OBJECTIVE To provide reference for optimizing or formulating unified evaluation methods for evidence and recommendation in expert consensus on off-label use of drugs. METHODS Retrieved from CNKI， Wanfang data， VIP， CBM， PubMed and Web of Science， Chinese expert consensuses on off-label use of drugs involving evaluation methods for evidence and recommendations were collected from the inception to August 1， 2024. After screening the literature and extracting relevant data， descriptive statistical analysis was conducted. RESULTS & CONCLUSIONS Among the 32 articles included， 14 articles （43.8%） used Micromedex’s Thomson grading system， only 7 articles （21.9%） considered economic factors when forming recommendations， 10 articles （31.3%） reported the conflicts of interest； only 2 articles （6.3%） involved experts in the field of evidence-based medicine methodology. There were differences in the sources of evidence， factors considered in forming recommendations， and the grading standards for evidence and recommendations among different expert consensus evidence evaluation methods. There were also differences in evidence levels and recommendation strength of the same drug off-label use in different expert consensus. It is recommended that in future consensus-building processes， greater attention should be paid to potential conflicts of interest among participants， collaboration with methodological experts should be enhanced， and efforts should be expedited to establish unified standards for evaluating evidence and recommendation methodologies.

Objective:To study the risk factors of venous thromboembolism(VTE)and the predictive value of the improved VTE score model to identify the risk of VTE in gynecological surgery patients.Methods:From Janu-ary 1,2020 to December 31,2022,41 patients with VTE after gynecological surgery were selected as the VTE group,and a total of 164 patients with adjacent gynecological surgeries during the same period were selected as the non-VTE group with a ratio of 1 :4.Univariate and multivariate Logistic regression analysis were used to ana-lyze the risk factors of VTE after gynecological surgery,and a modified VTE risk factor rapid assessment model(referred to as the improved VTE score model)was constructed.The receiver operating characteristic(ROC)curve was used to study the predictive value for VTE for in gynecological surgery,and compared with the Caprini score model(Caprini table for short).Results:①Multivatiate Logistic regression analysis showed that there were independent risk factors for postoperative VTE in gynecology surgery(OR＞1,P＜0.05),including age≥60 years,BMI≥28 kg/m2,malignant tumors,surgery time＞3 hours,history of thrombosis,and the increased D-di-mer difference before and after surgery.②The Area under Curve(AUC)of ROC was 0.963 in the improved VTE score model with a Youden index 81.10％,sensitivity 87.80％and specificity 93.29％.The AUC of the Caprini score model was 0.888 with Youden index 63.41％,sensitivity 73.17％and specificity 90.24％.The improved VTE score model the Caprini score model identified 92.68％and 85.37％of VTE patients as high-risk or ex-tremely high-risk,respectively,but the difference was not statistically significant(P＜0.05).Conclusions:More attention should be paid to the six independent risk factors for postoperative VTE in gynecology surgery.The two score models showed a similar identified level.However,the improved VTE score model is more simple and easier to operate,has better practicality,and has certain clinical promotion value.

Objective:Using different machine learning methods to construct and screen the best prediction model for predicting the risk of death within 30 days after surgery in patients with acute type A aortic dissection.Methods:Five hundred and twenty-one patients with acute type A aortic dissection who underwent surgery between 2015 and 2022 were included, after collecting their perioperative date and screening them, 329 patients were retained. two different groups of predictor variables were generated by using Lasso regression and principal component analysis, after that, logistic regression, support vector machine algorithm, random forest algorithm, gradient boosting algorithm, and super learning algorithm were used to develop prediction models for the risk of death within 30 days after surgery. Finally, we compare the models and select the best one. Results:The AUC values for all models rangrd from 0.791-0.959. The model using Lasso regression to determine the predictor variables and built by the super learning algorithm had the best prediction with an AUC value of 0.959. Conclusion:The super learning algorithm better than other algorithms in predicting death within 30 days after acute type A aortic dissection.

Objective To investigate the efficacy of low-dose inhaled nitric oxide (iNO) in the treatment of severe hypoxemia after Sun’s operation. Methods The clinical data of patients undergoing Sun’s operation for acute Type A aortic dissection in our hospital from January 2020 to June 2022 were retrospectively analyzed. Patients who received conventional treatment before November 2021 were enrolled as a control group. After November 2021, iNO was used in our hospital, and the patients who received iNO as an iNO group. The preoperative clinical baseline data, perioperative clinical data and oxygenation index were compared between the two groups. Results A total of 54 patients were included in the control group, including 45 males and 9 females, with an average age of 53.0±10.9 years. A total of 27 patients were included in the iNO group, including 21 males and 6 females, with an average age of 52.0±10.6 years. The preoperative body mass index of the two groups was greater than 25 kg/m2, white blood cell count, C-reactive protein were significantly higher than normal level, but there was no statistical difference between the groups (P＞0.05). There were no statistical differences in intraoperative data between the two groups (P＞0.05). The iNO group had significantly shorter duration of mechanical ventilation, postoperative ICU stay, and postoperative hospital stay than the control group (P<0.001). After 12 h of iNO treatment, hypoxic condition improved obviously, oxygenation indices in 12 h, 24 h, 36 h,48 h, 60 h and 72 h in the iNO group were significantly higher than those in the control group (P<0.05). Conclusion The treatment of severe hypoxemia after Sun’s surgery with low-dose of iNO is safe and effective, can significantly improve oxygenation function, and has significant advantages in shortening ventilator use time, postoperative ICU stay and postoperative hospital stay, but it is not significant in changing postoperative mortality.

Objective:The aim is to construct an evaluation framework for clinical research benefits,and provide a reference for the formulate of evaluation standards for clinical research benefits.Methods:The Delphi method was used to carry out expert consultation,and the mean,score of importance,coefficient of variation and coordination,etc.of evaluation indicators were summarized and calculated,to screen evaluation indicators for clinical research benefits.Results:Twenty-three experts in this field were selected for correspondence,and their enthusiasm was 100%in both rounds,the authority coefficients were≥0.90,and Kendall's coefficients of concordance were<0.25(P<0.001).By referring to the mean and coefficient of variation of the indicators,as well as combining them with expert suggestions,an evaluation framework for clinical research benefits was ultimately formed with 2 primary indicators,5 secondary indicators,and 8 tertiary indicators.Conclusion:The evaluation framework for clinical research benefits constructed in this paper can comprehensively evaluate the research benefits,as well as provide a basis for reasonably determining the research risk-benefit ratio and developing quantitative evaluation tools for clinical research benefits.

Objective To summarize the results and clinical experience of transcatheter valve-in-valve implantation using domestic self-expanding valve in patients with aortic degenerated bio-prosthesis. Methods From January 2019 to April 2023, the patients who underwent transcatheter valve-in-valve surgery in the Department of Cardiac Surgery of Tianjin Chest Hospital due to surgical bio-prosthesis failure were included. Characteristics of valves, perioperative complications, and hemodynamic manifestations during the early postoperative and follow-up period were analyzed. Results A total of 24 patients were enrolled, including 14 males and 10 females with an average age of 68.17±7.72 years, and the average interval between the two operations was 10.48±4.09 years. All patients were successfully discharged without complications such as coronary artery obstruction and pacemaker implantation, and the average transvalvular pressure gradient was 16.39±6.52 mm Hg before discharge. During the median follow-up time of 16 months, the left ventricular diastolic inner diameter and ejection fraction were continuously improved. Conclusion Transcatheter valve-in-valve using domestic self-expanding valves is safe and feasible to treat aortic bioprosthetic valve failure. Sound patient selection and surgical strategies are critical to achieve good hemodynamics.

Objective To investigate the clinical characteristics and prognosis of pneumococcal meningitis(PM),and drug sensitivity of Streptococcus pneumoniae(SP)isolates in Chinese children.Methods A retrospective analysis was conducted on clinical information,laboratory data,and microbiological data of 160 hospitalized children under 15 years old with PM from January 2019 to December 2020 in 33 tertiary hospitals across the country.Results Among the 160 children with PM,there were 103 males and 57 females.The age ranged from 15 days to 15 years,with 109 cases(68.1% )aged 3 months to under 3 years.SP strains were isolated from 95 cases(59.4% )in cerebrospinal fluid cultures and from 57 cases(35.6% )in blood cultures.The positive rates of SP detection by cerebrospinal fluid metagenomic next-generation sequencing and cerebrospinal fluid SP antigen testing were 40% (35/87)and 27% (21/78),respectively.Fifty-five cases(34.4% )had one or more risk factors for purulent meningitis,113 cases(70.6% )had one or more extra-cranial infectious foci,and 18 cases(11.3% )had underlying diseases.The most common clinical symptoms were fever(147 cases,91.9% ),followed by lethargy(98 cases,61.3% )and vomiting(61 cases,38.1% ).Sixty-nine cases(43.1% )experienced intracranial complications during hospitalization,with subdural effusion and/or empyema being the most common complication[43 cases(26.9% )],followed by hydrocephalus in 24 cases(15.0% ),brain abscess in 23 cases(14.4% ),and cerebral hemorrhage in 8 cases(5.0% ).Subdural effusion and/or empyema and hydrocephalus mainly occurred in children under 1 year old,with rates of 91% (39/43)and 83% (20/24),respectively.SP strains exhibited complete sensitivity to vancomycin(100% ,75/75),linezolid(100% ,56/56),and meropenem(100% ,6/6).High sensitivity rates were also observed for levofloxacin(81% ,22/27),moxifloxacin(82% ,14/17),rifampicin(96% ,25/26),and chloramphenicol(91% ,21/23).However,low sensitivity rates were found for penicillin(16% ,11/68)and clindamycin(6% ,1/17),and SP strains were completely resistant to erythromycin(100% ,31/31).The rates of discharge with cure and improvement were 22.5% (36/160)and 66.2% (106/160),respectively,while 18 cases(11.3% )had adverse outcomes.Conclusions Pediatric PM is more common in children aged 3 months to under 3 years.Intracranial complications are more frequently observed in children under 1 year old.Fever is the most common clinical manifestation of PM,and subdural effusion/emphysema and hydrocephalus are the most frequent complications.Non-culture detection methods for cerebrospinal fluid can improve pathogen detection rates.Adverse outcomes can be noted in more than 10% of PM cases.SP strains are high sensitivity to vancomycin,linezolid,meropenem,levofloxacin,moxifloxacin,rifampicin,and chloramphenicol.[Chinese Journal of Contemporary Pediatrics,2024,26(2):131-138]

Acute mitral regurgitation(MR)in the setting of myocardial infarction(MI)may be the result of papillary muscle rupture(PMR).The clinical presentation can be catastrophic,with refractory cardiogenic shock.This condition is associated with high morbidity and mortality.Transcatheter edge-to-edge repair(TEER)has become increasingly common in treating severe mitral regurgitation.This case details a successful TEER is feasible and safe in patients with acute MR following MI.TEER is an emerging treatment option in this clinical scenario that should be taken into consideration.

AIM To explore the effects of praeruptorin A from Suhuang antitussive capsules on cough variant asthma(CVA).METHODS The rats were randomly divided into the normal group,the model group,the dexamethasone group(0.5 mg/kg),the Suhuang antitussive capsules group(7 g/kg)and the low,medium and high dose praeruptorin A groups(15,30 and 60 mg/kg).The rat model of CVA was established by intraperitoneal injection of sensitizer(1 mg/mL ovalbumin and 10 mg/mL aluminum hydroxide)and aerosol inhalation of 1%ovalbumin followed by the corresponding dosing of drugs by gavage initiated on the 14th day.Another 14 days later,the rats had their pathological pulmonary changes observed by HE,Masson and PAS stainings;their number of inflammatory cells in bronchoalveolar lavage fluid(BALF)detected by hematology analyzer;and their levels of IL-4,IL-5,IL-13 and MUC5AC in BALF detected by ELISA.The RAW264.7 cell inflammatory model induced by lipopolysaccharide(LPS)was treated with 4,8,16 μmol/L praeruptorin A or 0.25 mg/mL Suhuang antitussive capsules,respectively.And the cells had their NO level detected by Griess method,and their ROS expression observed using fluorescence microscopy.The detections of the pulmonary and cellular mRNA expressions of IL-6,IL-1β,COX-2,iNOS and PPAR-γ by RT-qPCR;and the protein expressions of p-P65,P65,p-IκBα,IκBα,NLRP3,caspase-1(p20)and IL-1β by Western blot were conducted in both the cells and the rats.RESULTS The in vivo result showed that praeruptorin A reduced the cough frequency(P＜0.01);prolonged the cough latency(P＜0.05,P＜0.01);reduced the number of eosinophils and neutrophils in BALF(P＜0.05,P＜0.01);decreased the levels of IL-4,IL-5,IL-13 and MUC5AC in BALF and the pulmonary mRNA expressions of IL-6,IL-1β,COX-2 and iNOS(P＜0.05,P＜0.01);and decreased the phosphorylation of P65 and IκBα protein and NLRP3,caspase-1(p20)and IL-1β protein expressions(P＜0.05,P＜0.01)as well.The in vitro result showed that praeruptorin A inhibited the release of LPS-induced NO and reduce the ROS level(P＜0.01);decreased the mRNA expressions of IL-1β,COX-2 and iNOS(P＜0.05,P＜0.01);increased PPAR-γ mRNA expression(P＜0.05),and decreased the phosphorylation of P65 and IκBα protein and the expression of NLRP3 protein(P＜0.05,P＜0.01).CONCLUSION Praeruptorin A,one of the main antitussive components of Suhuang antitussive capsules,may improve CVA because of its anti-inflammatory and antitussive role by inhibiting the activation of NF-κB signaling pathway and reducing the expression of NLRP3 inflammatory corpuscles.

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.