to explore the effects and regulatory roles of glucose transporter 1 （GLUT1） on the proliferation， migration， adhesion， and angiogenesis of human umbilical vein endothelial cells （HUVECs） under ischemia-hypoxic conditions. MethodsIn vitro experiments were conducted to subject HUVECs to an ischemia-hypoxic-mimicking environment （1% O₂， 5% CO₂， 94% N₂）. The biological characteristics of HUVECs under normoxic and ischemia-hypoxic conditions were compared by assessing cell viability， proliferation capacity， and examining the expression changes of GLUT1， HIF-1α， and VEGFA proteins under ischemia-hypoxia using Western blot technology. Further， GLUT1 was overexpressed using plasmid transfection and the proliferation， migration， adhesion， and angiogenic capabilities of HUVECs were evaluated through scratch assays， cell adhesion assays， and tube formation assays. Mitochondrial morphological changes were observed by transmission electron microscopy，and oxygen consumption rate （OCR） was detected by Seahorse metabolic analyzer to evaluate mitochondrial function. ResultsCompared with normoxic conditions， the ischemia-hypoxic environment significantly inhibited the proliferation， cell viability， migration， and adhesion capabilities of HUVECs and impaired their angiogenic potential. The expression levels of GLUT1， HIF-1α and VEGFA proteins were also markedly reduced. However， when GLUT1 expression was upregulated， the migration， adhesion， and angiogenic capabilities of HUVECs were significantly improved， and the protein expression levels of HIF-1α， VEGFA and VEGFR were increased. Transmission electron microscopy revealed that ischemic-hypoxia leads to mitochondrial swelling and matrix damage， while GLUT1 overexpression significantly alleviates mitochondrial morphology abnormalities. OCR results suggest that GLUT1 overexpression may enhance oxidative phosphorylation of endothelial cells in ischemic-hypoxic environments to improve energy metabolism. These results suggest that GLUT1 may influence the function and angiogenic potential of HUVECs by regulating glucose metabolism and energy supply. ConclusionsThis study reveals the significant regulatory role of GLUT1 in the function of HUVECs under ischemia-hypoxic conditions， potentially through modulating cellular energy metabolism and signal transduction pathways， thereby affecting cell proliferation， migration， adhesion， and angiogenesis. These findings provide a new perspective on the role of GLUT1 in cardiovascular diseases and may offer potential targets for the development of new therapeutic strategies.

Approximately 10% of the global adult population has diabetes, with accumulating evidence linking suboptimal vitamin D levels to an increased risk of type 2 diabetes and its complications. Current clinical studies suggest that vitamin D supplementation may enhance insulin sensitivity and improve glycemic control, prompting significant interest in its potential as a therapeutic intervention. However, further high-quality, large-scale randomized controlled trials are required to validate its efficacy in glucose metabolism regulation and clarify the underlying molecular mechanisms. These investigations will provide critical evidence to inform precision medicine approaches for diabetes prevention and management.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

ObjectiveTo explore quality difference factors of Perillae Caulis based on the contents of multiple chemical components and comprehensively evaluate the quality. MethodsA total of 32 batches of Perillae Caulis samples were collected from 12 producing areas such as Hebei， Anhui and Guangdong， and their diameter range， epidermis color and producing areas were recorded. Total flavonoids， total phenols， volatile oils， 5 active components and 84 volatile components in 32 batches of samples were quantitatively or semi-quantitatively determined by colorimetry， ultra performance liquid chromatography-photodiode array detector（UPLC-PDA） and gas chromatography-mass spectrometry（GC-MS）. Then the differences between the contents of these components were analyzed by principal component analysis（PCA） and non-parametric test. According to the weights of the index components determined by PCA model， entropy weight-technique for order preference by similarity to ideal solution（TOPSIS） model was constructed to evaluate the quality of Perillae Caulis with different characters and origins. ResultsThere were significant differences in the composition of Perillae Caulis with different diameters， epidermis colors and producing areas， and 9 differential components were screened out， including 6 index constituents（total flavonoids， total phenols， caffeic acid， scutellarin， rosmarinic acid and luteolin） and 3 volatile components（caryophyllene oxide， （-）-humulene epoxide Ⅱ， 14-hydroxycaryophyllene）， of which 6 index constituents were higher in samples with small diameter， purple-brown epidermis and southern origin， while the contents of 3 volatile components were higher in samples with large diameter， dark-brown epidermis and northern origin. A significant difference was shown in the model scores of different diameters， epidermis colors and origins（P<0.05）， and the scores of Perillae Caulis with small diameter and purple-brown epidermis from southern area， especially Guangdong， had a high score. ConclusionThere are significant differences in the composition and content of chemical constituents between different diameters， epidermal colors and production areas of Perillae Caulis， samples showing small diameter， owing purple-brown epidermis， and originating from Guangdong were of higher-quality due to their higher content of 8 key indices.

ObjectiveTo explore quality difference factors of Perillae Caulis based on the contents of multiple chemical components and comprehensively evaluate the quality. MethodsA total of 32 batches of Perillae Caulis samples were collected from 12 producing areas such as Hebei， Anhui and Guangdong， and their diameter range， epidermis color and producing areas were recorded. Total flavonoids， total phenols， volatile oils， 5 active components and 84 volatile components in 32 batches of samples were quantitatively or semi-quantitatively determined by colorimetry， ultra performance liquid chromatography-photodiode array detector（UPLC-PDA） and gas chromatography-mass spectrometry（GC-MS）. Then the differences between the contents of these components were analyzed by principal component analysis（PCA） and non-parametric test. According to the weights of the index components determined by PCA model， entropy weight-technique for order preference by similarity to ideal solution（TOPSIS） model was constructed to evaluate the quality of Perillae Caulis with different characters and origins. ResultsThere were significant differences in the composition of Perillae Caulis with different diameters， epidermis colors and producing areas， and 9 differential components were screened out， including 6 index constituents（total flavonoids， total phenols， caffeic acid， scutellarin， rosmarinic acid and luteolin） and 3 volatile components（caryophyllene oxide， （-）-humulene epoxide Ⅱ， 14-hydroxycaryophyllene）， of which 6 index constituents were higher in samples with small diameter， purple-brown epidermis and southern origin， while the contents of 3 volatile components were higher in samples with large diameter， dark-brown epidermis and northern origin. A significant difference was shown in the model scores of different diameters， epidermis colors and origins（P<0.05）， and the scores of Perillae Caulis with small diameter and purple-brown epidermis from southern area， especially Guangdong， had a high score. ConclusionThere are significant differences in the composition and content of chemical constituents between different diameters， epidermal colors and production areas of Perillae Caulis， samples showing small diameter， owing purple-brown epidermis， and originating from Guangdong were of higher-quality due to their higher content of 8 key indices.

Objective To construct a key technical indicator system for in-hospital treatment and nursing of patients with nuclear radiation injury, and provide a basis for the implementation of such treatment and nursing. Methods The draft of the key technical indicator system for in-hospital treatment and nursing of patients with nuclear radiation injury was determined by literature review, case study, and field investigation. The indicators of the system were determined through two rounds of Delphi consultation and using the precedence chart method. According to the criteria of indicator evaluation, the reliability of expert opinions, and the opinions of the research group, the indicators were refined and evaluated. Results Twenty experts were included for two rounds of consultation via mailed inquiries, with a 100% effective response rate in both rounds. The expert authority coefficients were both 0.945, and the Kendall’s W values were 0.347 and 0.448, respectively (P < 0.05). Following the expert consultations, 1 indicator was deleted, 12 indicators were added, and 6 indicators were modified. The key technical indicator system for in-hospital treatment and nursing of patients with nuclear radiation injury established in this study included 4 first-level indicators, 17 second-level indicators, and 73 third-level indicators. The means of importance assignment for all indicators were > 4.00, and the coefficients of variation were < 0.25. Conclusion The key technical indicator system for in-hospital treatment and nursing of patients with nuclear radiation injury established in this study is scientifically rigorous and practically grounded. The indicators demonstrate strong professional relevance and provide important guidance for in-hospital treatment and nursing of patients with nuclear radiation injury.

Objective: To develop a simple digital chylous plasma device and validate its ability to accurately, standardly, and non-destructively determine chylous plasma in blood banks and clinical transfusions in hospitals. Methods: A digital chylous plasma assessment device was designed and manufactured. This device was used to measure the chylous degrees of chylous plasma samples before freezing, after freeze-thawing, before viral inactivation, and after viral inactivation. The measured chylosity index values were categorized according to the requirements specified in Appendix A of the Chinese national standard GB 18469-2001 "Quality Requirements for Whole Blood and Blood Components". This process established a digital standard for chylous plasma, enabling the identification of severe, moderate and mild chylous plasma, and non-chylous plasma. Results: The initial simple product of the digital chylous assessment device was successfully designed and manufactured. There was no significant difference in the degree of chylous plasma between pre-freezing 468.11±217.73 lux and post-thawing 538.91±273.39 lux of chylous plasma (P>0.05), or between pre-viral inactivation 858.33±387.79 lux and post-viral inactivation 928.33±166.51 lux of chylous plasma (P>0.05). The median of chylous degree values for plasma chylous index grades 0 to 6 were 45 lux, 250 lux, 620 lux, 835 lux, 1 130 lux, 1 390 lux, and 1 700 lux, respectively. The defined cutoff values/ranges for the chylous degree values corresponding to plasma chylous index grade 0 to 6 were ≤125 lux, 126-465 lux, 466-740 lux, 741-1 000 lux, 1 001-1 233 lux, 1 234-1 560 lux, and ≥1 561 lux. Conclusion: This study successfully developed the initial product of the digital chylous device and established digital standards for classifying chylous plasma. The device demonstrates the potential to meet the needs for assessment of chylous plasma in both blood banks and clinical transfusions in hospitals, thereby promoting the development and application of standardized, non-destructive chylous plasma assessment technology.

The concept of holism is the core idea of traditional Chinese medicine （TCM）. Various organs and tissues coordinate with each other to maintain the body's life activities， with a close and mutual influence between the spleen， stomach， and the central nervous system （brain）. The gut-brain axis plays an important bridging role between the digestive system and the central nervous system， achieving bidirectional information exchange between the brain and the gastrointestinal tract through complex neuroendocrine and immune mechanisms. The theory of cross-organ interaction involves the mutual influence， coordination， and integration between different organs and systems； multimodality， on the other hand， utilizes multiple sensory modalities， such as vision， hearing， and touch， to convey information. By combining TCM theory with the gut-brain axis theory， a cross-organ multimodal characterization system is established to explore its mechanism and application value in refractory diseases such as functional gastrointestinal disorders， precancerous gastrointestinal diseases， Alzheimer's disease， Parkinson's syndrome， type 2 diabetes， and depression.

ObjectiveTo establish the fingerprints of 15 batches of Hengzhi Kechuan capsules， to quantitatively analyze 10 index components， and to evaluate the quality uniformity of samples from different batches. MethodsThe fingerprints and quantitative analysis of Hengzhi Kechuan capsules were established by a combination method of high performance liquid chromatography coupled with diode array detector and charged aerosol detector（HPLC-DAD-CAD）， adenosine， guanosine， vanillic acid， safflomin A， agarotetrol， naringin， hesperidin， militarine， ginsenoside Rb₁， and glycyrrhizic acid were selected as quality attribute indexes. A total of 15 batches of Hengzhi Kechuan capsules from 2022 to 2024（3 boxes per batch） were qualitatively and quantitatively analyzed， and the quality uniformity level of the manufacturers was characterized by parameters of intra-batch consistency（P_A） and inter-batch consistency（P_B）. The homogeneity and difference of quality attribute indexes of samples from different years were analyzed by heatmap clustering analysis. ResultsHPLC fingerprints and quantitative method of Hengzhi Kechuan capsules were established， and the methods could be used for qualitative and quantitative analysis of this preparation， which was found to be stable and reliable by method validation. The similarity of fingerprints of 15 batches of samples was 0.887-0.975， a total of 13 common peaks were calibrated， and 10 common peaks were designated， all of which were quality attribute index components. The results of quantitative analysis showed that the contents of the above 10 ingredients in the samples were 0.038-0.078， 0.115-0.251， 0.007-0.018， 0.291-0.673， 0.122-0.257， 0.887-1.905， 1.841-3.364， 1.412-2.450， 2.207-3.112， 0.650-1.161， respectively. And the contents of ginsenoside Rb₁ and glycyrrhizic acid met the limit requirements in the 2020 edition of Chinese Pharmacopoeia. For the samples from 15 batches， the P_A values of the 10 index components were all <10%， indicating good intra-batch homogeneity， and the P_B values ranged from 33.86% to 92.97%， suggesting that the inter-batch homogeneity was poor. Heatmap clustering analysis showed that the samples from different years were clustered into separate categories， and adenosine， guanosine， safflomin A， naringin， hesperidin and agarotetrol were the main differential components. ConclusionThe intra-annual quality uniformity of Hengzhi Kechuan capsules is good and the inter-annual quality uniformity is insufficient， which may be related to the quality difference of Pinellinae Rhizoma Praeparatum， Carthami Flos， Citri Sarcodactylis Fructus， Citri Reticulatae Pericarpium， Aquilariae Lignum Resinatum， Citri Fructus， etc. In this study， the fingerprint and multi-indicator determination method of Hengzhi Kechuan capsules was established， which can be used for more accurate and efficient quality control and standardization enhancement.

BACKGROUND:Spinal canal decompression using uniportal endoscopic surgery is a new minimally invasive surgery in the treatment of lumbar spinal stenosis.However,this technique needs a steep learning curve and high requirements for surgical equipment and instruments,which limits its clinical application.We previously use the spinal endoscopy as a monitoring endoscopy and combined with unilateral biportal endoscopy to propose a hybrid technique of spinal endoscopy to achieve coaxial endoscopic operation and hands-separate operation. OBJECTIVE:To compare the clinical outcome of hybrid technique and uniportal endoscopic surgery in treatment of lumbar spinal stenosis with bilateral lower limb pain symptoms. METHODS:Ninety patients diagnosed of lumbar spinal stenosis with bilateral symptoms were included and retrospectively analyzed at First People's Hospital,Shanghai Jiao Tong University from August 2020 to August 2022.44 cases were included in group A(hybrid technique group),while 46 cases were included in group B(uniportal endoscopic surgery).The nerve decompression was observed during the surgery.Operation time,hospital stay time,and expenses were recorded in both groups.The visual analog scale scores of lower back pain and both lower extremities pain,Oswestry disability index scores of quality of life and excellent and good rate of modified Macnab criteria were recorded and compared at preoperative,postoperative 3 days,and postoperative 3 and 6 months. RESULTS AND CONCLUSION:(1)The operation time of group A was significantly shorter than that of group B(P<0.05).(2)The lower back pain and lower extremity pain of the severe side at postoperative 3 days,and 3 and 6 months were significantly relieved in both groups(P<0.05).The visual analog scale score of lower extremity pain on the mild side was significantly decreased at postoperative 3 days,3 and 6 months than preoperative score in the group A(P<0.05).The visual analog scale score of lower extremity pain on the mild side was significantly decreased at postoperative 3 days than preoperative score in the group B(P<0.05).The visual analog scale scores of lower extremity pain on the mild side at postoperative 3 and 6 months did not show significant difference than preoperative score in the group B.The comparison between the two groups showed that there was no significant difference in the visual analog scale scores of postoperative lower back pain and lower extremity pain of the severe side(P>0.05).The visual analog scale scores of lower extremity pain on the mild side in the group A were significantly lower than those of group B at postoperative 3 and 6 months(P<0.05).(3)The Oswestry disability index scores of both groups at postoperative 3 day were significantly lower than preoperative score(P<0.05),and there was no significant difference between the two groups 3 days after operation.Oswestry disability index scores of group A at postoperative 3 and 6 months were significantly decreased than preoperative score(P<0.05).The Oswestry disability index scores of group B at postoperative 3 and 6 months did not show significant differences than preoperative score(P>0.05).The comparison between the two groups showed the Oswestry disability index scores of group A were significantly lower than group B at postoperative 3 and 6 months(P<0.05).(4)The results of modified Macnab showed that the excellent and good rate of group A was significantly higher than that of group B(95%,78%,P<0.05).(5)It is indicated that the hybrid technique is a new spinal endoscopy technique,which has the advantages of less trauma and faster recovery as a minimally invasive surgery.The clinical outcome of hybrid technique is superior to that of uniportal endoscopic surgery in the treatment of lumbar spinal stenosis with bilateral symptoms.Additionally,it also has the advantages of good operational flexibility and high decompression efficiency as an open surgery.