ObjectiveTo explore the mechanism by which the ethanol extract of Epimedium brevicornu （EEBM） intervenes in mesenchymal adipose-derived stem cells （ADSCs） to delay aging in castrated rats. MethodsForty-five 3-month-old SPF female SD rats were ovariectomized and randomly divided into model group， ADSCs treatment group， and ADSCs groups treated with low， medium， and high concentrations of EEBM （1， 50， 100 μg·L^-1）， referred to as the AE low， medium， and high concentration groups， with 9 rats in each group. After tail vein injection of 200 μL of the corresponding stem cell suspension， aging-related indicators including cyclin-dependent kinase inhibitor （p21）， tumor suppressor gene （p53）， interleukin-6 （IL-6）， interleukin-8 （IL-8）， superoxide dismutase （SOD）， malondialdehyde （MDA）， B-cell lymphoma-2 （Bcl-2）， Bcl-2-associated X protein （Bax）， cysteine-aspartic acid protease-3 （Caspase-3）， and lipofuscin were measured using enzyme-linked immunosorbent assay （ELISA） and Western blot. ResultsCompared with the model group， the IL-6 content in the AE low， medium， and high concentration groups was significantly decreased （P<0.05）. Lipofuscin， MDA， and IL-8 levels in the ADSCs treatment group and AE low， medium， and high concentration groups were significantly reduced （P<0.01）， while SOD content was significantly increased （P<0.05， P<0.01）. Compared with the ADSCs treatment group， lipofuscin and IL-8 levels in the AE low， medium， and high concentration groups were significantly reduced （P<0.05， P<0.01）. The MDA content was significantly decreased in the AE medium concentration group （P<0.01）. Compared with the model group， protein levels of p21， p53， Bax， and Caspase-3 in the ADSCs treatment group and AE low， medium， and high concentration groups were significantly reduced （P<0.05， P<0.01）， while the Bcl-2 protein level was significantly increased （P<0.01）. Compared with the ADSCs treatment group， protein levels of p21， p53， Bax， and Caspase-3 in the AE low， medium， and high concentration groups were significantly reduced （P<0.05， P<0.01）， and the Bcl-2 protein level in the AE low concentration group was significantly increased （P<0.01）. ConclusionThe results of this experiment show that EEBM-treated ADSCs or ADSCs may delay aging in castrated rats by inhibiting cell apoptosis， reducing cell cycle inhibitors and pro-inflammatory factors， enhancing antioxidant capacity， and reducing oxidative reactions. Moreover， EEBM-treated ADSCs demonstrate stronger anti-aging effects than ADSCs alone. This study provides experimental evidence supporting the clinical use of EEBM to intervene in ADSCs and delay aging.

BACKGROUND:Adult stem cell therapy is one of the research hotspots in the field of peripheral nerve injury repair and regeneration.With excellent properties of mesenchymal stem cells such as high acquisition rate,wide source,and rapid proliferation,mesoderm have been regarded as the ideal source of adult stem cells,while ectoderm-derived adult stem cells,especially neural crest stem cells,have certain neurogenic properties and attract more and more attention from researchers. OBJECTIVE:To mainly review the role and mechanism of multifunctional adult stem cells from ectoderm and mesoderm in peripheral nerve injury repair and regeneration,so as to explore the research progress and application prospect of adult stem cells from different sources and discuss the potential application value of adult stem cell therapy and the problems to be solved in connection with clinical studies. METHODS:The first author searched the relevant articles published from December 2001 to February 2024 in PubMed and SinoMed by computer in February 2024.The Chinese and English search terms were"ectodermal stem cells,mesenchymal stem cells,peripheral nerve injury,repair,regeneration."Finally,69 articles were included and analyzed. RESULTS AND CONCLUSION:(1)Ectodermal adult stem cells have excellent differentiation and regeneration potential,especially epidermal neural crest stems cells,olfactory stem cells,and dental ectomesenchymal stem cells,which have certain neurogenic properties and can express neural specific markers in vitro.However,relevant clinical research needs to be accumulated.(2)There are many types of adult stem cells derived from mesoderm,which are easy to obtain and purify.Among them,the efficacy and safety of bone marrow mesenchymal stem cells and umbilical cord mesenchymal stem cells in the repair of peripheral nerve injury are supported by clinical trials;that is,they can improve sensory and motor nerve conduction and there are no complications and obvious adverse reactions in follow-up.The acquisition of bone marrow mesenchymal stem cells needs invasive surgery and requires the patient to match the donor bone marrow type,which limit the application to some extent.Although umbilical cord mesenchymal stem cells do not require invasive harvesting,their isolation is difficult and phenotypically unstable.(3)Adult stem cells derived from endoderm often fail to grow in vitro,so the possibility of clinical application is low.(4)In conclusion,bone marrow mesenchymal stem cells are still the first choice for adult stem cell therapy in the treatment of peripheral nerve injury,which is suitable for cases without surgical contraindications and meeting the matching requirements,followed by umbilical cord mesenchymal stem cells supplemented by improved isolation methods and advanced phenotypic stability strategies.(5)Dental ectomesenchymal stem cells and adipose-derived mesenchymal stem cells have high application potential and need to be further tested in clinical trials.Other adult stem cells derived from ectodermal and mesodermal layers have significant advantages in animal and cell experimental studies due to their excellent properties.

ObjectiveTo analyze the impact of maternal postpartum depression (PPD) at 2 months postpartum on caregiving for infants aged2 to 24 months, and to provide a scientific basis for future maternal and infant healthcare services. MethodsBased on the Shanghai Maternal-Child Pairs Cohort, 1 060 mother-child pairs were selected from those fully participating in follow-up visits at 2, 6, 12, and 24 months postpartum. Pregnancy and childbirth-related information was collected using standardized questionnaire surveys and hospital obstetric and maternity records. The Edinburgh postpartum depression scale was used to assess the maternal postpartum depressive symptoms at 2 months postpartum. At 2, 6, 12, and 24 months postpartum, questionnaire survey was used to evaluate the maternal responsiveness in caregiving and the provision of early learning opportunities for infants. Scores for responsive caregiving and early learning opportunities at 2, 6, 12, and 24 months were grouped based on the 25th percentile (P₂₅) of total scores. The mixed-effects model was used to analyze the longitudinal impact of maternal postpartum depression at 2 months on the caregiving of 2 to 24-month-old infants. ResultsThe longitudinal results from the mixed-effects model did not show an impact of maternal PPD on infant responsive caregiving within 12 months and early learning opportunities within24 months. However, cross-sectional analysis revealed that, compared to the non-PPD group, the risk of low responsive caregiving at 2 months in the PPD group was 93% higher (OR=1.931, 95%CI: 1.113‒3.364, P=0.019). The risks for low provision of early learning opportunities at2 months and 24 months increased by 59% (OR=1.589, 95%CI: 1.082‒2.324, P=0.017) and 60% (OR=1.598, 95%CI:1.120‒2.279, P=0.010), respectively. ConclusionMaternal postpartum depression increases the risk of low responsive caregiving at 2 months, but its long-term effects warrant further research.

Objective: To investigate the effects of different storage temperatures and durations on the activities of coagulation factor Ⅷ (Factor Ⅷ, FⅧ) and coagulation factor Ⅸ (Factor Ⅸ, FⅨ) after whole blood collection, so as to provide data support for the optimal storage conditions. Methods: A total of 16 mL of whole blood was collected from each of the 20 healthy volunteers at our blood center and aliquoted into 8 sodium citrate anticoagulant tubes. Two tubes were immediately centrifuged for the measurement of FⅧ and FⅨ activity levels. The remaining 6 tubes of whole blood were respectively stored under room temperature and low-temperature conditions. At 2, 4, and 6 h, the whole blood samples were centrifuged and analyzed for FⅧ and FⅨ activity levels. The mean values of the two immediately tested tubes were used as the control group, while other tubes were designated as the experimental groups for comparison. Statistical analysis was performed using SPSS 26.0. Results: The activity of FⅧ in whole blood remained stable after 4 hours of storage at both room temperature and low temperature (116.53±25.95 vs 125.22±27.33, 109.77±23.23 vs 125.22±27.33) (P>0.05 for both). However, by 6 hours, FⅧ activity showed a statistically significant decline compared to the control group (108.65±22.92 vs 125.22±27.33, 100.46±20.19 vs 125.22±27.33) (P<0.05 for both), though the room temperature group results were closer to the control values. The activity of FⅨ in whole blood remained stable after 6 hours of storage under both conditions (97.14±19.48 vs 96.76±19.67, 97.10±17.45 vs 96.76±19.6) (P>0.05 for all comparisons). Conclusion: For whole blood samples after collection, storage at either room temperature or low temperature for up to 4 hours does not compromise the accuracy of test results. When stored for 6 hours, FⅨ activity remains stable, whereas FⅧ activity decreases significantly. Notably, FⅧ activity demonstrates better stability at room temperature than under low-temperature conditions within the 6-hour storage.

OBJECTIVE To explore the mechanism of improvement effect of Chanbao zhichuang suppository （CBZCS） on hemorrhoids in rats through network pharmacology and metabolomics. METHODS A hemorrhoid model was established by subcutaneous injection of rhododendron oil to induce anal swelling. SD rats were divided into blank group （NC group， 0.32 g/kg vaseline）， model group （Model group， 0.32 g/kg vaseline）， CBZCS low-， medium-， and high-dose groups （CBZCS-L， CBZCS- M， CBZCS-H groups， with dosages of 0.16， 0.32， and 0.64 g/kg respectively）， and Mayinglong musk hemorrhoids suppository group （Positive group， 0.32 g/kg）， with 9 rats in each group. Anal administration was performed at 6， 12， 24， 48， and 72 hours after modeling. After the last administration， the pathological changes of the anal tissues in rats were observed， and the serum levels of interleukin-6 （IL-6） and tumor necrosis factor-α （TNF-α） in rats were detected. Differential metabolite analysis and enrichment analysis were conducted by metabolomics methods， and the target proteins of CBZCS in treating hemorrhoids were obtained by network pharmacology. The core metabolic pathways were screened by interaction and enrichment analysis of differential metabolites and proteins， and the core proteins were experimentally verified. RESULTS Compared with the NC group， the anal tissues of the Model group showed obvious lesions， and the levels of IL-6 and TNF- α in the serum were significantly increased （P＜0.05）； compared with the Model group， the pathological damage of the anal tissues in the treatment groups was alleviated to varying degrees， and serum levels of IL-6 in CBZCS-H group， CBZCS-M group， and Positive group as well as serum levels of TNF-α in CBZCS-H group were significantly reduced （P＜0.05）. The metabolomics results showed that 34 differential metabolites were screened from the anal tissues of rats， and 22 of them showed a return after CBZCS administration. The differential metabolites mainly enriched in arachidonic acid metabolism， histidine metabolism， and glycerophospholipid metabolism. Through the network pharmacology， 138 intersection genes of CBZCS against hemorrhoids were determined. The analysis results showed that differential metabolites and target proteins were mainly enriched in the arachidonic acid metabolism pathway， and the regulation of this pathway might be related to cyclooxygenase-2 （COX-2）， Myc proto-oncogene protein （c-MYC）， cytochrome P450 1B1 （CYP1B1）， interleukin-1β （IL-1β）， and IL-6 protein expression. The experimental verification results showed that the expression levels of key proteins （COX-2， c-MYC， CYP1B1， IL-6， IL-1β） in the anal tissues of the Model group were significantly higher than those in the NC group （P＜0.05）， and the levels of the above proteins in the anal tissues of CBZCS-H group and Positive group were significantly lower than those in the Model group （P＜0.05）. CONCLUSIONS The mechanism of CBZCS in treating hemorrhoids may be to inhibit the expression of COX-2， c-MYC and CYP1B1 proteins， thereby inhibiting arachidonic acid metabolism and reducing the release of inflammatory factors IL-6 and IL-1β.

OBJECTIVE To explore the effects of CD20 coding gene （MS4A1） polymorphism on the blood concentration and efficacy of rituximab in patients with non-Hodgkin’s lymphoma. METHODS A prospective observational study was conducted on 160 newly diagnosed non-Hodgkin’s lymphoma patients who received the R-CHOP regimen at the Sun Yat Sen University Cancer Center from January 2016 to December 2020， with a minimum follow-up period of approximately 5 years. The blood concentration of rituximab was detected by enzyme-linked immunosorbent assay. MS4A1 tagSNPs were selected by Haploview4.2 software， including rs1051461， rs17155034， rs4939364， and rs10501385. The genotype of MS4A1 was detected by Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Univariate linear regression analysis was employed to examine the correlation between various factors（demographic， clinical， and genotypic variables） in patients and the steady-state trough concentration of rituximab during the first course of treatment， followed by multivariate linear regression analysis. Kaplan-Meier curves were drawn to evaluate progression-free survival （PFS） and overall survival （OS）. Using MS4A1 genotype and tumor stage as independent variables， Cox regression model was employed to evaluate the factors influencing patient prognosis. RESULTS The blood concentration of rituximab in MS4A1 rs10501385 CC carriers was 15.20 μg/mL，which was significantly lower than 21.95 μg/mL in AA+AC carriers （P＜0.05）. The multivariate linear regression model incorporating tumor stage and MS4A1 rs10501385 polymorphism explained 7.3% of the interindividual variability in rituximab concentrations. Compared with MS4A1 rs1051461 CC carriers， CT+TT carriers had significantly prolonged PFS and OS （P＜0.05）. The Cox proportional hazards regression model showed that the MS4A1 rs1051461 CC genotype （HR＝4.406， 95%CI：1.743-11.137， P＜0.05） and tumor Ⅲ&Ⅳ （HR＝3.233， 95%CI： 1.413-7.399， P＜0.05） were independent risk factors for PFS. CONCLUSIONS The tumor staging and MS4A1 rs10501385 polymorphism are key influencing factors for blood concentration of rituximab， and MS4A1 rs1051461 polymorphism significantly affects PFS in non-Hodgkin’s lymphoma patients.

OBJECTIVE To explore the effects of prescription pre-review system on rational drug use and off-label drug use management in outpatient and emergency department. METHODS A retrospective analysis was conducted on outpatient and emergency department prescription data from three phases in our hospital： January to May 2023 （silent review phase， control group）， June to October 2023 （systematic automatic review phase， intervention group 1）， and November 2023 to March 2024 （phase combining systematic automatic review with centralized feedback from pharmacists to physicians regarding irrational prescriptions， intervention group 2）. These phases followed the implementation of our hospital’s pre-prescription review software. Statistical analysis of the prompt rate of alert， rate of irrational prescriptions， registered the off-label drug use rate and false positive irrationality prescription rate were conducted. Meanwhile， the composition of irrational prescriptions was analyzed， and evidence- based evaluation of the off-label drug use proposed by clinicians was also conducted. RESULTS Compared with control group， the prompt rate of alert and the rate of irrational prescriptions in intervention group 1 were all decreased significantly after receiving pop-up notification， with statistically significant differences （P＜0.05）. With the help of system warning and the pharmacists feedback， the prompt rate of alert and the rate of irrational prescriptions declined further in the intervention group 2， but there was no statistically significant difference when compared with intervention group 1 （P＞0.05）. The main type of irrational drug use was improper administration routes. When comparing intervention group 1 with the control group， as well as intervention group 2 with intervention group 1， a significant decrease in the rate of improper administration routes was observed， with statistically significant differences （P＜0.05）. Compared with control group， there was no significant difference in the registered off-label drug use rate of intervention group 1 and intervention group 2 （P＞0.05）. The doctor’s awareness of off-label drug use registration increased due to the real-time alerts from the pre-prescription review software， along with the pharmacists’ regular summarization and feedback. Total 13 items registrations of off-label drug use were proposed by clinicians from June 2023 to March 2024， all of which were supported by evidence of varying levels； among them， 3 items received FDA approval， 4 items were included in the Micromedex database， and the remaining 6 items were supported by evidence from system reviews or randomized controlled trials. CONCLUSIONS Prescription pre-review system can improve the level of rational drug use and assist in the standardized management of off-label drug use.

To investigate the therapeutic effect and related mechanisms of hordenine on ovalbumin (OVA)-induced allergic rhinitis (AR) in rats, HE and AB-PAS staining were used to detect the improvement of pathological damage to the nasal mucosa induced by hordenine. ELISA was employed to detect the effect of hordenine on OVA-sIgE in serum and IL-4 in the nasal mucosa supernatant of rats. IHC and Western blot experiments were undertaken to examine the effect of hordenine on Th1/Th2 cell balance. Bioinformatics analysis was performed to predict pathways, which were verified by in vivo and in vitro experiments. The experimental results showed that hordenine could alleviate the behavioral manifestations of OVA-induced AR rats, alleviate nasal mucosal pathological damage caused by AR, and reduce the secretion of OVA-sIgE and IL-4. In addition, hordenine could regulate the Th1/Th2 balance. Bioinformatics analysis results showed that the potential pathway of action of hordenine on AR was the phosphoinositide 3 kinase (PI3K)/protein kinase B (Akt) signaling pathway. The in vivo experimental results showed that the expression of PI3K and p-Akt proteins in the nasal mucosa of the model group rats was significantly increased (P < 0.01), and that the protein expression level was significantly decreased after the administration of hordenine, which was also confirmed by an in vitro experiment. This study suggests that hordenine may regulate Th1/Th2 cell balance through the PI3K/Akt signaling pathway, thereby exerting an alleviating effect on OVA-induced AR.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Objective: To explore the iodine nutrition status of children in Wuhan from 2019 to 2023, and to evaluate the effect of iodine deficiency disorders control in focus groups in Wuhan, so as to provide a basis for consolidating elimination of iodine deficiency disorders. Methods: A total of 13 000 non boarding primary school students aged 8-10 were selected from 13 districts of Wuhan by stratified random sampling method.Household salt samples were collected to measure salt iodine content, random urine samples were analyzed for urinary iodine concentration. And B ultrasound was used to measure thyroid volume in students. The median of salt iodine, coverage rate of iodized salt, consumption rate of qualified iodized salt, median of urinary iodine, and the goiter rate were calculated. And Mann-Whitney U- test, Kruskal-Wallis H- test and Chi-square test were applied to compare between groups. Chi-square trend test was used to analyze the changing trends of coverage rate of iodized salt, consumption rate of qualified iodized salt and goiter rate among children in Wuhan. Results: The median of iodine content of children s household salt was 23.8 (21.7, 26.1) mg/kg, and the coverage rate of iodized salt was 98.7%, and the consumption rate of qualified iodized salt was 94.5 %. The consumption rates of qualified iodized salt showed an overall upward trend from 2019 to 2023 ( χ 2 trend =5.57， P <0.05). The median of urinary iodine of children was 220.1 (136.7, 326.0) μg/L,and boys had higher median of urinary iodine than girls [228.3(143.2, 336.0),210.2(129.1, 315.7) μg/L] ( Z =6.60, P <0.01). The median of urinary iodine of children in suburbs was higher than those in urban areas [236.3 (150.7, 342.2) , 207.1 (124.5, 309.8) μg/L]( Z =11.00, P <0.01). A total of 4 600 children were examined for thyroid volume, and the range of goiter rates were 1.1% to 3.4%, with an average goiter rate of 2.5%, which showed an overall downward trend from 2019 to 2023 ( χ 2 trend =5.11, P <0.05). Conclusions The iodine nutrition is sufficient and iodine nutrition status is good among children in Wuhan. It should continue to carry out monitoring and evaluation of children s iodine nutrition, guide the public to supplement iodine scientifically,so as to maintain the appropriate level of iodine for children.