1.Inverse distance weight interpolation method for missing data of PM2.5 spatiotemporal series
Yurou LIANG ; Hongling WU ; Weipeng WANG ; Feng CHENG ; Ping DUAN
Journal of Environmental and Occupational Medicine 2025;42(2):171-178
Background Fine particulate matter (PM2.5) monitoring stations may generate missing data for a certain period of time due to various factors. This data loss will adversely affect air quality assessment and pollution control decision-making. Objective To propose an inverse distance weighted (IDW) spatiotemporal interpolation method based on particle swarm optimization (PSO) to interpolate and fill missing PM2.5 spatiotemporal sequence data and increase interpolation accuracy. Methods An interpolation experiment was designed into two parts. The first part used hourly PM2.5 observational data from four moments on January 1, 2017 in the Yangtze River Delta region. The second part employed daily PM2.5 observational data from the first 10 d of January 2017 in the Beijing-Tianjin-Hebei region. Interpolation accuracy was evaluated using four metrics: root mean square error (RMSE), mean absolute error (MAE), mean absolute percentage error (MAPE), and mean relative error (MRE). Results IDW spatiotemporal interpolation method optimized with PSO significantly improved the accuracy of filling missing PM2.5 spatiotemporal sequence data. In the hourly-scale experiment conducted in the Yangtze River Delta region, compared to a distance index of 2, the accuracy metrics RMSE, MAE, MAPE, and MRE generated by the proposed method improved on average by 0.17 μg·m−3, 0.27 μg·m−3, 0.17%, and 0.01%, respectively. The PM2.5 spatial field maps generated for four moments based on this method clearly illustrated the spatiotemporal distribution characteristics of hourly PM2.5 concentrations in the Yangtze River Delta region. In the daily-scale experiment conducted in the Beijing-Tianjin-Hebei region, the PSO-optimized distance index outperformed the traditional method, with interpolation accuracy improvements of approximately 0.215 μg·m−3, 0.283 μg·m−3, 0.174%, and 0.014%, respectively. Furthermore, the seasonal PM2.5 spatial field maps generated by this method revealed the spatiotemporal distribution characteristics of PM2.5 concentrations in the Beijing-Tianjin-Hebei region across different seasons, further validating the effectiveness and applicability of this method. Conclusion The IDW spatiotemporal interpolation method optimized with PSO is highly accurate and reliable for interpolating the missing data in the Yangtze River Delta region and the Beijing-Tianjin-Hebei region, providing valuable insights for air pollution control and public health protection.
2.Identification of unknown pollutants in drinking water based on solid-phase extraction and supramolecular solvent extraction
Zixin QIAN ; Yuhang CHEN ; Chao FENG ; Yuanjie LIN ; Qian XU ; Ziwei LIANG ; Xinyu WANG ; Dasheng LU ; Ping XIAO ; Zhijun ZHOU
Journal of Environmental and Occupational Medicine 2025;42(7):854-861
Background With the progression of industrialization, an increasing number of emerging contaminants are entering aquatic environments, posing significant threats to the safety of drinking water. Therefore, establishing a system for identifying unknown hazardous factors and implementing safety warning mechanisms for drinking water is of paramount importance. Among these efforts, non-target screening plays a critical role, but its effectiveness is largely constrained by the scope of coverage of sample pre-treatment methods. Objective To integrate modern chromatography/mass spectrometry techniques with advanced data mining methods to develop a non-discriminatory sample pre-treatment method for comprehensive enrichment of unknown contaminants in drinking water, laying a technical foundation for the discovery and identification of unknown organic hazardous factors in drinking water. Methods A non-discriminatory pre-treatment method based on supramolecular and solid-phase extraction was developed. The final target compounds including 333 pesticides, 194 pharmaceuticals and personal care products (PPCPs), and 59 per- and polyfluoroalkyl substances (PFASs) were used for optimizing the pre-treatment method, confirming its coverage. The impacts of different eluents on the absolute recovery rates of target compounds were compared to select the conditions with the highest recovery for sample pre-treatment. The effects of different supramolecular solvents and salt concentrations on target compound recovery were also evaluated to determine the most suitable solvent and salt concentration. Results The solid-phase extraction elution solvents, supramolecular extraction solvents, and salt concentrations were optimized based on the target compound recovery rates. The optimal recovery conditions were achieved using 2 mL methanol, 2 mL methanol (containing 1% formic acid), 2 mL ethyl acetate, 2 mL dichloromethane, hexanediol supramolecular solvent, and 426 mg salt. The detection method developed based on these conditions showed a good linear relationship for all target compounds in the range of 0.1-100.0 ng·mL−1, with R² > 0.99. The method’s limit of detection ranged from 0.01 ng−1 to 0.95 ng−1, and 95% of target compounds were recovered in the range of 20%-120%, with relative standard deviation (RSD) less than 30%, indicating good precision. Conclusion The combined pre-treatment method of solid-phase extraction and supramolecular solvent extraction can effectively enrich contaminants in drinking water across low, medium, and high polarities, enabling broad-spectrum enrichment of diverse trace contaminants in drinking water. It provides technical support for broad-spectrum, high-throughput screening and identification of organic pollutants in drinking water, and also serves as a reference for establishing urban drinking water public safety warning systems.
3.Pharmacoeconomic evaluation of durvalumab combined with chemotherapy as first-line therapy for advanced biliary tract cancer
Liman HUO ; Yangyang DUAN ; Ping LIANG ; Bin SHAN ; Xiaoli SUN ; Rui FENG
China Pharmacy 2025;36(17):2141-2147
OBJECTIVE To assess the cost-effectiveness of durvalumab combined with chemotherapy as a first-line treatment for advanced biliary tract cancer from the perspective of the Chinese healthcare system. METHODS Using data from the TOPAZ-1 clinical trial, a three-state Markov model comprising progression-free survival (PFS), progressive disease (PD) and death was developed, with a cycle length of 21 days and a 10-year time horizon. Patients in the observation group received durvalumab in combination with gemcitabine and cisplatin, whereas those in the control group received placebo plus the same chemotherapy regimen. The evaluation indexes were quality-adjusted life year (QALY) and the incremental cost-effectiveness ratio (ICER). The willingness-to-pay (WTP) threshold was set at three times the 2024 Chinese per capita gross domestic product (GDP) (287 247 yuan/QALY). The sensitivity analyses, along with scenario analyses, were performed. RESULTS In the base-case analysis, the ICER of observation group compared to control group was 1 166 344.46 yuan/QALY, far exceeding the WTP threshold, indicating that the regimen was not cost-effective. One-way sensitivity analysis identified the PD state utility, discount rate, cost of durvalumab, and PFS state utility as the main drivers of ICER variation. Probabilistic sensitivity analysis showed that, at the above WTP threshold, the probability of the acceeptance of this regimen was 0, further supporting the robustness of the base-case findings. In the scenario analysis, inclusion of a patient assistance program reduced the ICER to 235 885.16 yuan/ QALY, below the above WTP threshold, suggesting cost-effectiveness under this assistance program. However, when applying a regional WTP threshold set at three times the per capita GDP (158 475 yuan/QALY) of Gansu Province (the province with the lowest GDP in China in 2024), the ICER remained above the threshold, indicating that the regimen was not cost-effective at the regional level. CONCLUSIONS At current pricing, durvalumab plus chemotherapy as a first-line treatment for advanced biliary tract cancer is not cost-effective in China. Although the introduction of a patient assistance program can substantially reduce the ICER and achieve cost-effectiveness at a WTP threshold set at three times the 2024 per capita GDP of China, due to limited affordability in low-income areas, the program remains not cost-effective.
4.Processing technology of calcined Magnetitum based on concept of QbD and its XRD characteristic spectra.
De-Wen ZENG ; Jing-Wei ZHOU ; Tian-Xing HE ; Yu-Mei CHEN ; Huan-Huan XU ; Jian FENG ; Yue YANG ; Xin CHEN ; Jia-Liang ZOU ; Lin CHEN ; Hong-Ping CHEN ; Shi-Lin CHEN ; Yuan HU ; You-Ping LIU
China Journal of Chinese Materia Medica 2025;50(9):2391-2403
Guided by the concept of quality by design(QbD), this study optimizes the calcination and quenching process of calcined Magnetitum and establishes the XRD characteristic spectra of calcined Magnetitum, providing a scientific basis for the formulation of quality standards. Based on the processing methods and quality requirements of Magnetitum in the Chinese Pharmacopoeia, the critical process parameters(CPPs) identified were calcination temperature, calcination time, particle size, laying thickness, and the number of vinegar quenching cycles. The critical quality attributes(CQAs) included Fe mass fraction, Fe~(2+) dissolution, and surface color. The weight coefficients were determined by combining Analytic Hierarchy Process(AHP) and the criteria importance though intercrieria correlation(CRITIC) method, and the calcination process was optimized using orthogonal experimentation. Surface color was selected as a CQA, and based on the principle of color value, the surface color of calcined Magnetitum was objectively quantified. The vinegar quenching process was then optimized to determine the best processing conditions. X-ray diffraction(XRD) was used to establish the characteristic spectra of calcined Magnetitum, and methods such as similarity evaluation, cluster analysis, and orthogonal partial least squares-discriminant analysis(OPLS-DA) were used to evaluate the quality of the spectra. The optimized calcined Magnetitum preparation process was found to be calcination at 750 ℃ for 1 h, with a laying thickness of 4 cm, a particle size of 0.4-0.8 cm, and one vinegar quenching cycle(Magnetitum-vinegar ratio 10∶3), which was stable and feasible. The XRD characteristic spectra analysis method, featuring 9 common peaks as fingerprint information, was established. The average correlation coefficient ranged from 0.839 5-0.988 1, and the average angle cosine ranged from 0.914 4 to 0.995 6, indicating good similarity. Cluster analysis results showed that Magnetitum and calcined Magnetitum could be grouped together, with similar compositions. OPLS-DA discriminant analysis identified three key characteristic peaks, with Fe_2O_3 being the distinguishing component between the two. The final optimized processing method is stable and feasible, and the XRD characteristic spectra of calcined Magnetitum was initially established, providing a reference for subsequent quality control and the formulation of quality standards for calcined Magnetitum.
X-Ray Diffraction/methods*
;
Drugs, Chinese Herbal/chemistry*
;
Quality Control
;
Particle Size
5.Potential mechanism of Yueju Pills in improving depressive symptoms of psychocardiac diseases based on metabolomics and network pharmacology.
Cheng-Yu DU ; Xue-Feng GUO ; Han-Wen ZHANG ; Jian LIANG ; Huan ZHANG ; Guo-Wei HUANG ; Ping NI ; Hai-Jun MA ; You YU ; Rui YU
China Journal of Chinese Materia Medica 2025;50(16):4564-4573
The therapeutic effects of Yueju Pills on depression and cardiovascular diseases have been widely recognized. Previous studies have shown that the drug can significantly improve depressive-like behaviors induced by chronic unpredictable mild stress(CUMS) combined with atherosclerosis(AS). Given the complex pathogenesis of psychocardiac diseases, this study integrated metabolomics and network pharmacology to systematically elucidate the mechanism of Yueju Pills in alleviating depressive symptoms in psychocardiac diseases. The results demonstrate that, after Yueju Pill intervention, the levels of 9 abnormal metabolites in the hippocampus restore to normal ranges, primarily involving key pathways or signaling pathways, including the cyclic adenosine monophosphate(cAMP), mammalian target of rapamycin(mTOR), glycine/serine/threonine metabolism, and aminoacyl-tRNA biosynthesis. In a high-fat diet-induced CUMS ApoE~(-/-) mouse model, Yueju Pills significantly increases adenosine monophosphate(AMP) levels and decreases L-alanine and D-glyceric acid levels in the hippocampus. In conclusion, Yueju Pills exert antidepressant effects by regulating multiple metabolic axes, including glycine/serine/threonine metabolism and the cAMP, mTOR signaling pathways. Network pharmacology predictions reveal that the treatment of CUMS combined with AS by its core active components may be realized through modulating pathways concerning neuroinflammation and synaptic plasticity, including serine/threonine-protein kinase 1(AKT1), mitogen-activated protein kinase 1(MAPK1), and prostaglandin-endoperoxide synthase 2(PTGS2). This study provides a theoretical reference for the clinical application of Yueju Pills in alleviating the depressive symptoms of psychocardiac diseases.
Animals
;
Network Pharmacology
;
Mice
;
Drugs, Chinese Herbal/administration & dosage*
;
Metabolomics
;
Male
;
Depression/genetics*
;
Humans
;
Hippocampus/drug effects*
;
Mice, Inbred C57BL
;
Signal Transduction/drug effects*
6.Correlation of IGF2 levels with sperm quality, inflammation, and DNA damage in infertile patients.
Jing-Gen WU ; Cai-Ping ZHOU ; Wei-Wei GUI ; Zhong-Yan LIANG ; Feng-Bin ZHANG ; Ying-Ge FU ; Rui LI ; Fang WU ; Xi-Hua LIN
Asian Journal of Andrology 2025;27(2):204-210
Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans
;
Male
;
Insulin-Like Growth Factor II/metabolism*
;
Infertility, Male/genetics*
;
DNA Damage
;
Adult
;
Inflammation/metabolism*
;
Spermatozoa/metabolism*
;
Semen Analysis
;
Semen/metabolism*
;
Tumor Necrosis Factor-alpha/metabolism*
;
Histones/metabolism*
;
Interleukin-1beta/metabolism*
7.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
8.Psychological stress-activated NR3C1/NUPR1 axis promotes ovarian tumor metastasis.
Bin LIU ; Wen-Zhe DENG ; Wen-Hua HU ; Rong-Xi LU ; Qing-Yu ZHANG ; Chen-Feng GAO ; Xiao-Jie HUANG ; Wei-Guo LIAO ; Jin GAO ; Yang LIU ; Hiroshi KURIHARA ; Yi-Fang LI ; Xu-Hui ZHANG ; Yan-Ping WU ; Lei LIANG ; Rong-Rong HE
Acta Pharmaceutica Sinica B 2025;15(6):3149-3162
Ovarian tumor (OT) is the most lethal form of gynecologic malignancy, with minimal improvements in patient outcomes over the past several decades. Metastasis is the leading cause of ovarian cancer-related deaths, yet the underlying mechanisms remain poorly understood. Psychological stress is known to activate the glucocorticoid receptor (NR3C1), a factor associated with poor prognosis in OT patients. However, the precise mechanisms linking NR3C1 signaling and metastasis have yet to be fully elucidated. In this study, we demonstrate that chronic restraint stress accelerates epithelial-mesenchymal transition (EMT) and metastasis in OT through an NR3C1-dependent mechanism involving nuclear protein 1 (NUPR1). Mechanistically, NR3C1 directly regulates the transcription of NUPR1, which in turn increases the expression of snail family transcriptional repressor 2 (SNAI2), a key driver of EMT. Clinically, elevated NR3C1 positively correlates with NUPR1 expression in OT patients, and both are positively associated with poorer prognosis. Overall, our study identified the NR3C1/NUPR1 axis as a critical regulatory pathway in psychological stress-induced OT metastasis, suggesting a potential therapeutic target for intervention in OT metastasis.
9.Multidisciplinary expert consensus on weight management for overweight and obese children and adolescents based on healthy lifestyle
HONG Ping, MA Yuguo, TAO Fangbiao, XU Yajun, ZHANG Qian, HU Liang, WEI Gaoxia, YANG Yuexin, QIAN Junwei, HOU Xiao, ZHANG Yimin, SUN Tingting, XI Bo, DONG Xiaosheng, MA Jun, SONG Yi, WANG Haijun, HE Gang, CHEN Runsen, LIU Jingmin, HUANG Zhijian, HU Guopeng, QIAN Jinghua, BAO Ke, LI Xuemei, ZHU Dan, FENG Junpeng, SHA Mo, Chinese Association for Student Nutrition & ; Health Promotion, Key Laboratory of Sports and Physical Fitness of the Ministry of Education,〖JZ〗 Engineering Research Center of Ministry of Education for Key Core Technical Integration System and Equipment,〖JZ〗 Key Laboratory of Exercise Rehabilitation Science of the Ministry of Education
Chinese Journal of School Health 2025;46(12):1673-1680
Abstract
In recent years, the prevalence of overweight and obesity among children and adolescents has risen rapidly, posing a serious threat to their physical and mental health. To provide scientific, systematic, and standardized weight management guidance for overweight and obese children and adolescents, the study focuses on the core concept of healthy lifestyle intervention, integrates multidisciplinary expert opinions and research findings,and proposes a comprehensive multidisciplinary intervention framework covering scientific exercise intervention, precise nutrition and diet, optimized sleep management, and standardized psychological support. It calls for the establishment of a multi agent collaborative management mechanism led by the government, implemented by families, fostered by schools, initiated by individuals, optimized by communities, reinforced by healthcare, and coordinated by multiple stakeholders. Emphasizing a child and adolescent centered approach, the consensus advocates for comprehensive, multi level, and personalized guidance strategies to promote the internalization and maintenance of a healthy lifestyle. It serves as a reference and provides recommendations for the effective prevention and control of overweight and obesity, and enhancing the health level of children and adolescents.
10.Analysis of clinical characteristics of children with adenoid hypertrophy and pharyngolaryngeal reflux
Feng LIN ; Jing ZHAO ; Yingxia LU ; Jizhen ZOU ; Ping XIAO ; Jieqiong LIANG ; Chong PANG ; Qinglong GU
Chinese Journal of Otorhinolaryngology Head and Neck Surgery 2024;59(2):140-146
Objectives:To explore the clinical characteristics of children with adenoid hypertrophy (AH) and laryngopharyngeal reflux (LPR) by detecting the expression of pepsin in adenoids as a standard for AH with LPR.Methods:A total of 190 children who were admitted for surgical treatment due to AH were included in the study. The main clinical symptoms of the patients were recorded, and the degree of adenoid hypertrophy was evaluated. Before the surgery, Reflux Symptom Index (RSI) and Reflux Finding Score (RFS) were used to evaluate the reflux symptoms. After the surgery, pepsin immunohistochemical staining was performed on the adenoid tissue, and according to the staining results, the patients were divided into study group (pepsin staining positive) and control group (pepsin staining negative). SPSS 19.0 software was used for statistical analysis. Quantitative data conforming to normal distribution between the two groups were tested by two-independent sample t test, and quantitative data with skewed distribution were tested by Mann-Whitney U test. Results:The positive rate of pepsin staining in the 190 AH patients was 78.4% (149/190). The study group had higher levels of preoperative symptoms such as erythema and/or congestion of the pharynx(2.1±0.7 vs. 1.8±0.6, t=2.23), vocal cord edema[1.0(0, 1.0) vs. 1.0(0, 1.0), Z=2.00], diffuse laryngeal edema[0(0, 1.0) vs. 0(0, 0), Z=2.48], posterior commissure hypertrophy[(1.4±0.6 vs. 1.1±0.5), t=2.63], and a higher total score on the RFS scale than the control group(6.2±2.7 vs. 5.0±2.6, t=2.47), with statistical differences ( P<0.05). The sensitivity and specificity of RFS score in diagnosing AH with LPR were 24.8% and 80.5%, respectively. When RFS>5 was used as the positive threshold, the sensitivity and specificity of RFS score in diagnosing AH with LPR were 61.1% and 58.5%, respectively. There was a statistical difference in the number of positive cases of RFS score between the study group and the control group(91 vs. 17, χ2=5.04, P=0.032). Conclusions:LPR is common in AH children. Children with AH and LPR have specific performance in electronic laryngoscopy, such as erythema with edema in the pharynx, posterior commissure hypertrophy, and vocal cord edema.


Result Analysis
Print
Save
E-mail