1.Mechanism of Yizhi Qingxin Prescription in Regulating PKA/CaN Pathway to Improve Cognitive Function in Alzheimer's Disease Model Mice
Xiaochen GUO ; Jiangang LIU ; Dandan SHI ; Ziqi NING ; Yaoyao ZHANG ; Fang LIU ; Meixia LIU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(3):97-108
ObjectiveTo explore the mechanism by which Yizhi Qingxin prescription improves mitochondrial dysfunction in Alzheimer's disease (AD) through regulating mitochondrial Ca2+ homeostasis and kinetic balance based on the protein kinase A (PKA)/calcineurin (CaN) signaling pathway. MethodsSixty three-month-old amyloid precursor protein (APP)/presenilin 1 (PS1) double transgenic mice were randomly divided into a model group, a donepezil group(0.65 mg·kg-1), a low-dose Yizhi Qingxin prescription group (YQF-L,2.6 g·kg-1), a medium-dose Yizhi Qingxin prescription group (YQF-M,5.2 g·kg-1), and a high-dose Yizhi Qingxin prescription group (YQF-H,10.4 g·kg-1), with 12 mice in each group. Twelve C57BL/6J mice with the same genetic background served as a normal group. Each treatment group received gavage administration daily, with the model and normal groups receiving equal volume of physiological saline. Intervention continued for 12 consecutive weeks. The learning and memory abilities of the mice were assessed using the novel object recognition (NOR) and Morris water maze (MWM) tests. Hematoxylin-eosin (HE)/Nissl staining was used to observe histopathological changes in the hippocampus. Transmission electron microscopy (TEM) was used to observe mitochondrial ultrastructure. Fluo-4 acetoxymethyl ester (Fluo-4 AM) Ca2+ probe was used to measure intracellular Ca2+ concentration in brain tissue. Western blot was used to determine the protein expression of PKA, CaN, sodium/calcium/lithium exchanger (NCLX), mitochondrial calcium uniporter (MCU), calmodulin (CaM), dynamin-related protein 1 (Drp1), and phosphorylated dynamin-related protein 1 (serine 637 site) [p-Drp1(S637)] in the hippocampus. Real-time quantitative polymerase chain reaction (Real-time PCR) was used to measure the expression of PKA, CaN, CaM, NCLX, MCU, and Drp1 mRNAs. ResultsCompared with those in the normal group, the recognition index (RI) of the model group decreased (P0.01), and the number of crossings through the original platform area, the duration of stay in the target quadrant, and the distance were reduced (P0.01). The protein expression of PKA, NCLX, and p-DRP1 (ser637) significantly decreased (P0.05), and the mRNA expression of PKA and NCLX significantly decreased (P0.05). The escape latency (EL) was prolonged (P0.05), and the intracellular Ca2+ level significantly increased (P0.01). The protein expression of CaN, CaM, MCU, and Drp1, as well as the mRNA expression of CaN, MCU, and Drp1, significantly increased (P0.05). After intervention with Donepezil and Yizhi Qingxin prescription, compared with that in the model group, the RI of the treatment group significantly increased (P0.05), and the number of crossings through the platform and the duration of stay in the target quadrant significantly increased (P0.05). The protein expression of PKA, NCLX, and p-Drp1 (ser637) and the mRNA expression of PKA and NCLX significantly increased (P0.05). On the 4th and 5th days, the EL was shortened (P0.05), and the intracellular Ca2+ level decreased (P0.05). The protein expression of CaN, CaM, MCU, and Drp1 and the mRNA expression of CaN, MCU, and Drp1 significantly decreased (P0.05). ConclusionYizhi Qingxin prescription regulates the PKA/CaN pathway, upregulates the expression of PKA, NCLX, and p-Drp1 (ser637) proteins, reduces the expression of CaN, CaM, MCU, and Drp1 proteins, and regulates Ca2+ homeostasis and mitochondrial dynamic balance, thereby enhancing the spatial learning and memory abilities of AD mice.
2.Mechanism of Yizhi Qingxin Prescription in Regulating PKA/CaN Pathway to Improve Cognitive Function in Alzheimer's Disease Model Mice
Xiaochen GUO ; Jiangang LIU ; Dandan SHI ; Ziqi NING ; Yaoyao ZHANG ; Fang LIU ; Meixia LIU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(3):97-108
ObjectiveTo explore the mechanism by which Yizhi Qingxin prescription improves mitochondrial dysfunction in Alzheimer's disease (AD) through regulating mitochondrial Ca2+ homeostasis and kinetic balance based on the protein kinase A (PKA)/calcineurin (CaN) signaling pathway. MethodsSixty three-month-old amyloid precursor protein (APP)/presenilin 1 (PS1) double transgenic mice were randomly divided into a model group, a donepezil group(0.65 mg·kg-1), a low-dose Yizhi Qingxin prescription group (YQF-L,2.6 g·kg-1), a medium-dose Yizhi Qingxin prescription group (YQF-M,5.2 g·kg-1), and a high-dose Yizhi Qingxin prescription group (YQF-H,10.4 g·kg-1), with 12 mice in each group. Twelve C57BL/6J mice with the same genetic background served as a normal group. Each treatment group received gavage administration daily, with the model and normal groups receiving equal volume of physiological saline. Intervention continued for 12 consecutive weeks. The learning and memory abilities of the mice were assessed using the novel object recognition (NOR) and Morris water maze (MWM) tests. Hematoxylin-eosin (HE)/Nissl staining was used to observe histopathological changes in the hippocampus. Transmission electron microscopy (TEM) was used to observe mitochondrial ultrastructure. Fluo-4 acetoxymethyl ester (Fluo-4 AM) Ca2+ probe was used to measure intracellular Ca2+ concentration in brain tissue. Western blot was used to determine the protein expression of PKA, CaN, sodium/calcium/lithium exchanger (NCLX), mitochondrial calcium uniporter (MCU), calmodulin (CaM), dynamin-related protein 1 (Drp1), and phosphorylated dynamin-related protein 1 (serine 637 site) [p-Drp1(S637)] in the hippocampus. Real-time quantitative polymerase chain reaction (Real-time PCR) was used to measure the expression of PKA, CaN, CaM, NCLX, MCU, and Drp1 mRNAs. ResultsCompared with those in the normal group, the recognition index (RI) of the model group decreased (P0.01), and the number of crossings through the original platform area, the duration of stay in the target quadrant, and the distance were reduced (P0.01). The protein expression of PKA, NCLX, and p-DRP1 (ser637) significantly decreased (P0.05), and the mRNA expression of PKA and NCLX significantly decreased (P0.05). The escape latency (EL) was prolonged (P0.05), and the intracellular Ca2+ level significantly increased (P0.01). The protein expression of CaN, CaM, MCU, and Drp1, as well as the mRNA expression of CaN, MCU, and Drp1, significantly increased (P0.05). After intervention with Donepezil and Yizhi Qingxin prescription, compared with that in the model group, the RI of the treatment group significantly increased (P0.05), and the number of crossings through the platform and the duration of stay in the target quadrant significantly increased (P0.05). The protein expression of PKA, NCLX, and p-Drp1 (ser637) and the mRNA expression of PKA and NCLX significantly increased (P0.05). On the 4th and 5th days, the EL was shortened (P0.05), and the intracellular Ca2+ level decreased (P0.05). The protein expression of CaN, CaM, MCU, and Drp1 and the mRNA expression of CaN, MCU, and Drp1 significantly decreased (P0.05). ConclusionYizhi Qingxin prescription regulates the PKA/CaN pathway, upregulates the expression of PKA, NCLX, and p-Drp1 (ser637) proteins, reduces the expression of CaN, CaM, MCU, and Drp1 proteins, and regulates Ca2+ homeostasis and mitochondrial dynamic balance, thereby enhancing the spatial learning and memory abilities of AD mice.
3.Hypoglycemic Effect and Mechanism of ICK Pattern Peptides
Lin-Fang CHEN ; Jia-Fan ZHANG ; Ye-Ning GUO ; Hui-Zhong HUANG ; Kang-Hong HU ; Chen-Guang YAO
Progress in Biochemistry and Biophysics 2025;52(1):50-60
Diabetes is a very complex endocrine disease whose common feature is the increase in blood glucose concentration. Persistent hyperglycemia can lead to blindness, kidney and heart disease, neurodegeneration, and many other serious complications that have a significant impact on human health and quality of life. The number of people with diabetes is increasing yearly. The global diabetes prevalence in 20-79 year olds in 2021 was estimated to be 10.5% (536.6 million), and it will rise to 12.2% (783.2 million) in 2045. The main modes of intervention for diabetes include medication, dietary management, and exercise conditioning. Medication is the mainstay of treatment. Marketed diabetes drugs such as metformin and insulin, as well as GLP-1 receptor agonists, are effective in controlling blood sugar levels to some extent, but the preventive and therapeutic effects are still unsatisfactory. Peptide drugs have many advantages such as low toxicity, high target specificity, and good biocompatibility, which opens up new avenues for the treatment of diabetes and other diseases. Currently, insulin and its analogs are by far the main life-saving drugs in clinical diabetes treatment, enabling effective control of blood glucose levels, but the risk of hypoglycemia is relatively high and treatment is limited by the route of delivery. New and oral anti-diabetic drugs have always been a market demand and research hotspot. Inhibitor cystine knot (ICK) peptides are a class of multifunctional cyclic peptides. In structure, they contain three conserved disulfide bonds (C3-C20, C7-C22, and C15-C32) form a compact “knot” structure, which can resist degradation of digestive protease. Recent studies have shown that ICK peptides derived from legume, such as PA1b, Aglycin, Vglycin, Iglycin, Dglycin, and aM1, exhibit excellent regulatory activities on glucose and lipid metabolism at the cellular and animal levels. Mechanistically, ICK peptides promote glucose utilization by muscle and liver through activation of IR/AKT signaling pathway, which also improves insulin resistance. They can repair the damaged pancrease through activation of PI3K/AKT/Erk signaling pathway, thus lowering blood glucose. The biostability and hypoglycemic efficacy of the ICK peptides meet the requirements for commercialization of oral drugs, and in theory, they can be developed into natural oral anti-diabetes peptide drugs. In this review, the structural properties, activity and mechanism of ICK pattern peptides in regulating glucose and lipid metabolism were summaried, which provided a reference for the development of new oral peptides for diabetes.
4.Prognostic Factors of Liposarcoma in Head and Neck
Shuo DING ; Zhigang HUANG ; Jugao FANG ; Yang ZHANG ; Lizhen HOU ; Wei GUO ; Gaofei YIN ; Qi ZHONG
Cancer Research on Prevention and Treatment 2025;52(1):31-35
Objective To explore the pathogenesis and prognostic factors of liposarcoma in the head and neck region, and simultaneously analyze the efficacy of different treatment regimens. Methods A retrospective analysis was performed on all patients with primary untreated head and neck liposarcoma who were diagnosed and underwent surgical treatment at our hospital from January 2008 to January 2024. All patients were monitored during follow-up, and their prognoses were analyzed using SPSS software. Results A total of 30 patients were included in the study. Liposarcoma accounted for up to 60% of the cases in the orbit, while the remaining liposarcomas were primarily located in various interspaces of the neck. Dedifferentiated liposarcoma was the most common type, comprising 33%, while myxoid pleomorphic liposarcoma was the rarest at 4%. The tumor pathological type (P<0.001) and Ki67 (P=0.014) significantly affected the tumor control rate. However, an analysis of disease-specific survival rates revealed no significant differences across various factors (all P>0.05). Conclusion The prognosis of head and neck liposarcoma is better compared to that of liposarcomas in other parts of the body. However, myxoid pleomorphic liposarcoma, pleomorphic fat sarcoma, and high Ki67 levels are indicators of poor prognosis. Additionally, postoperative adjuvant radiotherapy does not significantly enhance disease-specific survival rates.
5.Gradient artificial bone repair scaffold regulates skeletal system tissue repair and regeneration
Yu ZHANG ; Ruian XU ; Lei FANG ; Longfei LI ; Shuyan LIU ; Lingxue DING ; Yuexi WANG ; Ziyan GUO ; Feng TIAN ; Jiajia XUE
Chinese Journal of Tissue Engineering Research 2025;29(4):846-855
BACKGROUND:Gradient artificial bone repair scaffolds can mimic unique anatomical features in musculoskeletal tissues,showing great potential for repairing injured musculoskeletal tissues. OBJECTIVE:To review the latest research advances in gradient artificial bone repair scaffolds for tissue engineering in the musculoskeletal system and describe their advantages and fabrication strategies. METHODS:The first author of the article searched the Web of Science and PubMed databases for articles published from 2000 to 2023 with search terms"gradient,bone regeneration,scaffold".Finally,76 papers were analyzed and summarized after the screening. RESULTS AND CONCLUSION:(1)As an important means of efficient and high-quality repair of skeletal system tissues,gradient artificial bone repair scaffolds are currently designed bionically for the natural gradient characteristics of bone tissue,bone-cartilage,and tendon-bone tissue.These scaffolds can mimic the extracellular matrix of native tissues to a certain extent in terms of structure and composition,thus promoting cell adhesion,migration,proliferation,differentiation,and regenerative recovery of damaged tissues to their native state.(2)Advanced manufacturing technology provides more possibilities for gradient artificial bone repair scaffold preparation:Gradient electrospun fiber scaffolds constructed by spatially differentiated fiber arrangement and loading of biologically active substances have been developed;gradient 3D printed scaffolds fabricated by layered stacking,graded porosity,and bio-3D printing technology;gradient hydrogel scaffolds fabricated by in-situ layered injections,simple layer-by-layer stacking,and freeze-drying method;and in addition,there are also scaffolds made by other modalities or multi-method coupling.These scaffolds have demonstrated good biocompatibility in vitro experiments,were able to accelerate tissue regeneration in small animal tests,and were observed to have significantly improved histological structure.(3)The currently developed gradient artificial bone repair scaffolds have problems such as mismatch of gradient scales,unclear material-tissue interactions,and side effects caused by degradation products,which need to be further optimized by combining the strengths of related disciplines and clinical needs in the future.
6.miR-27a-3p promotes the proliferation of human hypertrophic scar fibroblasts by regulating mitogen-activated protein kinase signaling pathway
Jun LI ; Jingjing GONG ; Guobin SUN ; Rui GUO ; Yang DING ; Lijuan QIANG ; Xiaoli ZHANG ; Zhanhai FANG
Chinese Journal of Tissue Engineering Research 2025;29(8):1609-1617
BACKGROUND:Multiple studies have confirmed that mitogen-activated protein kinase(MAPK)signaling pathway is involved in cell proliferation,and microRNA(miR)is involved in the occurrence and development of hypertrophic scars.Therefore,the role of miR-27a-3p and MAPK signaling pathways in pathological scar formation has been further explored. OBJECTIVE:To explore the effect of miR-27a-3p on the proliferation of human hypertrophic scar fibroblasts through the MAPK signaling pathway. METHODS:The primary fibroblasts were isolated and collected from the skin samples.The primary fibroblasts were observed by inverted microscope and verified by immunofluorescence.The relative expression level of miR-27a-3p in tissues was detected by qRT-PCR.The target genes of hsa-miR-27a-3p were predicted using the database,and then the predicted target genes were enriched by gene ontology function analysis and biological pathway enrichment analysis of the Kyoto Encyclopedia of Genes and Genomes.There were seven groups:blank control,negative control,miR-27a-3p mimic,miR-27a-3p inhibitor,miR-27a-3p mimic+p38 MAPK inhibitor,miR-27a-3p mimic+extracellular regulated protein kinase inhibitor,miR-27a-3p mimic+c-Jun N-terminal kinase inhibitor.Western blot was used to detect the levels of extracellular regulated protein kinase,c-Jun N-terminal kinase inhibitor.and p38 kinase and their phosphorylation levels.Cell counting kit-8 and EdU were used to detect cell proliferation. RESULTS AND CONCLUSION:Compared with normal skin fibroblasts,hypertrophic scar fibroblasts had stronger proliferative activity(P<0.05)and faster proliferation level(P<0.001).Compared with normal skin,miR-27a-3p was highly expressed in hypertrophic scars(P<0.001).Compared with the negative control group,overexpression of miR-27a-3p could promote cell proliferation activity(P<0.001)and proliferation levels(P<0.001).Compared with the negative control group,knockdown of miR-27a-3p could inhibit the proliferation activity(P<0.05)and proliferation levels(P<0.001).Compared with the negative control group,overexpression of miR-27a-3p promoted the phosphorylated levels of extracellular regulated protein kinase,c-Jun N-terminal kinase,and p38 mitogen-activated protein kinase(P<0.05).Compared with the negative control group,knockdown of miR-27a-3p inhibited the phosphorylated levels of extracellular regulated protein kinase,c-Jun N-terminal kinase,and p38 MAPK(P<0.05).Compared with the miR-27a-3p mimic group,specific inhibitors of extracellular regulated protein kinase,c-Jun N-terminal kinase,and p38 MAPK reversed the effects of miR-27a-3p on the proliferative activity(P<0.01)and proliferation level(P<0.001)of fibroblasts.To conclude,these results suggest that miR-27a-3p promotes the proliferation of human hypertrophic scar fibroblasts by activating the MAPK signaling pathway.
7.Study on mechanism of Chanbao zhichuang suppository in treating hemorrhoids based on network pharmacology and metabolomics
Chunfeng GUO ; Xin JIANG ; Ruyang CHENG ; Shumin LIU ; Chunxiang XIE ; Fang LU
China Pharmacy 2025;36(13):1622-1628
OBJECTIVE To explore the mechanism of improvement effect of Chanbao zhichuang suppository (CBZCS) on hemorrhoids in rats through network pharmacology and metabolomics. METHODS A hemorrhoid model was established by subcutaneous injection of rhododendron oil to induce anal swelling. SD rats were divided into blank group (NC group, 0.32 g/kg vaseline), model group (Model group, 0.32 g/kg vaseline), CBZCS low-, medium-, and high-dose groups (CBZCS-L, CBZCS- M, CBZCS-H groups, with dosages of 0.16, 0.32, and 0.64 g/kg respectively), and Mayinglong musk hemorrhoids suppository group (Positive group, 0.32 g/kg), with 9 rats in each group. Anal administration was performed at 6, 12, 24, 48, and 72 hours after modeling. After the last administration, the pathological changes of the anal tissues in rats were observed, and the serum levels of interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) in rats were detected. Differential metabolite analysis and enrichment analysis were conducted by metabolomics methods, and the target proteins of CBZCS in treating hemorrhoids were obtained by network pharmacology. The core metabolic pathways were screened by interaction and enrichment analysis of differential metabolites and proteins, and the core proteins were experimentally verified. RESULTS Compared with the NC group, the anal tissues of the Model group showed obvious lesions, and the levels of IL-6 and TNF- α in the serum were significantly increased (P<0.05); compared with the Model group, the pathological damage of the anal tissues in the treatment groups was alleviated to varying degrees, and serum levels of IL-6 in CBZCS-H group, CBZCS-M group, and Positive group as well as serum levels of TNF-α in CBZCS-H group were significantly reduced (P<0.05). The metabolomics results showed that 34 differential metabolites were screened from the anal tissues of rats, and 22 of them showed a return after CBZCS administration. The differential metabolites mainly enriched in arachidonic acid metabolism, histidine metabolism, and glycerophospholipid metabolism. Through the network pharmacology, 138 intersection genes of CBZCS against hemorrhoids were determined. The analysis results showed that differential metabolites and target proteins were mainly enriched in the arachidonic acid metabolism pathway, and the regulation of this pathway might be related to cyclooxygenase-2 (COX-2), Myc proto-oncogene protein (c-MYC), cytochrome P450 1B1 (CYP1B1), interleukin-1β (IL-1β), and IL-6 protein expression. The experimental verification results showed that the expression levels of key proteins (COX-2, c-MYC, CYP1B1, IL-6, IL-1β) in the anal tissues of the Model group were significantly higher than those in the NC group (P<0.05), and the levels of the above proteins in the anal tissues of CBZCS-H group and Positive group were significantly lower than those in the Model group (P<0.05). CONCLUSIONS The mechanism of CBZCS in treating hemorrhoids may be to inhibit the expression of COX-2, c-MYC and CYP1B1 proteins, thereby inhibiting arachidonic acid metabolism and reducing the release of inflammatory factors IL-6 and IL-1β.
8.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
9.Research progress on the mechanism of action of rosmarinic acid in the prevention of cardiovascular diseases
Ke CAI ; Sheng-ru HUANG ; Fang-fang GAO ; Xiu-juan PENG ; Sheng GUO ; Feng LIU ; Jin-ao DUAN ; Shu-lan SU
Acta Pharmaceutica Sinica 2025;60(1):12-21
With the rapid development of social economy and the continuous improvement of human living standard, the incidence, fatality and recurrence rates of cardiovascular disease (CVD) are increasing year by year, which seriously affects people's life and health. Conventional therapeutic drugs have limited improvement on the disability rate, so the search for new therapeutic drugs and action targets has become one of the hotspots of current research. In recent years, the therapeutic role of the natural compound rosmarinic acid (RA) in CVD has attracted much attention, which is capable of preventing CVD by modulating multiple signalling pathways and exerting physiological activities such as antioxidant, anti-apoptotic, anti-inflammatory, anti-platelet aggregation, as well as anti-coagulation and endothelial function protection. In this paper, the role of RA in the prevention of CVD is systematically sorted out, and its mechanism of action is summarised and analysed, with a view to providing a scientific basis and important support for the in-depth exploration of the prevention value of RA in CVD and its further development as a prevention drug.
10.Investigation of tick species in Suizhou City, Hubei Province from 2023 to 2024
Huiya LU ; Fang GUO ; Yibin PAN ; Meng PENG ; Libang WU ; Ye LIN ; Xiaohui LIU ; Xuejie YU
Chinese Journal of Schistosomiasis Control 2025;37(2):184-189
Objective To investigate the species of ticks in Suizhou City, Hubei Province, so as to provide insights into management of ticks and tick-borne diseases. Methods During the period between May 2023 and June 2024, livestock breeding farms and vegetation neighboring the place of residence of confirmed and suspected patients with tick-borne disease were selected as sampling points in rural areas from Yindian Township, Gaocheng Township, Wanhe Township, Wushan Township, Xiaolin Township, Xihe Township, Hedian Township and Beijiao Street in Suizhou City, Hubei Province, where confirmed and suspected cases with tick-borne diseases had been reported. The parasitic ticks on the body surface of free-range livestock were captured with tweezers in livestock breeding farms, and free ticks on the vegetation surface were captured with the flagging method. Morphological identification of tick samples was performed under a microscope, and the gender and developmental stage of ticks were determined. One engorged adult tick, 2 to 3 blood-feeding but non-engorged adult ticks, 10 to 15 unfed female ticks, 15 to 20 unfed male ticks, and 30 to 40 tick nymphs or larvae were assigned into a group, respectively. Genomic DNA was extracted from tick samples in each group, and mitochondrial 16S rRNA gene was amplified. Sequence analysis was performed with the DNASTAR software, and phylogenetic analysis was performed using the software MEGA 7.0. In addition, the phylogenetic tree was generated using the maximum likelihood method based on the Kimura 2 parameter model. Results A total of 2 438 ticks were captured from Suizhou City, Hubei Province during the period between May 2023 and June 2024, including 595 free ticks and 1 483 parasitic ticks. Three developmental stages of ticks were captured, including larvae, nymphs, and adults, and 75.18% (1 899/2 438) of captured ticks were adult, in which 79.04% (1 501/1 899) were female. Morphological and molecular biological assays identified one family, three genera and four species of captured ticks, including 2 425 Haemaphysalis longicornis ticks (99.47%) and one H. flava tick (0.04%) of the genus Haemaphysalis, 11 Rhipicephalus microplus ticks (0.45%) of the genus Rhipicephalus, and one Ixodes sinensis tick (0.04%) of the genus Ixodes in the family Ixodidae. Phylogenetic analysis revealed that the H. longicornis sequence (SZ49) in this study was clustered with sequences from Yunnan Province (GenBank accession number: MH024510.1), Hebei Province (GenBank accession number: MK450606.1) and Henan Province (GenBank accession number: MZ230645.1) into a clade, and the H. flava sequence (SZ19) in this study was clustered with sequences from Japan (GenBank accession number: MW064044.1), South Korea (GenBank accession number: ON629585.1), and Jiangsu Province (GenBank accession number: PP494741.1) and Hebei Province of China (GenBank accession number: MH520685.1) into a clade, while the R. microplus sequence (SZ8) in this study was clustered with the sequences from India (GenBank accession number: MK621328.1), and Henan Province (GenBank accession number: MT555307.1) and Guizhou Province of China (GenBank accession number: PP446801.1) into a clade. The sequence of I. sinensis (SZ23) in this study had 99.51% homology with that (GenBank accession number: OM368265.1) of ticks sampled from Wuhan City, Hubei Province. Conclusion There are four tick species of H. longicornis, H. flava, R. microplus and I. sinensis in Suizhou City, Hubei Province, and H. longicornis is the dominant species. H. flava is firstly recorded in Suizhou City.

Result Analysis
Print
Save
E-mail