OBJECTIVE: To report on a rare case of Neurofibromatosis type 2 (NF2) manifesting as oculomotor nerve palsy and explore its genetic basis. METHODS: A patient with NF2 who had presented at Beijing Ditan Hospital Affiliated to Capital Medical University on July 10, 2021 was selected as the study subject. Cranial and spinal cord magnetic resonance imaging (MRI) was carried out on the patient and his parents. Peripheral blood samples were collected and subjected to whole exome sequencing. Candidate variant was verified by Sanger sequencing. RESULTS: MRI revealed bilateral vestibular Schwannomas, bilateral cavernous sinus meningiomas, popliteal neurogenic tumors, and multiple subcutaneous nodules in the patient. DNA sequencing revealed that he has harbored a de novo nonsense variant of the NF2 gene, namely c.757A>T, which has replaced a codon (AAG) encoding lysine (K) at position 253 with a stop codon (TAG). This has resulted in removal of the Merlin protein encoded by the NF2 gene from position 253 onwards. The variant was not found in public databases. Bioinformatic analysis suggested that the corresponding amino acid is highly conserved. Based on the guidelines from the American College of Medical Genetics and Genomics (ACMG), the variant was rated as pathogenic (PVS1+PS2+PM2_Supporting+PP3+PP4). CONCLUSION The heterozygous nonsense variant c.757A>T (p.K253*) of the NF2 gene probably underlay the disease in this patient with an early onset, atypical but severe phenotype.
Male ; Humans ; Neurofibromatosis 2/genetics* ; Genes, Neurofibromatosis 2 ; Oculomotor Nerve Diseases/genetics* ; Computational Biology ; Genomics ; Mutation

Cochlear Implantation ; Genes, Neurofibromatosis 2 ; Humans ; Neurofibromatosis 2/surgery* ; Neuroma, Acoustic/surgery* ; Sequence Deletion

BACKGROUND: We previously reported the frequent neurofibromatosis 2 (NF2) gene mutations in anaplastic thyroid cancers in association with the BRAF V600E mutation. We aimed to investigate the role of NF2 in thyroid cancer with BRAF mutation. METHODS: To identify the function of NF2 in thyroid cancers, we investigated the changes in cell proliferation, colon formation, migration and invasion of thyroid cancer cells (8505C, BHT101, and KTC-1) with BRAF V600E mutation after overexpression and knock-down of NF2. We also examined how cell proliferation changed when NF2 was mutagenized. Human NF2 expression in papillary thyroid carcinoma (PTC) was analyzed using the The Cancer Genome Atlas (TCGA) data. RESULTS: First, NF2 was overexpressed in 8505C and KTC-1 cells. Compared to control, NF2 overexpressed group of both thyroid cancer cells showed significant inhibition in cell proliferation and colony formation. These results were also confirmed by cell migration and invasion assay. After knock-down of NF2 in 8505C cells, there were no significant changes in cell proliferation and colony formation, compared with the control group. However, after mutagenized S288* and Q470* sites of NF2 gene, the cell proliferation increased compared to NF2 overexpression group. In the analysis of TCGA data, the mRNA expression of NF2 was significantly decreased in PTCs with lateral cervical lymph node (LN) metastasis compared with PTCs without LN metastasis. CONCLUSION: Our study suggests that NF2 might play a role as a tumor suppressor in thyroid cancer with BRAF mutation. More studies are needed to elucidate the mechanism how NF2 acts in thyroid cancer with BRAF mutation.
Cell Movement ; Cell Proliferation ; Colon ; Genes, Neurofibromatosis 2 ; Genes, Tumor Suppressor ; Genome ; Humans ; Lymph Nodes ; Neoplasm Metastasis ; Neurofibromatosis 2 ; RNA, Messenger ; Thyroid Carcinoma, Anaplastic ; Thyroid Gland ; Thyroid Neoplasms

PURPOSE: Neurofibromatosis type 2 (NF2) is characterized by multiple tumors, including vestibular schwannoma (VS) and others affecting cranial and peripheral nerves. NF2 is caused by mutation of the NF2 gene. The mutation spectrum of NF2 has not been characterized in Korean patients. In the current study, the clinical and genetic characteristics of Korean NF2 patients were analyzed. MATERIALS AND METHODS: Twenty-five unrelated Korean families were enrolled according to the Manchester criteria. Genetic analysis was performed by direct sequencing and multiplex ligation-dependent probe amplification methods using genomic DNA from peripheral lymphocytes or tumor tissues. RESULTS: All patients had bilateral/unilateral VS and/or other cranial and peripheral nerve tumors. Two patients were familial cases and the other 24 patients were sporadic. Germline NF2 mutations were detected in peripheral lymphocytes from both familial cases, but only in 26.1% of the 23 sporadic families. Somatic mutations were also found in tumor tissues from two of the sporadic families. These somatic mutations were not found in peripheral lymphocytes. A total of 10 different mutations including 2 novel mutations were found in 40.0% of studied families. Five mutations (50.0%) were located in exon 6 of NF2, the FERM domain coding region. CONCLUSION: Family history was an important factor in identifying germline NF2 mutations. Further study is required to investigate whether exon 6 is a mutation hotspot in Korean NF2 patients and its correlation to phenotypic severity.
Clinical Coding ; DNA ; Exons ; Genes, Neurofibromatosis 2 ; Humans ; Korea ; Lymphocytes ; Multiplex Polymerase Chain Reaction ; Neurofibromatoses* ; Neurofibromatosis 2* ; Neuroma, Acoustic ; Peripheral Nerves ; Peripheral Nervous System Neoplasms

OBJECTIVETo explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.

METHODSSamples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.

RESULTSFour de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.

CONCLUSIONThe occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.

Adult ; Aged ; Female ; Genes, Neurofibromatosis 2 ; Humans ; Male ; Middle Aged ; Mutation ; Neurilemmoma ; genetics ; Spinal Cord Neoplasms ; genetics

Neurofibromatosis 2 is a multiple neoplasia syndrome that is caused by mutations in the NF2 tumor suppressor gene on chromosome 22q12. Bilateral vestibular nerve schwannomas are the distinctive feature of neurofibromatosis 2. There have been no reported cases of breast cancer in patients with neurofibromatosis 2. We recently encountered a case of breast cancer in a 46-year-old woman with neurofibromatosis 2. She had had a palpable right beast mass for the previous year andtinnitus in her left ear for the previous 6 months. She was diagnosed with breast cancer (invasive ductal carcinoma) with metastasis to the lungs, bones and stomach. MRI of the brain revealed nodules in both internal auditory canals, indicating that she was suffering from neurofibromatosis 2. After radiation therapy for compression fractures in T8 and L1, and one cycle of chemotherapy, the patient died of febrile neutropenia and pneumonia.
Brain ; Breast ; Breast Neoplasms ; Ear ; Female ; Fractures, Compression ; Genes, Tumor Suppressor ; Humans ; Lung ; Middle Aged ; Neoplasm Metastasis ; Neurilemmoma ; Neurofibromatoses ; Neurofibromatosis 2 ; Neutropenia ; Pneumonia ; Stomach ; Stress, Psychological ; Vestibular Nerve

OBJECTIVE: To determine the expression and clinical significance of Merlin protein in non-small cell lung cancer (NSCLC). METHODS: The expression of Merlin protein in 45 cases of NSCLC and adjacent tissue of NSCLC and normal lung tissue was checked by immunohistochemistry. The relation between the expression of Merlin protein and the multiple factors of pathological type, gender, P-TNM stage, differentiation and lymph node metastasis was analyzed. RESULTS: The expression rates of Merlin protein in NSCLC and normal lung tissue sections were 73.33% and 15.56%, respectively (P<0.05). The expression of Merlin protein was not associated with the pathological type, gender, P-TNM stage, differentiation and lymph node metastasis (P>0.05). CONCLUSION Merlin protein might contribute to the initiation of metastasis of NSCLC.
Adult ; Aged ; Carcinoma, Non-Small-Cell Lung ; metabolism ; pathology ; Female ; Genes, Neurofibromatosis 2 ; physiology ; Humans ; Lung Neoplasms ; metabolism ; pathology ; Male ; Middle Aged ; Neoplasm Metastasis ; Neurofibromin 2 ; metabolism

Acoustic tumor is the most common tumor originating from cerebellopontine angle. Acoustic tumor is benign and main origin of this tumor is vestibular nerve. This tumor arises in Schwann cell (SC) and is encapsulated. Recently, the tumor is called vestibular schwannoma (VS). VS is classified to two type by epidemiology, sporadic form and neurofibromatosis type 2 (NF2). NF2 is autosomal dominant inherent disorder. This tumor is characterized bilateral VS, brain tumors such as meningioma and ependymoma, and spinal or cranial nerve schwannoma. Genetic studies suggested that NF2 is caused by abnormality or mutation of NF2 gene in chromosome 22q12. Both of them are known to develop the tumor by mutation of NF2 gene. Merlin is the cytoskeletal protein product of the NF2 tumor suppressor gene that mediates cell to cell contact information to regulate SC proliferation and survival. And merlin is highly homologous to ERM proteins. Merlin function is regulated by its conformation, adopting an inactive, growth permissive state following serine 518 (S518) phosphorylation. In NF2 patients, the precise mechanisms of developing the VS are unclear. But, the abnormalities of merlin are confirmed by many studies. And now, a lot of research about merlin function is progressing. In this study, the author would introduce about merlin (structure, function, molecular pathway, tumorigenesis and regulation) which leads to VS and molecular studies about merlin, and suggest the future direction of research.
Brain Neoplasms ; Cell Transformation, Neoplastic ; Cerebellopontine Angle ; Cranial Nerves ; Ependymoma ; Genes, Neurofibromatosis 2 ; Genes, Tumor Suppressor ; Humans ; Meningioma ; Neurilemmoma ; Neurofibromatosis 2 ; Neurofibromin 2 ; Neuroma, Acoustic ; Phosphorylation ; Proteins ; Serine ; Vestibular Nerve

BACKGROUND: Neurofibromatosis type 2 (NF2) is an autosomal dominant syndrome caused by the NF2 tumor suppressor gene. However, the NF2 mutation characteristics in Korean patients are not sufficiently understood. In this study, we conducted a comprehensive mutational analysis in 7 Korean NF2 patients by performing direct sequencing and gene-dosage assessment. METHODS: We analyzed all exons and flanking regions of NF2 by direct sequencing and screened the deletions or duplications involving NF2 by multiplex ligation-dependent probe amplification. RESULTS: Four novel NF2 mutations, including 2 splice-site mutations (c.364-1G>A and c.886-3C>G), 1 frameshift mutation (c.524delA), and 1 missense mutation (c.397T>C; p.Cys133Arg), were identified in our patients. No large deletion or duplication was identified in our series. Subsequently, we identified an abnormal splicing product by using reverse transcription-PCR and direct sequencing in 2 patients with a novel splice-site mutation. The missense mutation c.397T>C was predicted to have harmful effects on protein function. CONCLUSIONS: The detection rate of NF2 mutations in Korean patients (57%) is similar to those in other populations. Our results provided a greater insight into the mutational spectrum of the NF2 gene in Korean subjects.
3' Flanking Region/genetics ; 5' Flanking Region/genetics ; Adult ; Aged ; Amino Acid Sequence ; Asian Continental Ancestry Group/*genetics ; Child, Preschool ; Exons ; Female ; Frameshift Mutation ; *Genes, Neurofibromatosis 2 ; Humans ; Male ; Middle Aged ; Molecular Sequence Data ; *Mutation ; Mutation, Missense ; Neurofibromatosis 2/diagnosis/*genetics ; RNA Splice Sites ; Republic of Korea ; Sequence Analysis, DNA ; Young Adult

We report a case of an intraneural perineurioma that developed in an unusual location, the tongue. A 16-year-old male presented with a 1 cm sized protruding submucosal mass in his tongue without any sensory or motor signs or symptoms. The mass was excised. The mucosa was intact, with an ill-defined firm mass measuring 1.0 x 0.8 x 0.6 cm in the submucosa and muscle. The cut surface of the mass was pinkish gray and fibrotic. Microscopically, the mass contained tortuous and thickened peripheral nerve bundles in the submucosa, showing onion bulb like structures. The onion bulb like structures consisted of centrally located S-100 protein positive Schwann cells surrounded by Glut-1 positive perineurial cells. The FISH study did not reveal any genetic aberrations in chromosome 22.
Adolescent ; Chromosomes, Human, Pair 22 ; Genes, Neurofibromatosis 2 ; Humans ; Immunohistochemistry ; In Situ Hybridization, Fluorescence ; Male ; Mucous Membrane ; Nerve Sheath Neoplasms* ; Onions ; Peripheral Nerves ; S100 Proteins ; Schwann Cells ; Tongue Neoplasms ; Tongue*