OBJECTIVE: To explore the genetic basis for a child with Neurodevelopmental disorder with or without autistic features and/or structural brain abnormalities (NEDASB). METHODS: A child with NEDASB who presented at the Third Affiliated Hospital of Zhengzhou University in July 2021 was selected as the subject. Peripheral blood samples of the child and her parents were collected and subjected to high-throughput sequencing. Candidate variant was verified by Sanger sequencing and bioinformatic analysis. RESULTS: The child was found to harbor a heterozygous c.820_828delinsCTTCA (p.Thr274Leufs*121) variant of the NOVA2 gene, for which both of her parents were of wild type. The variant was predicted as pathogenic based on the guidelines from the American College of Medical Genetics and Genomics. CONCLUSION The heterozygous c.820_828delinsCTTCA (p.Thr274Leufs*121) variant of the NOVA2 gene probably underlay the disease in this child. Above finding has enriched the spectrum of NOVA2 gene variants and provided a basis for genetic counseling and prenatal diagnosis for this family.
Child ; Female ; Humans ; Pregnancy ; Autistic Disorder/genetics* ; Brain ; Computational Biology ; Genetic Counseling ; Mutation ; Nerve Tissue Proteins/genetics* ; Neuro-Oncological Ventral Antigen ; Neurodevelopmental Disorders ; RNA-Binding Proteins

Brain size abnormality is correlated with an increased frequency of autism spectrum disorder (ASD) in offspring. Genetic analysis indicates that heterozygous mutations of the WD repeat domain 62 (WDR62) are associated with ASD. However, biological evidence is still lacking. Our study showed that Wdr62 knockout (KO) led to reduced brain size with impaired learning and memory, as well as ASD-like behaviors in mice. Interestingly, Wdr62 Nex-cKO mice (depletion of WDR62 in differentiated neurons) had a largely normal brain size but with aberrant social interactions and repetitive behaviors. WDR62 regulated dendritic spinogenesis and excitatory synaptic transmission in cortical pyramidal neurons. Finally, we revealed that retinoic acid gavages significantly alleviated ASD-like behaviors in mice with WDR62 haploinsufficiency, probably by complementing the expression of ASD and synapse-related genes. Our findings provide a new perspective on the relationship between the microcephaly gene WDR62 and ASD etiology that will benefit clinical diagnosis and intervention of ASD.
Mice ; Animals ; Microcephaly/genetics* ; Autistic Disorder/metabolism* ; Autism Spectrum Disorder/metabolism* ; Nerve Tissue Proteins/metabolism* ; Brain/metabolism* ; Mice, Knockout ; Cell Cycle Proteins/metabolism*

Autism spectrum disorder (ASD) is a highly heritable neurodevelopmental disorder characterized by deficits in social interactions and repetitive behaviors. Although hundreds of ASD risk genes, implicated in synaptic formation and transcriptional regulation, have been identified through human genetic studies, the East Asian ASD cohorts are still under-represented in genome-wide genetic studies. Here, we applied whole-exome sequencing to 369 ASD trios including probands and unaffected parents of Chinese origin. Using a joint-calling analytical pipeline based on GATK toolkits, we identified numerous de novo mutations including 55 high-impact variants and 165 moderate-impact variants, as well as de novo copy number variations containing known ASD-related genes. Importantly, combined with single-cell sequencing data from the developing human brain, we found that the expression of genes with de novo mutations was specifically enriched in the pre-, post-central gyrus (PRC, PC) and banks of the superior temporal (BST) regions in the human brain. By further analyzing the brain imaging data with ASD and healthy controls, we found that the gray volume of the right BST in ASD patients was significantly decreased compared to healthy controls, suggesting the potential structural deficits associated with ASD. Finally, we found a decrease in the seed-based functional connectivity between BST/PC/PRC and sensory areas, the insula, as well as the frontal lobes in ASD patients. This work indicated that combinatorial analysis with genome-wide screening, single-cell sequencing, and brain imaging data reveal the brain regions contributing to the etiology of ASD.
Humans ; Autism Spectrum Disorder/metabolism* ; Autistic Disorder ; Exome Sequencing ; DNA Copy Number Variations ; East Asian People ; Brain/metabolism* ; Mutation/genetics* ; Genetic Predisposition to Disease/genetics*

OBJECTIVE: To explore the genetic basis for a child featuring idiopathic epilepsy and autism. METHODS: Peripheral blood samples of the child and his parents were collected with informed consent for the extraction of genome DNA. Whole exome sequencing was carried out for the family trio. Candidate variants were verified by Sanger sequencing and bioinformatic analysis. RESULTS: The proband was found to harbor a heterozygous nonsense c.3025C>T (p.Arg1009Ter) variant in exon 7 of the CASR gene exon 7, which may produce a truncated protein. Based on the guidelines of the American College of Medical Genetics and Genomics, the variant was predicted to be deleterious and classified as possibly pathogenic (PVS1+PM2). CONCLUSION The c.3025C>T (p.Arg1009Ter) variant of the CASR gene probably underlay the disease in this child.
Autistic Disorder ; Child ; Epilepsy/genetics* ; Exons ; Heterozygote ; Humans ; Receptors, Calcium-Sensing/genetics* ; Whole Exome Sequencing

OBJECTIVE: To explore the genetic basis for a child manifesting with intellectual disability, language delay and autism spectrum disorder. METHODS: Genomic DNA was extracted from peripheral blood samples of the child and his family members, and subjected to whole exome sequencing. Candidate variants were verified by Sanger sequencing and interpreted according to the guidelines of the American College of Medical Genetics and Genomics. RESULTS: The child was found to harbor a heterozygous c.568C>T (p.Q190X) nonsense variant of the ADNP gene, which was not detected in either parent by Sanger sequencing. CONCLUSION The clinical and genetic testing both suggested that the child has Helsmoortel-van der Aa syndrome due to ADNP gene mutation, which is extremely rare in China.
Abnormalities, Multiple/genetics* ; Autism Spectrum Disorder/genetics* ; Autistic Disorder/genetics* ; Child ; Heterozygote ; Homeodomain Proteins/genetics* ; Humans ; Intellectual Disability/genetics* ; Mutation ; Nerve Tissue Proteins/genetics* ; Rare Diseases

OBJECTIVE: To investigate the effects of CACNA1H gene knockout (KO) on autistic-like behaviors and the morphology of hippocampal neurons in mice. METHODS: In the study, 25 CACNA1H KO mice of 3-4 weeks old and C57BL/6 background were recruited as the experimental group, and 26 wild type (WT) mice of the same age and background were recruited as the control group. Three-chamber test and open field test were used to observe the social interaction, anxiety, and repetitive behaviors in mice. After that, their brain weight and size were measured, and the number of hippocampal neurons were observed by Nissl staining. Furthermore, the CACNA1H heterozygote mice were interbred with Thy1-GFP-O mice to generate CACNA1H^-/--Thy1⁺(KO-GFP) and CACNA1H^+/+-Thy1⁺ (WT-GFP) mice. The density and maturity of dendritic spines of hippocampal neurons were observed. RESULTS: In the sociability test session of the three-chamber test, the KO mice spent more time in the chamber of the stranger mice than in the object one (F_{1, 14}=95.086, P < 0.05; Post-Hoc: P < 0.05), without any significant difference for the explored preference index between the two groups (t=1.044, P>0.05). However, in the social novelty recognition test session, no difference was observed between the time of the KO mice spend in the chamber of new stranger mice and the stranger one (F_{1, 14}=18.062, P < 0.05; Post-Hoc: P>0.05), and the explored preference index of the KO mice was less than that of the control group (t=2.390, P < 0.05). In the open field test, the KO mice spent less time in the center of the open field apparatus than the control group (t=2.503, P < 0.05), but the self-grooming time was significantly increased compared with the control group (t=-2.299, P < 0.05). Morphological results showed that the brain weight/body weight ratio (t=0.356, P>0.05) and brain size (t=-0.660, P>0.05) of the KO mice were not significantly different from those of the control group, but the number of neurons were significantly reduced in hippocampal dentate gyrus compared with the control group (t=2.323, P < 0.05). Moreover, the density of dendritic spine of dentate gyrus neurons in the KO-GFP mice was significantly increased compared with the control group (t=-2.374, P < 0.05), without any significant difference in spine maturity (t=-1.935, P>0.05). CONCLUSION CACNA1H KO mice represent autistic-like behavior, which may be related to the decrease in the number of neurons and the increase in the density of dendritic spine in the dentate gyrus.
Animals ; Autistic Disorder/genetics* ; Calcium Channels, T-Type/genetics* ; Gene Knockout Techniques ; Hippocampus ; Mice ; Mice, Inbred C57BL ; Mice, Knockout ; Neurons

OBJECTIVE: To assess the association of C677T polymorphism of methylenetetrahydrofolate reductase (MTHFR) gene with autistic behavior and inheritance pattern of children patients. METHODS: Ninety three autism patients were selected as the study group, whilst 93 healthy children were selected as the control group. The C677T genotype of the MTHFR gene was determined, and the correlation between the genotype and the autistic behavior and inheritance pattern were investigated. RESULTS: MTHFR gene C677T locus revealed three genotypes CC, CT and TT. Compared with the control group, the study group had fewer CC genotype but more TT genotype (P<0.05). Individuals with the three genotypes showed a statistically significant difference in the frequencies of four problem behaviors (P<0.05). Regression analysis showed that at least one T allele encoding the degree of 1 and 2 for the 4 problem behaviors that were statistically different. MTHFR gene C677T genotype was associated with autism under the recessive inheritance model and allelic inheritance model (P<0.05). CONCLUSION The C677T polymorphism of the MTHFR gene is associated with autistic behaviors. Children with the TT genotype or T allele are at higher risk of developing autism, particularly direct gaze, complex limb movements, self-injurious behavior and hyperactivity 1 and 2 related with the degree of coding.
Autistic Disorder/genetics* ; Child ; Genetic Predisposition to Disease ; Genotype ; Humans ; Inheritance Patterns ; Methylenetetrahydrofolate Reductase (NADPH2)/genetics* ; Problem Behavior

OBJECTIVE: To analyze the clinical characteristics and genetic etiology of a child with Helsmoortel-Van der Aa syndrome (HVDAS). METHODS: Genetic testing was carried out for the child and his parents, and the clinical phenotypes and genetic variants of reported cases were summarized through literature review. RESULTS: The child has featured peculiar facies, accompanied by autism spectrum disorder, intellectual disability and motor retardation, and curving of the second toes, which was unreported previously. Genetic testing revealed that the child has harbored a heterozygous c.2157C>G (p.Tyr719*) variant of the ADNP gene, which was not found in either parent. Based on the guidelines of the American College of Medical Genetics and Genomics, this variant was rated as pathogenic. Among 80 HVDAS cases described in the literature, most had various degrees of behavioral abnormalities, intellectual disability, language retardation and motor retardation, with common features involving the nervous system, gastrointestinal system and eye. Variants of the ADNP gene mainly included frameshift variants and nonsense variants, with the hotspot variants including p.Tyr719*, p.Asn832lysfs*81 and p.Arg730*. CONCLUSION The clinical phenotype of the child is closely correlated with the heterozygous variant of the ADNP gene, which expanded the phenotypic spectrum of HVDAS. As HVDAS may involve multiple systems and have high phenotypic heterogeneity, genetic testing technology can facilitate accurately diagnose.
Abnormalities, Multiple/genetics* ; Autism Spectrum Disorder/genetics* ; Autistic Disorder/genetics* ; Homeodomain Proteins/genetics* ; Humans ; Intellectual Disability/genetics* ; Mutation ; Nerve Tissue Proteins/genetics* ; Rare Diseases/complications*

Humans ; Autistic Disorder ; China/epidemiology* ; Cohort Studies ; Autism Spectrum Disorder/genetics* ; Asian People

OBJECTIVE: To retrospectively analyze the clinical phenotype and genetic characteristics of a child with severe mental retardation, language and motor development delays and autism. METHODS: High-throughput sequencing was carried out for the patient. Candidate variant was verified by Sanger sequencing and bioinformatics analysis. RESULTS: The child was found to harbor a heterozygous variant of exon 11:c.1421_1422insTGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) of the ASXL3 gene. The same variant was found in neither of her parents, suggesting that it has a de novo origin. CONCLUSION The exon 11:c.1421_1422ins TGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) variant of the ASXL3 gene probably underlay the pathogenesis of Bainbridge-Ropers syndrome in this patient. Above finding has enriched the spectrum of ASXL3 gene variants.
Autistic Disorder/genetics* ; Child ; Developmental Disabilities ; Female ; Humans ; Mutation ; Retrospective Studies ; Syndrome ; Transcription Factors/genetics*