Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.

In order to study the biological characteristics and whole-genome sequence of Streptococ-cus equi,a sheep-derived Streptococcus equi preserved in our laboratory was subjected to recovery,biochemical experiments,drug susceptibility tests and animal experiments,and followed by whole genome sequencing and annotation of the gene functions of the genome by using the biogenetic da-tabase.The biochemical identification results showed that this strain could ferment sugars,but the results of nitrate,catalase,V-P test,and M-R test were negative;the drug susceptibility test results showed that this strain was highly sensitive to most antibiotics and was resistant to kanaphylaxis.It was resistant to amikacin and amikacin;animal experiments showed that the lethality rate of this strain to mice was 100％,and the median lethal dose of this strain was measured to be 4.86X 106 CFU/kg.According to the pathological section results of mice,it showed that the lungs,liver,kidneys,and spleen all had varying degrees of lesions.The whole genome sequencing results showed that the total genome length of this strain is 2 272 497 bp,the G+C content was 41.1％,and it was predicted to contain 2 124 CDS regions.The RNA prediction results showed that the number of rRNA and tRNA was 15,and the number of tRNA was 57.There were four prophages and gene islands,and there were 362 pathogenicity-related genes in the VFDB database without CRISPR sequences.This study analyzed the complete genome of Streptococcus equi derived from sheep,and also provided a theoretical basis for the treatment,prevention and control of the disease.

[Objective]To explore innovative approaches for integrating ethical culture education in traditional Chinese medicine(TCM)colleges and universities,which involves extracting elements of integrity from TCM culture to develop an ethical education program tailored for these institutions.[Methods]Applying literature research methods,this study extracts similarities between TCM culture and ethical culture.It utilizes key TCM concepts like"four diagnoses integration""differential diagnosis and treatment""good prescription""treating both the symptoms and root causes"as a framework for ethical culture education in TCM colleges and universities.[Results]TCM culture is found to contain a wealth of ethical and methodological content,showing high compatibility with ethical culture.Ethical culture education in TCM colleges and universities currently faces challenges,including a lack of comprehensive integration of the"four diagnoses",insufficient"differential diagnosis and treatment",limited use of"good prescriptions"and a weak foundation in"treating both the symptoms and root causes".It is necessary to further improve the achievements of clean culture education in TCM colleges and universities by using measures such as finding out the reality of clean ideology education,improving the clean culture education system,skillfully carrying out clean culture education,and building a solid line of clean culture education.[Conclusion]Through case study of Zhejiang Chinese Medical University provides insights into the current state of ethical education.It emphasizes the need to improve the ethical culture education system,execute ethical culture education strategically and strengthen the ethical education defense line.These findings could serve as a model for ethical culture education in universities.

Nonpharmaceutical interventions (NPIs) have been commonly deployed to prevent and control the spread of the coronavirus disease 2019 (COVID-19), resulting in a worldwide decline in influenza prevalence. However, the influenza risk in China warrants cautious assessment. We conducted a cross-sectional, seroepidemiological study in Shandong Province, Northern China in mid-2021. Hemagglutination inhibition was performed to test antibodies against four influenza vaccine strains. A combination of descriptive and meta-analyses was adopted to compare the seroprevalence of influenza antibodies before and during the COVID-19 pandemic. The overall seroprevalence values against A/H1N1pdm09, A/H3N2, B/Victoria, and B/Yamagata were 17.8% (95% CI 16.2%-19.5%), 23.5% (95% CI 21.7%-25.4%), 7.6% (95% CI 6.6%-8.7%), and 15.0 (95% CI 13.5%-16.5%), respectively, in the study period. The overall vaccination rate was extremely low (2.6%). Our results revealed that antibody titers in vaccinated participants were significantly higher than those in unvaccinated individuals (P < 0.001). Notably, the meta-analysis showed that antibodies against A/H1N1pdm09 and A/H3N2 were significantly low in adults after the COVID-19 pandemic (P < 0.01). Increasing vaccination rates and maintaining NPIs are recommended to prevent an elevated influenza risk in China.

Objective:To explore the clinical application of the posterior tibial artery perforator flap with the great saphenous vein (GSV) in the treatment of severe degloving injury of the forearm.Methods:From June 2015 to October 2020, 5 patinets (4 males and 1 female, aged 20-46 years old, mean age 37 years old) were treated in the Department of Hand Surgery of Yantaishan Hospital in Yantai. Aposterior tibial artery perforator flap with GSV was used to repair the partial wound of the injured forearm, together with the establishment of venous circulation of dorsal hand for all 5 patients. All the patients suffered from severe forearm degloving injury. Of which, 3 accompanied with ulna radius fracture, 2 with ulnar and radial artery injury and 2 with blood supply insufficiency in the injured fingers. The sizes of soft-tissue defect were 26 cm×18 cm-32 cm×25 cm. The sizes of the posterior tibial artery perforator flap with GSV ranged from 12 cm×5 cm to 33 cm×6 cm. The anastomoses were performed on the perforating artery and the radial artery. The GSV was anastomosed with cephalic vein with bridging anastomosis to re-establish the venous circulation of dorsal hand. Combined anterolateral thigh flaps (ALTF) were used to repair the rest wound of injured limbs in 4 patients, and the combined pedicled abdominal flap was used in 1 patient. The donor site of calf flap was sutured directly, and the skin of upper limb was thinned into medium thick to cover the thigh flap donor site, which was packed with pressure dressing. Regular follow-up reviews were carried out by outpatient clinic, telephone, WeChat APP or home-visit after the operation to observe the survival of flaps, the swelling of the distal end of injured limb, functional recovery and healing at the donor site. Functional recovery was evaluated according to the Evaluation Standard of Upper Limb Partial Functional of Hand Surgery of Chinese Medical Association.Results:All the grafted flaps in 5 patients survived. Necrosis at epidermal edge occurred in 1 calf flap, and achieved secondary healing after dress changing for 4 weeks. There was neither arterial nor venous crisis in all flaps. The oedema of the hand disappeared within 4-8 weeks, with clear dermatoglyph. There was no obvious enlarged circumference of thumb and fingers. The follow-up was carried out for 8-20 months, with 11 months in average. The flaps were elastic in good colour, and full texture without pigmentation. The donor site of the calf flap showed a linear scar. No swollen was seen in the hands of the injured forearm and the feet of donor lower legs. The range of motion of phalangeal joints was good. Recovery of finger sensation achieved at S 4. The recovery of the sensation of posterior tibial artery perforator flap reached S 3 in 2 patients and S 2 in 3 patients. Assessment of the Upper Limb Function using the Standard Issued by the Hand Surgery Society of Chinese Medical Association rated excellent in 3 patients and good in 2 patients. Conclusion:The posterior tibial artery perforator flap with GSV has a reliable blood supply with a small damage to the donor site. This flap is ideal for repair of severe degloving injury of forearm and meanwhile to achieve the re-establishment of venous circulation in dorsal hand.

Objective:The surgical method and clinical efficacy was studied on the anterior lateral malleolar venous network grafting in repair of the defects of superficial palmar arch.Methods:From February 2015 to July 2021, 8 cases (6 males and 2 females; aged 32-44 years old, mean age at 39 years old) were treated in the Department of Hand Surgery of Yantaishan Hospital. Anterior lateral malleolar venous network was grafted to repair the defects of superficial palmar arch of the patients. The patients had different degrees of tendon damage, and injuries of nerve, deep palmar arch, common palmar digital artery or proper palmar digital artery. The length of the vessel defect was 6.0-10.0 cm. Blood supply insufficiency occurred in 1st-5th digits in 1 case, 2nd-4th fingers in 5 cases, and 2nd-5th fingers in 2 cases. The anterior lateral malleolar venous network was transferred to repair 3 broken ends of vessels in 5 cases, 4 broken ends in 1 case and 5 broken ends in 2 cases. The wound of hand was sutured directly in 2 cases. The emergency surgical repair of the wound of hand by transfer of ALTPF was performed in 2 patients, and elective ALTPF transfer in 3 cases. Forearm dorsi-ulnar flap transfer was performed in 1 case. The follow-up reviews were carried out via the outpatient clinic visit, telephone, WeChat interviews or home visits. The blood supply of the distal digit, skin sensation, TPD, the range of motion of the phalangeal joints were observed.Results:The results showed that all the digits and the grafted flaps survived. The follow-up was carried out for 10-53 months, with an average of 17.9 months. The functions of digit extension and flexion, finger opposition and thumb opposition were restored in 5 cases, and the patients returned back to former jobs. The finger flexion and thumb opposition were limited in 3 cases, and these cases participated in light physical work. The proprioception of the digits were recovered, and the TPD was 5-7 mm. Functional recovery was evaluated according to the Evaluation Standard of Upper Limb Partial Functional of Hand Surgery of Chinese Medical Association and rated as excellent in 5 cases and good in 3 cases. The donor sites of the foot showed a linear scar. There was no effect on the function and the shape of the donor site.Conclusion:The anterior lateral malleolar venous network grafting is an ideal method in repair of the defects of superficial palmar arch.

Hepatocellular carcinoma (HCC) has been known as the second common leading cancer worldwide, as it responds poorly to both chemotherapy and medication. Triptolide (TP), a diterpenoid triepoxide, is a promising treatment agent for its effective anticancer effect on multiple cancers including HCC. However, its clinical application has been limited owing to its severe systemic toxicities, low solubility, and fast elimination in the body. Therefore, to overcome the above obstacles, photo-activatable liposomes (LP) integrated with both photosensitizer Ce6 and chemotherapeutic drug TP (TP/Ce6-LP) was designed in the pursuit of controlled drug release and synergetic photodynamic therapy in HCC therapy. The TP encapsulated in liposomes accumulated to the tumor site due to the enhanced permeability and retention (EPR) effect. Under laser irradiation, the photosensitizer Ce6 generated reactive oxygen species (ROS) and further oxidized the unsaturated phospholipids. In this way, the liposomes were destroyed to release TP. TP/Ce6-LP with NIR laser irradiation (TP/Ce6-LP+L) showed the best anti-tumor effect both

Objective:To enhance the early recognition of Prader-Willi syndrome by summarizing the clinical characteristics of Prader-Willi syndrome (PWS) during perinatal period.Methods:Through a nationwide cross-sectional study in the Department of Pediatrics, Peking Union Medical College Hospital, Peking Union Medical College, Chinese Academy of Medical Sciences,226 children diagnosed as PWS by molecular genetics were recruited from September 2019 to March 2020. Clinical data including fetuses Age, birth weight, fetal movement, fetal position, amniotic fluid, mode of bith, crying, muscle tension, feeding, and cryptorchidism were collected to analyze the clinical characteristics of Chinese PWS patients in the perinatal period, and according to the mode of birty, birth weight and genotypes to perform subgroup analysis. The clinical manifestations of different subtypes were statistically analyzed by t test, χ 2 test or Mann-Whitney U test. Results:Among the 226 PWS patients, 120 were males, and 106 were females. Among them, 100 (44.2%) patients were small for gestational age. Decreased fetal movement was the most common manifestation 202 cases (89.4%) during pregnancy, and other manifestations included polyhydramnios 71 cases (31.4%) and abnormal fetal position 58 cases (25.7%). One hundred and eighty-five (81.9%) patients were delivered by cesarean section and the frequency of abnormal fetal position was significantly higher (30.8%(57/185) vs. 2.4%(1/41),χ2=14.161, P<0.01). As for abnormal manifestations after birth included hypotonia 221 cases (97.8%),220 cases (97.3%) showing weak crying, 116 cases among the total 120 males patients (96.7%) wanifested with cryptordnildism and 206 feeding difficulties (91.2%). In terms of genetic subtype, most of them (184/226, 81.4%) had a paternal deletion, while maternal age (35±5 vs. 29±5, t=-6.591, P<0.01) and the frequency of polyhydramnios (47.6% (20/42) vs. 27.7% (51/185), χ2=6.286, P=0.012) were significantly higher in the non-deletion group. Conclusions:The main manifestations of PWS patients during the perinatal period are hypotonia, weak crying, feeding difficulties, decreased fetal movement, cryptorchidism and those patients are more likely to be born by cesarean section. In newborns with these characteristics, pediatricians should be aware of the possibility of PWS. In terms of the relationship between genotypes and phenotypes, polyhydramnios is more frequently observed in the non-deletion group.

Objective:To investigate the different outcomes of two types of acute kidney injury (AKI) according to standard of Kidney Disease: Improving Global Outcomes-AKI (KDIGO-AKI), and to analyze the risk factors that affect the prognosis of intensive care unit (ICU) patients in China.Methods:A secondary analysis was performed on the database of a previous study conducted by China Critical Care Clinical Trial Group (CCCCTG), which was a multicenter prospective study involving 3 063 patients in 22 tertiary ICUs in 19 provinces and autonomous regions of China. The demographic data, scores reflecting severity of illness, laboratory findings, intervention during ICU stay were extracted. All patients were divided into pure AKI (PAKI) and acute on chronic kidney disease (AoCKD). PAKI was defined as meeting the serum creatinine (SCr) standard of KDIGO-AKI (KDIGO-AKI SCr) and the estimated glomerular filtration rate (eGFR) at baseline was ≥ 60 mL·min -1·1.73 m -2, and AoCKD was defined as meeting the KDIGO-AKI SCr standard and baseline eGFR was 15-59 mL·min -1·1.73 m -2. All-cause mortality in ICU within 28 days was the primary outcome, while the length of ICU stay and renal replacement therapy (RRT) were the secondary outcome. The differences in baseline data and outcomes between the two groups were compared. The cumulative survival rate of ICU within 28 days was analyzed by Kaplan-Meier survival curve, and the risk factors of ICU death within 28 days were screened by Cox multivariate analysis. Results:Of the 3 063 patients, 1 042 were enrolled, 345 with AKI, 697 without AKI. The AKI incidence was 33.11%, while ICU mortality within 28 days of AKI patients was 13.91% (48/345). Compared with PAKI patients ( n = 322), AoCKD patients ( n = 23) were older [years old: 74 (59, 77) vs. 58 (41, 72)] and more critical when entering ICU [acute physiology and chronic health evaluation Ⅱ (APACHEⅡ) score: 23 (19, 27) vs. 15 (11, 22)], had worse basic renal function [eGFR (mL·min -1·1.73 m -2): 49 (38, 54) vs. 115 (94, 136)], more basic complications [Charlson comorbidity index (CCI): 3 (2, 4) vs. 0 (0, 1)] and higher SCr during ICU stay [peak SCr for diagnosis of AKI (μmol/L): 412 (280, 515) vs. 176 (124, 340), all P < 0.01]. The mortality and RRT incidence within 28 days in ICU of AoCKD patients were significantly higher than those of PAKI patients [39.13% (9/23) vs. 12.11% (39/322), 26.09% (6/23) vs. 4.04% (13/322), both P < 0.01], while no significant difference was found in the length of ICU stay. Kaplan-Meier survival curve analysis showed that the 28-day cumulative survival rate in ICU in AoCKD patients was significantly lower than PAKI patients (Log-Rank: χ2 = 5.939, P = 0.015). Multivariate Cox regression analysis showed that admission to ICU due to respiratory failure [hazard ratio ( HR) = 4.458, 95% confidence interval (95% CI) was 1.141-17.413, P = 0.032], vasoactive agents treatment in ICU ( HR = 5.181, 95% CI was 2.033-13.199, P = 0.001), and AoCKD ( HR = 5.377, 95% CI was 1.303-22.186, P = 0.020) were independent risk factors for ICU death within 28 days. Conclusion:Further detailed classification (PAKI, AoCKD) based on KDIGO-AKI SCr standard combined with eGFR is related to ICU mortality in critical patients within 28 days.

Objective To explore the clinical application effect of multiple end-to-side anastomosis in free anterolateral thigh perforator flap transplantation.Methods From January,2013 to October,2017,29 cases were applied the technology of multiple end-to-side anastomosis to the same recipient vessel in anterolateral thigh perforator flap transplantation for wound repair.Fifteen cases treated with multiple end-to-side anastomosis on flap arteries,and 2-3 arteries were anastomosed,with the average of 2.13.Nine cases were treated with venous multiple end-to-side anastomosis,and 2-4 veins were anastomosed,with the average of 3.11.Five cases treated with arterial and venous multiple end-to-side anastomosis,and 4-6 vessels were anastomosed,with the average of 5.20.Distribution of wounds:10 cases with hands and wrists wounded,15 cases with forearms and elbow joints wounded,and 4 cases with lower legs and feet wounded.The soft tissue defect size was 5 cm×13 cm-11 cm×27 cm,and the flap area was 6 cm× 15 cm-12 cm×29 cm.Postoperative followed-up was performed every 3-6 months to review flap survival.Results All flaps of 29 cases survived.Venous congestion occurred in 2 flaps within 48 h after the operation,among which,1 was overcomed after released the dressing and sutures,and the other underwent surgical exploration.The venous end-to-side anastomotic stomas were unobstructed,and hematoma was formed.After the hematoma compression was removed,circulation was recovered and the flap survived.With followed-up for 6 months to 2.5 years,both donor site and recipient site of the flaps healed well and the injured distal limbs had no hemodynamic disorder.Conclusion The application of multiple end-to-side anastomosis to the same recipient vessel for free transplantation of anterolateral thigh perforator flaps is safe and reliable.