Objective:To explore the potential of integrating virtual surgery with three-dimensional (3D) printed guides in the surgical management of mandibular benign tumors and subsequent reconstruction of bone defects.Methods:A retrospective analysis was conducted on the clinical data of patients who underwent computer-assisted resection and vascularized fibular flap reconstruction for benign mandibular tumors at the Department of Oral and Maxillofacial Surgery, First Affiliated Hospital of Zhengzhou University, from June 2013 to December 2020. According to the utilization of guide plates for mandibular and fibular osteotomy during surgical procedures or not, the patients were categorized into two cohorts: a guide plate cohort and a non-guide plate cohort. In the guide plate group, custom-designed gudie plates based on virtual surgical plans were fabricated using 3D printing technology and employed intraoperatively; In the non-guide plate group, surgery was exclusively performed based on virtual surgical plan and prebent titanium plate without any supplementary plating. The measured outcomes included fibular flap osteotomy, operation duration, and clinical flap survival. Computed tomography images obtained one week post-surgery were utilized to assess the intersegmental commissure degree between fibular segments as well as between fibular segments and mandible, commissure degree between fibular segments and prebent titanium plate, and condyle position. The satisfaction of patients with their facial appearance was evaluated 6 months after the surgery using a visual analogue scale. Statistical analysis was conducted using SPSS 21.0 software. Independent sample t-tests was utilized to compare the duration of operation and and postoperative evaluation of facial appearance, the Chi-square tests was utilized for condyle position, commissure degrees among interactions involving fibular segments, prebent titanium plates, bone segments( P<0.05 denoted statistical significance). Results:A total of 30 patients were enrolled, comprising 17 males and 13 females, with a median age of 24 years (16-64 years). The preparation process of fibular flaps proceeded smoothly. The required length of fibula was measured as (14.1 ± 1.9) cm (5.7-18.1 cm), while the number of fibular segments ranged from 2 to 4, averaging at approximately 2.9 ± 0.6. The mandibular defects were repaired using a single-layer fibula in 12 cases, a vascularized folded fibula in 7 cases and a combination of vascularized and non-vascularized fibula in 11 cases. The operation time for the guide plate group was recorded as ( 335.9 ± 64.0) min (240-433 min), while it was observed to be (470.7 ± 140.5 ) min (280-680 min) for the non-guide plate group.The postoperative follow-up duration ranged from 9 to 23 months, with an average period of 11 months. All fibular flaps demonstrated clinical survival. The number of patients with good commissure degree between fibular and mandibular segments, between prebent titanium plate and fibular and mandibular segments and the position of condyle were 15, 15 and 13 cases in guide plate group, 10, 13 and 11 cases in non-guide plate group respectively. The statistical analysis revealed a significant difference ( P<0.05) in the degree of commissure between the fibular and the mandibular segments (15/15 vs. 10/15) in the two groups. Both groups exhibited high levels of satisfaction regarding their postoperative facial appearance at the 6 months follow-up, observed to be 9.6±0.5 and 9.3±0.5 respectively, and the statisticla analysis revealed non-significant difference ( P>0.05). Conclusion:The integration of virtual surgery with 3D printed guide plates can effectively reduce operative time and improve precision in the repair and reconstruction of free-fibular flaps following resection of benign tumors of the mandible.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

Objective:To explore the potential of integrating virtual surgery with three-dimensional (3D) printed guides in the surgical management of mandibular benign tumors and subsequent reconstruction of bone defects.Methods:A retrospective analysis was conducted on the clinical data of patients who underwent computer-assisted resection and vascularized fibular flap reconstruction for benign mandibular tumors at the Department of Oral and Maxillofacial Surgery, First Affiliated Hospital of Zhengzhou University, from June 2013 to December 2020. According to the utilization of guide plates for mandibular and fibular osteotomy during surgical procedures or not, the patients were categorized into two cohorts: a guide plate cohort and a non-guide plate cohort. In the guide plate group, custom-designed gudie plates based on virtual surgical plans were fabricated using 3D printing technology and employed intraoperatively; In the non-guide plate group, surgery was exclusively performed based on virtual surgical plan and prebent titanium plate without any supplementary plating. The measured outcomes included fibular flap osteotomy, operation duration, and clinical flap survival. Computed tomography images obtained one week post-surgery were utilized to assess the intersegmental commissure degree between fibular segments as well as between fibular segments and mandible, commissure degree between fibular segments and prebent titanium plate, and condyle position. The satisfaction of patients with their facial appearance was evaluated 6 months after the surgery using a visual analogue scale. Statistical analysis was conducted using SPSS 21.0 software. Independent sample t-tests was utilized to compare the duration of operation and and postoperative evaluation of facial appearance, the Chi-square tests was utilized for condyle position, commissure degrees among interactions involving fibular segments, prebent titanium plates, bone segments( P<0.05 denoted statistical significance). Results:A total of 30 patients were enrolled, comprising 17 males and 13 females, with a median age of 24 years (16-64 years). The preparation process of fibular flaps proceeded smoothly. The required length of fibula was measured as (14.1 ± 1.9) cm (5.7-18.1 cm), while the number of fibular segments ranged from 2 to 4, averaging at approximately 2.9 ± 0.6. The mandibular defects were repaired using a single-layer fibula in 12 cases, a vascularized folded fibula in 7 cases and a combination of vascularized and non-vascularized fibula in 11 cases. The operation time for the guide plate group was recorded as ( 335.9 ± 64.0) min (240-433 min), while it was observed to be (470.7 ± 140.5 ) min (280-680 min) for the non-guide plate group.The postoperative follow-up duration ranged from 9 to 23 months, with an average period of 11 months. All fibular flaps demonstrated clinical survival. The number of patients with good commissure degree between fibular and mandibular segments, between prebent titanium plate and fibular and mandibular segments and the position of condyle were 15, 15 and 13 cases in guide plate group, 10, 13 and 11 cases in non-guide plate group respectively. The statistical analysis revealed a significant difference ( P<0.05) in the degree of commissure between the fibular and the mandibular segments (15/15 vs. 10/15) in the two groups. Both groups exhibited high levels of satisfaction regarding their postoperative facial appearance at the 6 months follow-up, observed to be 9.6±0.5 and 9.3±0.5 respectively, and the statisticla analysis revealed non-significant difference ( P>0.05). Conclusion:The integration of virtual surgery with 3D printed guide plates can effectively reduce operative time and improve precision in the repair and reconstruction of free-fibular flaps following resection of benign tumors of the mandible.

Objective:To explore the role of endothelial biomarkers in predicting damp-heat syndrome in diabetic kidney disease (DKD).Methods:A total of 183 patients with DKD were divided into 3 groups:the early DKD group,established DKD group,and advanced DKD group.All patients were classified according to traditional Chinese medicine (TCM) syndrome type,and clinical indexes were collected for statistical analysis.Results:A total of 183 DKD patients were included in this study.Fibroblast growth factor 23 (FGF23),chitinase-3-like protein 1 (CHI3L1),endocan,tumor necrosis factor receptor 1 (TNFR1),secretory leukocyte protease inhibitor (SLPI),and vascular endothelial growth factor A (VEGF-A) were increased in advanced DKD.FGF23,CHI3L1,endocan,SLPI,and TNFR1 showed a negative correlation with estimated glomerular filtration rate (eGFR),while they had a positive correlation with 24 h urine protein.After adjusting for age,gender,diabetes duration,body mass index (BMI),hemoglobin,glucose,uric acid,24 h urine protein,cholesterol,triglyceride,low-density lipoprotein,and hemoglobin A1c (HbA1c),the multiple regression analysis showed that FGF23,endocan,TNFR1,and SLPI significantly correlated with eGFR.Conclusions:FGF23,endocan,TNFR1,and SLPI are elevated in advanced DKD compared with early stage,and they may take part in the pathogenesis and progression of DKD.Our study provides useful bio-markers for predicting the appearance of damp-heat syndrome,including FGF23,endocan,TNFR1,and SLPI.

Objective:As the amount of scientific reagents/consumables procurement in tertiary medical institutions increases year by year, it is necessary to seek for a more optimized operation mode for the current management needs to improve the procurement service and management of scientific reagents/consumables.Methods:Focused on the bottleneck problem of scientific research reagents/consumables procurement management, combined with the investigation of management mode in the same field and the review of relevant literature, a scientific research reagents/consumables procurement platform suitable for hospital was established, which was operated in the whole hospital for 2 years and continuingly improved.Results:The application of the scientific reagents/consumables procurement platform is expected to save 7%~8% of the scientific reagents/consumables related expenditure, which can make the scientific research procurement work standardized and simple, the procurement management precise and fast, and also provide favorable support for the prevention and control of epidemic diseases in hospitals.Conclusions:This platform is conducive to improving the service and management level of scientific reagents/consumables procurement in our hospital, and has conditions to expand the scope and increase the depth of management and service.

Critical ultrasonography(CUS) is different from the traditional diagnostic ultrasound,the examiner and interpreter of the image are critical care medicine physicians.The core content of CUS is to evaluate the pathophysiological changes of organs and systems and etiology changes.With the idea of critical care medicine as the soul,it can integrate the above information and clinical information,bedside real-time diagnosis and titration treatment,and evaluate the therapeutic effect so as to improve the outcome.CUS is a traditional technique which is applied as a new application method.The consensus of experts on critical ultrasonography in China released in 2016 put forward consensus suggestions on the concept,implementation and application of CUS.It should be further emphasized that the accurate and objective assessment and implementation of CUS requires the standardization of ultrasound image acquisition and the need to establish a CUS procedure.At the same time,the standardized training for CUS accepted by critical care medicine physicians requires the application of technical specifications,and the establishment of technical specifications is the basis for the quality control and continuous improvement of CUS.Chinese Critical Ultrasound Study Group and Critical Hemodynamic Therapy Collabration Group,based on the rich experience of clinical practice in critical care and research,combined with the essence of CUS,to learn the traditional ultrasonic essence,established the clinical application technical specifications of CUS,including in five parts:basic view and relevant indicators to obtain in CUS;basic norms for viscera organ assessment and special assessment;standardized processes and systematic inspection programs;examples of CUS applications;CUS training and the application of qualification certification.The establishment of applied technology standard is helpful for standardized training and clinical correct implementation.It is helpful for clinical evaluation and correct guidance treatment,and is also helpful for quality control and continuous improvement of CUS application.

OBJECTIVE:To systematically evaluate therapeutic efficacy of Xuefu zhuyu decoction in the adjuvant treatment of unstable angina pectoris (UAP),and to provide systematic evidence-based reference in clinic.METHODS:Retrieved from PubMed,EMBase,Cochrane library,CJFD,Wanfang database,VIP and CBM,randomized controlled trials (RCTs) about Xuefu zhuyu decoction+conventional treatment (trial group) vs.single conventional treatment (control group) in the treatment of UAP were collected.Meta-analysis was performed by using Rev Man 5.2 statistical software after data extraction and Cochrane systematic review manual 5.1.0.RESULTS:Totally 12 RCTs were included,involving 1 252 patients.The results of Meta-analysis showed that total response rate [OR=3.56,95％CI(2.49,5.10),P＜0.001],serum HDL[WMD=0.25,95％CI(0.05,0.45),P=0.01] and the rate of ECG improvement [OR=2.76,95％CI(1.97,3.87),P＜0.001] of trial group were significantly higher than those of control group,while serum TC [WMD=-1.14,95％CI(-1.46,-0.82),P＜0.001],TG [WMD=-0.53,95％CI(-0.84,-0.22),P＜0.001] and CRP [WMD =-0.91,95 ％ CI (-1.14,-0.69),P＜ 0.001] levels of trial group were significantly lower than those of control group,with statistical significance.CONCLUSIONS:Therapeutic efficacy of Xuefu zhuyu decoction in adjuvant treatment have good therapeutic efficacy and can significantly improve the blood lipid and inflammatory factors level.

Objective:To observe the effect of warm needling plus oral administration of rosuvastatin calcium tablets on blood lipids in cerebral infarction patients. Methods:A total of 125 eligible cases were randomly allocated into group A (n=42), group B (n=40) and group C (n=43). Cases in group A received warm needling plus oral administration of rosuvastatin calcium tablets, cases in group B received warm needling, whereas cases in group C received oral administration of rosuvastatin calcium tablets. Results:After treatment, the total cholesterol (TC), triglyceride (TG), low-density lipoprotein cholesterol (LDL-C) all dropped obviously in the three groups, with significant differences (allP<0.05), modified Barthel index (BI) scores all significantly rise (allP<0.05), and high-density lipoprotein cholesterol (HDL-C) remained unchanged (allP>0.05). After treatment, the changes of TC, TG and LDL-C in group A were significantly different from those in group B and group C (allP<0.05), while the changes showed no statistical significance between group B and group C (P>0.05). There were no between-group differences in HDL-C among the three groups (allP>0.05); the modified BI scores in groupA and groupB were significantly higher than that in group C (bothP<0.05), while there was no significant difference between group A and group B (P>0.05).After treatment, the total effective rate was significantly higher in group A than that in group B and group C (bothP<0.05), there was no significant difference between group B and group C (P>0.05). Conclusion:Warm needling and oral administration of rosuvastatin calcium tablets both can adjust blood lipids effectively in cerebral infarction patients with a similar therapeutic efficacy, while the effect gets better based upon combining both methods; acupuncture-moxibustion plays an important role in the recovery of nerve functions in cerebral infarction patients.

ObjectiveTo evaluate whether AN69 ST membrane would prolong filter lifetime in continuous renal replacement therapy (CRRT) without anticoagulation in patients with high risk of bleeding.Methods A single-center, prospective, randomized, double-blind control trial with crossover design was conducted. From March 1st to December 31st in 2013, patients who were admitted to Department of Critical Care Medicine of the Fourth Hospital of Hebei Medical University meeting CRRT treatment indications, but could not receive systemic anticoagulation because of high risk of bleeding were studied. The selected patients were randomly divided into two groups according to a random number table, and four filters consisting of two AN69 ST100 membrane filters (A) and two traditional AN69 M100 membrane filters (B) were used for them. GroupⅠ with the filter order of A-B-A-B, and groupⅡ with the order of B-A-B-A. The clinical data of patients was recorded in detail, and conventional AN69 ST and AN69 membrane filter lifetime, their influence on coagulability, and the incidence of bleeding complications were compared.Results Seventeen patients were enrolled, with 10 in groupⅠ, and 7 in groupⅡ. The basic medical characteristics including gender, age, acute physiology and chronic health evaluationⅡ (APAECHⅡ) score, sequential organ failure score (SOFA), Acute Renal Injury Network (AKIN) stage, activated partial thromboplastin time (APTT), prothrombin time (PT), international normalized ratio (INR), platelet count (PLT), and use of mechanical ventilation were not significantly different between two groups. But the use of vasoactive drug was more frequent in groupⅡcompared with that of groupⅠ[100.0% (7/7) vs. 30.0% (3/10),χ2 = 8.330,P = 0.010]. AN69 ST filter lifetime (n =34) was (15.92±2.10) hours, there was no statistically significant difference compared with that of AN69 membrane (t = 0.088,P = 0.942), filter lifetime of which (n = 34) was (16.12±1.38) hours. It was also found by Kaplan-Meier survival analysis that there was no significant difference between the two membrane filter lifetime (χ2=1.589,P =0.208). Logistic regression analysis showed that the life of the first filter was not correlated with coagulation indicators, including APTT, PT, INR, and PLT [APTT: odds ratio (OR) = 0.977, 95% confidence interval (95%CI) = 0.892-1.071, P = 0.623; PT:OR = 1.001, 95%CI = 0.901-1.109,P = 0.988; INR:OR = 1.078, 95%CI = 0.348-3.340,P = 0.896;PLT:OR = 0.996, 95%CI = 0.974-1.019,P = 0.735]. The application rate of vasoactive drugs, which was different between two groups for basic medical indications showed no effect on filter life time (OR = 2.541, 95%CI = 0.239-26.955,P = 0.439). Reasons of clotting in filters were also analyzed, and it was found that blood coagulation in the filter ranked the top (88.2%), and the other reasons were catheter-related problems, death, and unscheduled transport. No difference in blood coagulation function was found in both groups after treatment for 12 hours, and there was no bleeding complication.ConclusionDuring the CRRT without systemic anticoagulant, both surface-treatment with polyethyleneimine AN69 and AN69 ST membrane cannot prolong filter lifetime.

Objectives To evaluate the association between serum cystatin C and carotid atherosclerosis.Methods Medical data,including physical examinations,serum levels of cystatin C,bilirubin,uric acid and other biochemical markers and duplex ultrasonographic scanning for the carotid artery,of 1741 healthy adults (1193 men and 548 women) who sought physical check-up at Peking Union Medical College Hospital during January 2010 and December 2011 were collected,and those with hypertension,diabetes and liver or renal function failure were excluded.Based on the results of carotid duplex uhrasonography,all the adults checked were assigned to two groups,one with thickened intima-media and atherosclerotic plaque (group A),the other with non-thickened intima-media and non-atherosclerotic plaque (group B).Difference in serum cystatin C,bilirubin,uric acid and other biochemical markers between the two groups was analyzed by using Student's t test.The correlation between the markers and carotid plaque was analyzed by using Spearman correlation analysis.The correlated factors of the carotid thickness and plaque appearance were analyzed by using unconditional Logistic regression analysis.Results Serum level of cystatin C was significantly increased in group A (t =-8.85,P ＜ 0.05).Thickness of carotid intima was positively correlated with serum cystatin C (r =0.21,P ＜ 0.05).In multivariate Logistic regression analysis,high level of serum cystatin C was not an independent risk factor of carotid atherosclerosis.Conclusion Relationship between serum cyatatin C and carotid atherosclerosis was not confirmed in our populations,which should be explored further in cohort studies.