Virus-related lymphoma exhibits a dual nature as both a hematologic malignancy and a viral infectious disease， making it more resistant to treatment and associated with poorer prognosis. This paper analyzes the understanding and therapeutic advantages of traditional Chinese medicine （TCM） in virus-related lymphoma. It proposes a TCM-based approach centered around syndrome differentiation， using standardized measurements of the overall TCM condition， multi-omics research of hematologic tumors， and artificial intelligence technologies to identify the "pre-condition" of virus-related lymphoma. A risk warning model will be established to early identify high-risk populations with viral infections that may develop into malignant lymphoma， thereby establishing a risk warning system for virus-related lymphoma. At the same time， a TCM health management approach will be applied to manage and regulate virus-related lymphoma， interrupting its progression and forming a human-centered， comprehensive， continuous health service model. Based on this， a standardized， integrated clinical prevention and treatment decision-making model for virus-related lymphoma， recognized by both Chinese and western medicine， will be established to provide TCM solutions for primary prevention of major malignant tumors.

Objective: To investigate the distribution of traditional Chinese medicine (TCM) syndromes and syndrome elements in lymphoma, as well as the correlation between TCM syndromes and Western clinical indicators, in order to analyze associations between TCM syndromes and these indicators. Methods: From January 2023 to May 2024, 216 patients with lymphoma who met the inclusion criteria in the Department of Hematology, Third People′s Hospital Affiliated to Fujian University of Traditional Chinese Medicine were enrolled. Four diagnostic methods were applied to perform TCM syndrome differentiation and extract syndrome elements. The correlations between various syndromes and blood test indicators of lactate dehydrogenase (LDH), β2-microglobulin (β2-MG), immunoglobulin G (IgG), immunoglobulin M (IgM), immunoglobulin A (IgA), white blood cell (WBC), hemoglobin (Hb), platelet count (PLT), neutrophil (NEUT), immunohistochemical markers of B-cell lymphoma-6 (BCL6), B-cell lymphoma-2 (BCL2), proto-oncogene MYC, and Ki67 protein expression, Ann Arbor staging, international prognostic index (IPI) score, bone marrow infiltration, concurrent infections during chemotherapy, and post-chemotherapy bone marrow suppression rate were analyzed. Results: Five TCM syndromes, ranked by frequency, were syndromes of yin deficiency with phlegm accumulation(41.67%), qi depression with phlegm obstruction(30.56%), cold-phlegm congelation and stagnation(12.96%), phlegm-blood stasis toxin(12.04%), and lingering pathogen due to deficient vital qi(2.77%). Yin deficiency(50.93%) and phlegm(45.37%) were the more prevalent syndrome elements. The TCM syndromes were correlated with β2-MG, PLT, MYC, BCL2/MYC, Ki67 protein expression, and bone marrow infiltration (P<0.05). No statistically significant differences were observed in Ann Arbor staging or IPI score across the syndromes. Compared to the syndrome of cold-phlegm congelation and stagnation, the syndrome of qi depression with phlegm obstruction exhibited higher levels of NEUT, MYC, BCL2/MYC, and Ki67 protein expression, as well as a higher rate of post-chemotherapy bone marrow suppression (P<0.05); the syndrome of phlegm-blood stasis toxin showed higher MYC and BCL2/MYC protein expression and a higher rate of post-chemotherapy bone marrow suppression rate (P<0.05); the syndrome of yin deficiency with phlegm accumulation demonstrated higher MYC and BCL2/MYC protein expression and bone marrow infiltration rates, whereas PLT level was lower (P<0.05); the syndrome of lingering pathogen due to deficient vital qi had higher MYC, BCL2/MYC, and Ki67 protein expression levels, as well as a higher rate of post-chemotherapy bone marrow suppression rate (P<0.05). Compared to the syndrome of qi depression with phlegm obstruction, the syndrome of phlegm-blood stasis toxin exhibited lower Ki67 protein expression (P<0.05); the syndrome of yin deficiency with phlegm accumulation had higher β2-MG level, bone marrow infiltration rate, and rate of concurrent infections during chemotherapy, whereas PLT and NEUT levels and the rate of post-chemotherapy bone marrow suppression rate were lower (P<0.05). Compared to the syndrome of phlegm-blood stasis toxin, the syndrome of yin deficiency with phlegm accumulation had higher β2-MG level, whereas NEUT and the rate of post-chemotherapy bone marrow suppression were lower(P<0.05); the syndrome of lingering pathogen due to deficient vital qi exhibited a higher Ki67 protein expression (P<0.05). Compared to the syndrome of yin deficiency with phlegm accumulation, the syndrome of lingering pathogen due to deficient vital qi also showed a higher Ki67 protein expression(P<0.05). Conclusion The syndrome of yin deficiency with phlegm accumulation is relatively common in lymphoma. There is a correlation between TCM syndromes and Western medicine clinical indicators. The presence of heat signs in the syndromes may indicate active disease and poor prognosis, while the presence of strong pathogenic factors and weak vital qi in the syndromes may indicate a severer chemotherapy-related bone marrow suppression.

ObjectiveBased on analytic hierarchy process（AHP）-criteria importance through intercriteria correlation（CRITIC） hybrid weighting method， grey relational analysis and backpropagation artificial neural network（BP-ANN）， to optimize the water extraction process of Qizhi prescription， so as to provide an experimental basis for optimization of the preparation process of this prescription and the establishment of quality standards. MethodsL₉（3⁴） orthogonal test was employed， and the AHP-CRITIC hybrid weighting method was utilized to determine the weight coefficients of the quality fractions of various components， including astragaloside Ⅳ， polygalaxanthone Ⅲ， calycosin-7-O-β-D-glucoside， tenuifolin， and 3，6′-disinapoylsucrose， as well as the dry extract yield. The comprehensive score of each factor level combination in the orthogonal test were calculated as evaluation indicator to select the optimal extraction process parameters. The effects of extraction times， extraction time， and solvent dosage on the aqueous extraction process of the formula were investigated through intuitive analysis， variance analysis， and grey relational analysis. Meanwhile， a BP-ANN model was established to reverse-predict the optimal extraction process parameters of Qizhi prescription， and the optimized process parameters were validated. ResultsThe weight coefficients of the five index components（astragaloside Ⅳ， tenuifolin， calycosin-7-O-β-D-glucoside， polygalaxanthone Ⅲ， and 3，6′-disinapoylsucrose） and dry extract yield were 25.7%， 20.82%， 16.41%， 12.45%， 15.96% and 8.67%， respectively. The optimized extraction process parameters were extracted 3 times with 8， 6， 6 times the amount of water， each time for 1 h. The network prediction results of BP-ANN test samples were consistent with the orthogonal test results， and the mean square error（MSE） of the predicted and measured values of the network was <1%. The water extraction process of Qizhi prescription analyzed and predicted by relevant mathematical models was stable and feasible， which could effectively improve the extraction efficiency of the active ingredients of Astragali Radix and Polygalae Radix， and the average comprehensive score of the validation test was 90.85 with the relative standard deviation（RSD） of 1.55%. ConclusionThis study establishes a water extraction process for compound Qizhi granules， and the optimized extraction process can effectively improve the extraction efficiency of active ingredients， which provides useful references for the optimization of preparation process and the establishment of quality standards for other clinical experience formulas.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

ObjectiveTo investigate the brain absorption components of Tianyuan Zhitong prescription and their distribution based on ultra-high performance liquid chromatography-quadrupole-time-of-flight mass spectrometry（UPLC-Q-TOF-MS）， desorption electrospray ionization mass spectrometry imaging（DESI-MSI） and hyperspectral imaging techniques. MethodTen BALB/c mice were randomly divided into blank group（n=3） and administration group（n=7）， the administration group was gavaged with 0.3 mL of Tianyuan Zhitong prescription liquid at a concentration of about 5 g·mL^-1 of the raw material， and the blank group was gavaged with an equal volume of normal saline， and the whole brain of the mice were taken for the preparation of tissue homogenates and frozen sections， respectively. The tissue homogenates were qualitatively analyzed by UPLC-Q-TOF-MS for the brain absorption components in positive and negative ion modes， frozen sections were used for imaging to observe the distribution of these components in the brain. Cytoviva dark-field enhancement microscope was used to perform hyperspectral imaging scanning on the brain sections of mice from each group， and the scattered light data of at least 1 000 pixels in the visible-near-infrared（400-1 000 nm） band in the microscopic field of view were collected and average spectrum were created， which were used to compare the components in the brain tissues of mice from the blank and administration groups. ResultA total of 27 brain absorption components of Tianyuan Zhitong prescription were identified by UPLC-Q-TOF-MS， including 10 organic acids， 5 glycosides， 4 alkaloids， 1 phenol， 4 flavonoids， 2 phthalides and 1 other compound， which were mainly derived from Gastrodiae Rhizoma， Chuanxiong Rhizoma， vinegar-processed Corydalis Rhizoma， Ziziphi Spinosae Semen and processed Morindae Officinalis Radix. A total of 14 components were identified by mass spectrometry imaging， of which ferulic acid， tetrahydropalmatine and N-methyl dehydroberberine were mainly distributed in the cerebral cortex， vitamin B₅， vemonoic acid and ricinoleic acid were mainly distributed in the hypothalamus， elemicin， octadecenic acid and octadecanoic acid were mainly distributed in the cortex and hypothalamus， while senkyunolide B， ligustilide， linoleic acid， 9，12-octadecadienoyl ethyl ester and spinosin were distributed in most regions of the brain tissues. Hyperspectral imaging showed that in the visible-near-infrared band range， the average spectrum of the brain tissues of mice in the administration group was significantly red-shifted， indicating that there were differences in the physical properties or contents of the chemical components in the brain between mice in the blank group and those in the administration group， and further verified the results of mass spectrometry imaging. ConclusionThrough the combination of UPLC-Q-TOF-MS and imaging techniques， the pharmacodynamic components of Tianyuan Zhitong prescription in the treatment of headache and the regional characteristics in brain tissue are clarified， which can provide reference for the selection of the index components of the research on the quality standard of this prescription and the research on the mechanism of the pharmacological effect.

Patients with severe trauma require an extremely timely treatment and transfusion plays an irreplaceable role in the emergency treatment of such patients. An increasing number of evidence-based medicinal evidences and clinical practices suggest that patients with severe traumatic bleeding benefit from early transfusion of low-titer group O whole blood or hemostatic resuscitation with red blood cells, plasma and platelet of a balanced ratio. However, the current domestic mode of blood supply cannot fully meet the requirements of timely and effective blood transfusion for emergency treatment of patients with severe trauma in clinical practice. In order to solve the key problems in blood supply and blood transfusion strategies for emergency treatment of severe trauma, Branch of Clinical Transfusion Medicine of Chinese Medical Association, Group for Trauma Emergency Care and Multiple Injuries of Trauma Branch of Chinese Medical Association, Young Scholar Group of Disaster Medicine Branch of Chinese Medical Association organized domestic experts of blood transfusion medicine and trauma treatment to jointly formulate Chinese expert consensus on blood support mode and blood transfusion strategies for emergency treatment of severe trauma patients ( version 2024). Based on the evidence-based medical evidence and Delphi method of expert consultation and voting, 10 recommendations were put forward from two aspects of blood support mode and transfusion strategies, aiming to provide a reference for transfusion resuscitation in the emergency treatment of severe trauma and further improve the success rate of treatment of patients with severe trauma.

Objective To explore the role of sulodexide(SDX)in neointimal hyperplasia of arteriovenous fistulas(AVFs)in chronic kidney disease(CKD)rats and its possible mechanism.Methods A total of 18 male rats(weighing 300±50 g)were randomly and equally divided into AVF group,CKD+AVF group(CKD induction followed by AVF surgery and then gavaged with normal saline for 2 months),and CKD+AVF+SDX group[treated as in the CKD+AVF group but with 8 mg/(kg·d)SDX gavage].HE staining was used to observe the degree of neointimal hyperplasia.The expression of Hippo pathway related molecules,Yes-associated protein(YAP),pYAP and connective tissue growth factor(CTGF,YAP downstream target protein,one of mesenchymal marker)was detected by immunofluorescence assay.After human umbilical vein cell fusion EAHy926 cells were treated with 0,2.5,5,10,20 or 40 μg/mL SDX for 24 h,and with 2.5 μg/mL SDXfor24,48 or 72 h,respectively,CCK-8 assay was used to measure cell survival rate.Moreover,the serum sample from CKD rat was used to treat EAHy926 cells,and then the cells were treated with SDX or YAP inhibitor verteporfin.The expression levels of YAP,pYAP,CTGF and endothelial cell marker CD31 were detected by Western blotting.Results HE staining and immunofluorescence assay showed that CKD rats had serious neointimal hyperplasia in AVFs(P＜0.05),and slightly lower expression of pYAP and enhanced expression of CTGF(P＜0.05)when compared with the rats of the AVF group.While,SDX treatment alleviated the neointimal hyperplasia of AVFs,enhanced the expression of pYAP and reduced the expression of CTGF(P＜0.05).CCK-8 assay showed that cell survival rate was decreased significantly in a dose-and time-dependent manner after SDX treatment(P＜0.05).Western blotting revealed that SDX increased the expression of pYAP and CD31 while inhibited the expression of CTGF in EAHy926 cells(P＜0.05),which was consistent with the effect of verteporfin treatment.Conclusion SDX can block YAP activation caused by CKD and attenuate neointimal hyperplasia in AVFs.

Objective:To evaluate the role of G-rich RNA sequence binding factor 1 (GRSF1) in cerebral ischemia-reperfusion (I/R) injury in mice and the relationship with ferroptosis.Methods:Twenty-four clean-grade male C57BL/6 mice, aged 8-10 weeks, weighing 20-25 g, were divided into 4 groups ( n=6 each) using a random number table method: sham operation group (Sham group), cerebral I/R group (IR group), cerebral I/R+ GRSF1 overexpression group (IR+ LV-GRSF1 group), and cerebral I/R+ GRSF1 overexpression+ glutathione peroxidase 4 (GPX4) inhibitor group (IR+ LV-GRSF1+ RSL3 group). The model of middle cerebral artery occlusion was developed by thread-occlusion method in anesthetized animals. In IR+ LV-GRSF1 group, GRSF1-overexpressed lentivirus 2 μl was injected into the lateral ventricle at 7 days before the development of the model. GPX4 inhibitor RSL3 5 mg/kg was intraperitoneally injected for 2 consecutive days before the development of the model in IR+ LV-GRSF1+ RSL3 group. After 24 h of reperfusion, the percentage of cerebral infarction volume was determined by TTC assay, the survival neurons in ischemic area were detected by Nissl staining, and brain tissues in ischemic area were obtained for determination of the expression of p16, p21(markers of senescence) and tumor necrosis factor-alpha (TNF-α, senescence-associated secretory phenotype) mRNA (by quantitative real-time polymerase chain reaction), contents of malondialdehyde (MDA), superoxide dismutase(SOD) and glutathione (GSH) (by enzyme-linked immunosorbent assay) and expression of GRSF1, GPX4, Acyl-CoA synthetase long-chain family member 4 (ACSL4) and ferritin (by Western blot). Results:Compared with Sham group, the percentage of cerebral infarction volume was significantly increased, the count of viable neurons was decreased, the expression of p16, p21 and TNF-α mRNA in ischemic brain tissues was up-regulated, SOD and GSH contents were decreased, the MDA content was increased, the expression of GRSF1 and GPX4 was down-regulated, and the expression of ACSL4 and ferritin was up-regulated in IR group ( P<0.05). Compared with IR group, the percentage of cerebral infarction volume was significantly decreased, the count of viable neurons was increased, the expression of p16, p21 and TNF-α mRNA in ischemic brain tissues was down-regulated, SOD and GSH contents were increased, the MDA content was decreased, the expression of GRSF1 and GPX4 was up-regulated, and the expression of ACSL4 and ferritin was down-regulated in IR+ LV-GRSF1 group ( P<0.05). Compared with IR+ LV-GRSF1 group, the percentage of cerebral infarction volume was significantly increased, the count of viable neurons was decreased, the expression of p16, p21 and TNF-α mRNA in ischemic brain tissues was up-regulated, SOD and GSH contents were decreased, the MDA content was increased, the expression of GRSF1 and GPX4 was down-regulated, and the expression of ACSL4 and ferritin was up-regulated in IR+ LV-GRSF1+ RSL3 group ( P<0.05). Conclusions:GRSF1 is involved in the endogenous protective mechanism against cerebral I/R injury by up-regulating GPX4 expression, attenuating oxidative stress, and thus inhibiting ferroptosis in mice.

Objective:To evaluate the relationship between the second messenger cyclic GMP-AMP (cGAS)-cyclic GMP-AMP receptor stimulator of interferon genes (STING) signaling pathway and ferritinophagy in the early stage of cerebral ischemia-reperfusion (I/R) in mice.Methods:Twenty-four clean-grade healthy male C57BL/6 mice, aged 6-8 weeks, weighing 21-25 g, were divided into 4 groups ( n=6 each) using a random number table method: sham group, cerebral I/R injury group (CIRI group), cerebral I/R injury + cGAS inhibitor group (CIRI + RU group), and cerebral I/R injury + cGAS inhibitor + overexpressed nuclear receptor coactivator 4 (NCOA4) group (MCAO + RU + LV-NCOA4 group). The model of cerebral I/R injury was developed using the middle cerebral artery occlusion (MCAO) in anesthetized animals.In CIRI+ RU group, cGAS inhibitor 5 mg/kg was intraperitoneally injected at 10 min before reperfusion.In CIRI+ RU+ LV-NCOA4 group, NCOA4-overexpressing lentivirus (1×10 9 TU/ml) 2 μl was injected into the ventricle at 7 days before MCAO, and the other operations were the same as those previously described in CIRI+ RU group.After 6 h of reperfusion, the neurological function deficits were assessed and scored, then the mice were sacrificed, and brains were removed for determination of the cerebral infarct size (by TTC method), MDA content (by TBA method), activity of SOD (by WST-1 method), and expression of cGAS, STING, NCOA4, ferritin, and microtubule-associated protein 1 light chain 3B (LC3B) (by Western blot). Results:Compared with Sham group, the neurological function deficit score and cerebral infarct size were significantly increased, SOD activity was decreased, MDA content was increased, the expression of cGAS, STING, NCOA4 and LC3B was up-regulated, and the expression of ferritin was down-regulated in CIRI group ( P<0.05). Compared with CIRI group, the neurological function deficit score and cerebral infarct size were significantly decreased, SOD activity was increased, MDA content was decreased, the expression of cGAS, STING, NCOA4 and LC3B was down-regulated, and the expression of ferritin was up-regulated in CIRI+ RU group ( P<0.05). Compared with CIRI+ RU group, the neurological function deficit score and cerebral infarct size were significantly increased, SOD activity was decreased, MDA content was increased, the expression of cGAS, STING, NCOA4 and LC3B was up-regulated, and the expression of ferritin was down-regulated in CIRI group ( P<0.05), and no significant change was found in the expression of cGAS and STING in CIRI+ RU+ LV-NCOA4 group ( P>0.05). Conclusions:The cGAS-STING signaling pathway can promote the over-activation of ferritinophagy, enhance oxidative stress, and thus induce early CIRI in mice.

Objective:To investigate the expression of serum uric acid and cystatin C in older adult patients with diastolic heart failure and their correlation with ventricular remodeling.Methods:The clinical data of 173 older adult patients with diastolic heart failure (patient group) and 144 older adult patients who had normal heart function (control group) who received treatment in Liaoning Jinqiu Hospital from January 2018 to January 2020 were retrospectively analyzed. Left ventricular end-diastolic diameter, left ventricular mass index, serum uric acid and cystatin C levels were compared between the two groups. These indices were also compared between patients with different classes of heart failure. Serum uric acid and cystatin C levels were correlated with left ventricular end-diastolic diameter and left ventricular mass index.Results:Left ventricular end-diastolic diameter, left ventricular mass index, and serum uric acid and cystatin C levels in the patient group were (46.82 ± 4.56) mm, (117.45 ± 24.51) g/m 2, (380.23 ± 115.85) μmol/L, (1.41 ± 0.51) mg/L, respectively, which were significantly higher than (45.8 ± 3.96) mm, (111.19 ± 19.30) g/m 2, (333.65 ± 89.02) μmol/L, (1.06 ± 0.34) mg/L, respectively in the control group ( t = 2.10, 2.48, 3.95, 7.02, all P < 0.05). Serum uric acid level in patients with class IV heart failure was (432.48 ± 157.64) μmol/L, which was significantly higher than (355.22 ± 106.56) μmol/L and (379.89 ± 93.43) μmol/L in patients with class II and class III heart failure ( F = 5.18, P < 0.05). Pearson correlation analysis showed that serum uric acid level was positively correlated with left ventricular end-diastolic diameter ( r = 0.17, P < 0.05) and left ventricular mass index ( r = 0.18, P < 0.05) in older adult patients with diastolic heart failure. Conclusion:Serum uric acid plays an important role in the occurrence and development of diastolic heart failure in older adults. Serum uric acid level can help measure the degree of ventricular remodeling to some extent.