Purpose: To investigate the therapeutic potential of eliminating insulin-like growth factor-binding protein 5 (IGFBP5) expression in improving erectile function in mice with cavernous nerve injury (CNI)-induced erectile dysfunction (ED). Materials and Methods: Eight-week-old male C57BL/6 mice were divided into four groups: a sham-operated group and three CNI-induced ED groups. The CNI-induced ED groups were treated with intracavernous injections 3 days before the CNI procedure.These injections included phosphate-buffered saline, scrambled control short hairpin RNA (shRNA), or shRNA targeting mouse IGFBP5 lentiviral particles. One week after CNI, erectile function was evaluated and the penile tissue was then harvested for histological examination and western blot analysis. Additionally, the major pelvic ganglia (MPG) and dorsal root ganglia (DRG) were cultured for ex vivo neurite outgrowth assays. Results: Following CNI, IGFBP5 expression in the cavernous tissues significantly increased, reaching its peak at day 7. First, ablation of IGFBP5 expression promotes neurite sprouting in MPG and DRG when exposed to lipopolysaccharide. Second, ablating IGFBP5 expression in CNI-induced ED mice improved erectile function, likely owing to increased neurovascular contents, including endothelial cells, pericytes, and neuronal processes. Third, ablating IGFBP5 expression in CNI-induced ED mice promoted neurovascular regeneration by increasing cell proliferation, reducing apoptosis, and decreasing Reactive oxygen species production. Finally, western blot analysis demonstrated that IGFBP5 ablation attenuated the JNK/c-Jun signaling pathway, activated the PI3K/AKT signaling pathway, and increased vascular endothelial growth factor and neurotrophic factor expression. Conclusions Ablating IGFBP5 expression enhanced neurovascular regeneration and ultimately improved erectile function in CNI-induced ED mice.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Objective: To explore the association between the Internet usage characteristics and suicidal ideation among vocational high school students, so as to provide a theoretical basis for precise intervention of suicide among vocational high school students. Methods: A total of 1 781 students were recruited from three vocational high schools in Wuhan and Xianning in March 2023 by using the cluster random sampling method. The Columbia-Suicide Severity Rating Scale and Revised Chen Internet Addiction Scale were used to measure suicidal ideation and Internet addiction, respectively. LASSO regression model was used to select influential factors related to suicidal ideation, and the gradient boosting decision tree algorithm XGBoost was used to develop prediction models and evaluate predictive performance. By calculating the SHAP values, the contribution of each influential factor was quantified. Results: The prevalence of suicidal ideation among vocational high school students was 42.22% and prevalence of Internet addiction was 26.39%. LASSO regression results indicated that age, gender, experience of being left behind, parental relationship, holding a class cadre position, using the Internet for learning, Internet use during dawn, morning and late night, Internet addiction, and depressive symptoms were all the influential factors of suicidal ideation among vocational high school students ( β= -0.05 , 0.29, 0.09, 0.27, 0.10, -0.01, 0.09, 0.05, 0.24, 0.28, 0.78, all P <0.05). The AUC of the prediction model was 0.75. The results based on SHAP values indicated that all influential factors identified through multivariate analysis contributed positively to the model predictions ( SHAP >0). Among these, depressive symptoms and parental relationship had the greatest impact on suicidal ideation ( SHAP =0.77, 0.26), and the joint effect of features with higher contribution could improve the prediction probability. Conclusions Depressive symptoms, parental relationships, Internet addiction, and time of Internet use are most important risk factors of suicidal behaviors for vocational high school students. Thus, effective interventions should be conducted to reduce their suicidal ideation.

Coronary restenosis is an important cause of poor long-term prognosis in patients with coronary heart disease. Here, we show that lysine methyltransferase SMYD2 expression in the nucleus is significantly elevated in serum- and PDGF-BB-induced vascular smooth muscle cells (VSMCs), and in tissues of carotid artery injury-induced neointimal hyperplasia. Smyd2 overexpression in VSMCs (Smyd2-vTg) facilitates, but treatment with its specific inhibitor LLY-507 or SMYD2 knockdown significantly inhibits VSMC phenotypic switching and carotid artery injury-induced neointima formation in mice. Transcriptome sequencing revealed that SMYD2 knockdown represses the expression of serum response factor (SRF) target genes and that SRF overexpression largely reverses the inhibitory effect of SMYD2 knockdown on VSMC proliferation. HDAC3 directly interacts with and deacetylates SRF, which enhances SRF transcriptional activity in VSMCs. Moreover, SMYD2 promotes HDAC3 expression via tri-methylation of H3K36 at its promoter. RGFP966, a specific inhibitor of HDAC3, not only counteracts the pro-proliferation effect of SMYD2 overexpression on VSMCs, but also inhibits carotid artery injury-induced neointima formation in mice. HDAC3 partially abolishes the inhibitory effect of SMYD2 knockdown on VSMC proliferation in a deacetylase activity-dependent manner. Our results reveal that the SMYD2-HDAC3-SRF axis constitutes a novel and critical epigenetic mechanism that regulates VSMC phenotypic switching and neointimal hyperplasia.

Aim To analyze the anti-A549 and HI299 lung ade-nocarcinoma activities via using examples of baicalin, astragalo-side, hesperidin and cisplatin based on real time cellular analysis (RTCA) technology, and to build a new strategy for EC50 e-valuation reflecting the time-dimensional characteristic. Methods Using RTCA Software Pro for data analysis and GraphPad Prism and Origin Pro plotting, the in vitro anti-A549 and H1299 lung adenocarcinoma activities of baicalin, astragaloside, hesperidin, and cisplatin were characterized using the endpoint method and time dimension, respectively. Results (X) There were significant differences in EC50 values of A549 and H1299 cells at 24 h and 48 h endpoint methods. (2) The correlation coefficient of the curve fitted with the four-parameter equation was > 0. 9, and the dynamic change of EC50 remained relatively stable (the linear fitting of EC50 at adjacent 4 points I slope 1^1) used to calculate the EC50 value within this time dimension. The EC50 of baicalin, astragaloside, hesperidin and cisplatin on A549 cells was 52. 97 ±1.75 плпо! • L~1(16~48 h) , 62.88 ± 2.91 ijunol • L"1 (32.25 -48 h) , 78.84 ±0.33 плпо1 • L"1 (21.5 -29.75 h), 13.57 ±1.54 плпо1 • L_1(27.5 -48 h), respectively; the EC50 of baicalin, astragaloside, hesperidin and cisplatin on H1299 cells was 43. 71 ± 1. 26 |лто1 • L_1 ( 19. 5 -48 h), 47.23 ±1. 19 |лто1 • L_1(14 -48 h) , 39.45 ±0.24 плпо1 • L"1 (12.75 -46.25 h), 25.97 ±4.76 плпо1 • L"1 (10. 25 -48 h) , respectively. The results showed that the time window for the anti-tumor effect of the test solution/drug was different. Conclusions Based on RTCA technology, it is more accurate and reasonable to select EC50 data that exhibit better fitting, stable changes, and time-dimensional characteristics for the evaluation of anti-tumor activity. In addition, this method of distinguishing different effective time of antitumor drugs can provide a reference for the timing of clinical combination drugs, and this approach will also provide a reference for further related studies.

Umbilical cord mesenchymal stem cells (UC-MSCs) have been widely used in regenerative medicine, but there is limited research on the stability of UC-MSCs formulation during production. This study aims to assess the stability of the cell stock solution and intermediate product throughout the production process, as well as the final product following reconstitution, in order to offer guidance for the manufacturing process and serve as a reference for formulation reconstitution methods. Three batches of cell formulation were produced and stored under low temperature (2-8 ℃) and room temperature (20-26 ℃) during cell stock solution and intermediate product stages. The storage time intervals for cell stock solution were 0, 2, 4, and 6 h, while for intermediate products, the intervals were 0, 1, 2, and 3 h. The evaluation items included visual inspection, viable cell concentration, cell viability, cell surface markers, lymphocyte proliferation inhibition rate, and sterility. Additionally, dilution and culture stability studies were performed after reconstitution of the cell product. The reconstitution diluents included 0.9% sodium chloride injection, 0.9% sodium chloride injection + 1% human serum albumin, and 0.9% sodium chloride injection + 2% human serum albumin, with dilution ratios of 10-fold and 40-fold. The storage time intervals after dilution were 0, 1, 2, 3, and 4 h. The reconstitution culture media included DMEM medium, DMEM + 2% platelet lysate, 0.9% sodium chloride injection, and 0.9% sodium chloride injection + 1% human serum albumin, and the culture duration was 24 h. The evaluation items were viable cell concentration and cell viability. The results showed that the cell stock solution remained stable for up to 6 h under both low temperature (2-8 ℃) and room temperature (20-26 ℃) conditions, while the intermediate product remained stable for up to 3 h under the same conditions. After formulation reconstitution, using sodium chloride injection diluted with 1% or 2% human serum albumin maintained a viability of over 80% within 4 h. It was observed that different dilution factors had an impact on cell viability. After formulation reconstitution, cultivation in medium with 2% platelet lysate resulted in a cell viability of over 80% after 24 h. In conclusion, the stability of cell stock solution within 6 h and intermediate product within 3 h meets the requirements. The addition of 1% or 2% human serum albumin in the reconstitution diluent can better protect the post-reconstitution cell viability.

Objective To observe the regulatory mechanism of drug-containing serum of Jinghou Zengzhi Prescription based on qi and blood replenishing method on the expression of growth and differentiation factor 9(GDF9)and apoptosis of ovarian granulosa cells in rats with controlled ovarian hyperstimulation(COH).Methods Serum of COH rats(blank serum)and serum of COH rats gavaged by the Jinghou Zengzhi Prescription were prepared.A COH rat model was established and ovarian granulosa cells were collected.The experiment was divided into 5 groups:blank serum group,drug-containing serum group,drug-containing serum+SB203580[p38 mitogen-activated protein kinase(p38MAPK)inhibitor]group,drug-containing serum + PDTC[nuclear transcription factor κB(NF-κB)inhibitor]group,drug-containing serum + SB203580 + PDTC group.The mRNA expression levels of p38MAPK,casein kinase 2(CK2),nuclear transcription factor κB inhibitor α(IκBα),NF-κB and GDF9 were detected by real-time quantitative polymerase chain reaction(qRT-PCR),and GDF9 protein expression level was detected by Western Blot,and ovarian granulosa cell apoptosis was detected by terminal-deoxynucleoitidyl transferase mediated nick end labeling(TUNEL).Results The drug-containing serum of Jinghou Zengzhi Prescription decreased the mRNA expressions of p38MAPK and NF-κB,elevated the mRNA expressions of CK2 and IκBα,increased the mRNA and protein expression levels of GDF9,and decreased the apoptosis rate of ovarian granulosa cells in COH rats.The addition of p38MAPK inhibitor SB203580 alone and the addition of NF-κB inhibitor PDTC alone both promoted the mRNA and protein expressions of GDF9 and reduced the apoptosis rate of granulosa cells.Conclusion The drug-containing serum of Jinghou Zengzhi Prescription based on qi and blood replenishing method can promote the expression of GDF9 and inhibit the apoptosis of ovarian granulosa cells in rats with COH,and its mechanism may be related to the regulation of the expression of genes of the dual signaling pathways of p38MAPK and NF-κB.

BACKGROUND:With the further development of minimally invasive concepts,unicompartmental knee arthroplasty has become an important treatment for osteoarthritis of the knee;however,early postoperative pain adversely affects the recovery process,so effective analgesic measures are necessary.Femoral nerve block and cocktail therapy are common analgesic methods for unicompartmental knee arthroplasty,but there is a lack of studies confirming the analgesic effect and safety of their combined application. OBJECTIVE:To investigate the analgesic effect of cocktail therapy combined with femoral nerve block in unicompartmental knee arthroplasty. METHODS:One hundred patients who received unicompartmental knee arthroplasty from October 2021 to January 2023 were selected as the study subjects.They were divided into a control group(n=50)and a study group(n=50)using a random number table method.The femoral nerve block was used in the control group,while cocktail therapy combined with femoral nerve block was used in the study group during unicompartmental knee arthroplasty.Postoperative analgesia effect,analgesic frequency of dezocine injection within 2 days after surgery,motion range of affected knee joint,KSS function scores,and the occurrence of postoperative adverse reactions were compared between the two groups. RESULTS AND CONCLUSION:(1)Visual analog scale scores in the study group were lower than those in the control group at 12,24,and 48 hours after surgery(P<0.05).(2)The analgesic frequency of dezocine in the study group was less than that in the control group within 2 days after surgery(P<0.05).(3)The motion range in the study group was higher than that in the control group 1 and 3 days after surgery(P<0.05).On day 14 after surgery,there was no significant difference in motion range between the two groups(P>0.05).(4)The knee KSS score in the study group was higher than that in the control group at 2 weeks after surgery(P<0.05).There was no statistically significant difference in knee KSS scores between the two groups from 6 weeks to 6 months after surgery(P>0.05).(5)The difference in the occurrence of adverse reactions within 14 days after surgery was not significant between the two groups(P>0.05).(6)These results show that the use of cocktail therapy combined with femoral nerve block in unicompartmental knee arthroplasty can effectively reduce postoperative pain,improve the analgesic effect,reduce the frequency of analgesic drugs,and improve motion range of the early affected knee joint of patients.

Objective To observe the efficacy and safety of Morinda officinalis oligosaccharides in the continuation treatment of mild and moderate depression.Methods An open,single-arm,multi-center design was adopted in our study.Adult patients with mild and moderate depression who had received acute treatment of Morinda officinalis oligosaccharides were enrolled and continue to receive Morinda officinalis oligosaccharides capsules for 24 weeks,the dose remained unchanged during continuation treatment.The remission rate,recurrence rate,recurrence time,and the change from baseline to endpoint of Hamilton Depression Scale(HAMD),Hamilton Anxiety Scale(HAMA),Clinical Global Impression-Severity(CGI-S)and Arizona Sexual Experience Scale(ASEX)were evaluated.The incidence of treatment-related adverse events was reported.Results The scores of HAMD-17 at baseline and after treatment were 6.60±1.87 and 5.85±4.18,scores of HAMA were 6.36±3.02 and 4.93±3.09,scores of CGI-S were 1.49±0.56 and 1.29±0.81,scores of ASEX were 15.92±4.72 and 15.57±5.26,with significant difference(P＜0.05).After continuation treatment,the remission rate was 54.59％(202 cases/370 cases),and the recurrence rate was 6.49％(24 cases/370 cases),the recurrence time was(64.67±42.47)days.The incidence of treatment-related adverse events was 15.35％(64 cases/417 cases).Conclusion Morinda officinalis oligosaccharides capsules can be effectively used for the continuation treatment of mild and moderate depression,and are well tolerated and safe.

Objective To explore the analgesic effect of different doses of dezocine combined with ropivacaine for thoracic paravertebral block(TPVB)on patients undergoing thoracoscopic radical resection of lung cancer and the influence on hemodynamics and immune function of patients.Methods Patients with lung cancer who underwent thoracoscopic radical resection were divided into low-dose group and high-dose group according to random number table method.Both groups of patients were given total intravenous anesthesia to complete the surgery.At 15 min before general anesthesia induction,the low-dose group was given TPBV with 0.1 mg·kg-1 dezocine+0.375％ropivacaine for a total of 20 mL,and the high-dose group was given TPBV with 0.15 mg·kg-1 dezocine+0.375％ropivacaine for a total of 20 mL.Comparisons were performed on both groups in terms of analgesic effect,hemodynamic parameters,immune function and occurrence of adverse drug reactions.Results There were 48 cases in low-dose group and 46 cases in high-dose group.In low-dose group,the heart rate values before TPVB,before skin incision,at 5 min after sectioning and at the end of surgery were(78.52±6.54),(70.79±7.07),(74.48±6.68)and(76.69±7.29)beat·min-1,the mean arterial pressure values were(93.16±5.72),(86.38±7.51),(92.15±6.36)and(91.14±6.13)mmHg.In high-dose group,the heart rate values at the above time points were(79.36±7.11),(71.68±6.49),(74.76±7.06)and(76.57±6.52)beat·min-1;the mean arterial pressure values were(93.89±7.18),(85.27±7.41),(90.34±6.52)and(92.43±6.34)mmHg,there were no statistical differences between the two groups(all P＞0.05).The resting state scores at 2,6 and 12 h after surgery were(1.38±0.19),(1.54±0.21)and(1.72±0.16)points,the pain scores at motion state were(1.88±0.15),(2.36±0.37)and(3.26±0.38)points in low-dose group;in high-dose group,the resting state scores were(1.32±0.17),(1.58±0.22)and(1.81±0.18)points,the pain scores at motion state were(1.81±0.13),(2.11±0.31)and(3.03±0.36)points,respectively,there were no statistical differences between the two groups(all P＞0.05).The number of analgesic pump compressions at 24 h after surgery and the number of cases with analgesic remedy were(5.12±1.26)times and 15 cases in low-dose group and were(4.74±1.03)times and 10 cases in high-dose group,with no statistical differences between the groups(all P＞0.05).The percentages of CD3+cells in low-dose group at the end of surgery and at 12 h and 24 h after surgery were(68.51±6.76)％,(54.22±5.43)％and(51.47±6.58)％,the percentages of CD4+cells were(40.29±5.02)％,(34.94±4.79)％and(30.48±5.11)％,CD4+/CD8+ratios were 1.54±0.34,1.36±0.28 and 1.16±0.23;the percentages of CD3+cells in high-dose group were(67.92±7.11)％,(56.58±6.36)％and(54.47±6.89)％,percentages of CD4+cells were(41.33±5.75)％,(35.86±5.21)％and(32.27±4.78)％,the CD4+/CD8+were 1.53±0.35,1.40±0.30 and 1.22±0.26,all with no significant difference(all P＞0.05).The incidence of postoperative adverse drug reactions in high-dose group and low-dose group were 32.61％and 14.58％,with significant difference(P＜0.05).Conclusion When TPVB regimen of dezocine combined with ropivacaine is used in thoracoscopic radical resection of lung cancer,the analgesic effect of low-dose dezocine is comparable to that of high-dose dezocine,with lower risk of adverse drug reactions.