Objective: To evaluate the comprehensive intervention effect of lunch for primary and secondary school students in Minhang District, so as to provide a theoretical and practical basis for lunch intervention in school. Methods: From October to December 2023, a convenience sampling method was used to select 1 937 students from one primary and secondary school in Minhang District.A comprehensive intervention measure focusing on "reducing oil and salt" for lunch recipe optimization and nutrition education was carried out, and a questionnaire survey was conducted to evaluate the intervention effect three months later. Chi square test and Wilcoxon rank test were used to compare the data before and after the intervention. Results: After intervention, the use of cooking oil and salt, the supply of protein and fat in primary and secondary school lunches were reduced, and had no obvious impact on energy and other major nutrients. After intervention, compared to before intervention, the proportion of primary school students who felt that lunch was greasy decreased (8.9%, 6.2%, χ 2=4.35), and the proportion of primary and secondary school students who felt that lunch were delicious decreased significantly (33.2%, 23.2%; 63.9%, 53.5%, χ 2=26.39, 17.52) ( P < 0.05 ). Secondary school students also felt reduced variety of food ingredients (46.9%, 38.3%, χ 2=16.05, P <0.05). In addition, after intervention, the total surplus rate of primary school students meals decreased (7.4%, 4.4%, χ 2=5.73), mainly reflected in the decrease of the surplus rate of staple foods (7.1%, 2.4%, χ 2=17.39), while the surplus rate of vegetable dishes increased ( 16.0 %, 21.2%, χ 2=6.01) ( P <0.05). Although there was no significant change in the total surplus rate of meals for secondary school students, the surplus rate of staple foods decreased (12.9%, 5.4%, χ 2=33.52), while the surplus rates of meat and vegetable dishes increased (11.2%, 26.9%; 17.5%, 33.2%, χ 2=74.26, 61.88) ( P <0.05). After intervention, there was no statistically significant difference in the overweight and obesity rates of primary school students ( χ 2=0.11,0.43) and secondary school students ( χ 2=0.01,0.00) compared to before intervention( P >0.05). After intervention, the lung capacity of primary school students [1 564 (1 269,1 890) mL] and sitting forward flexion [11.3 (7.6, 15.2) cm] increased compared to before intervention [1 522 (1 259, 1 819 ) mL, 10.5 (6.3, 13.5) cm] ( Z =2.20, 4.68, P <0.01), but there was no statistically significant difference in lung capacity and sitting forward flexion of secondary school students before and after intervention ( Z =-0.46, -0.08, P >0.05). Conclusion The comprehensive intervention of school lunch has promoted a significant decrease in the use of oil and salt in lunch and improved the quality of recipes, and has a positive impact on the situation of leftover lunch and the health of students to a certain extent.

Objective: This study investigates the potential of radiomics to predict postoperative progression of ossification of the posterior longitudinal ligament (OPLL) after posterior cervical spine surgery. Methods: This retrospective study included 473 patients diagnosed with OPLL at Peking University Third Hospital between October 2006 and September 2022. Patients underwent posterior spinal surgery and had at least 2 computed tomography (CT) examinations spaced at least 1 year apart. OPLL progression was defined as an annual growth rate exceeding 7.5%. Radiomic features were extracted from preoperative CT images of the OPLL lesions, followed by feature selection using correlation coefficient analysis and least absolute shrinkage and selection operator, and dimensionality reduction using principal component analysis. Univariable analysis identified significant clinical variables for constructing the clinical model. Logistic regression models, including the Rad-score model, clinical model, and combined model, were developed to predict OPLL progression. Results: Of the 473 patients, 191 (40.4%) experienced OPLL progression. On the testing set, the combined model, which incorporated the Rad-score and clinical variables (area under the receiver operating characteristic curve [AUC] = 0.751), outperformed both the radiomics-only model (AUC = 0.693) and the clinical model (AUC = 0.620). Calibration curves demonstrated good agreement between predicted probabilities and observed outcomes, and decision curve analysis confirmed the clinical utility of the combined model. SHAP (SHapley Additive exPlanations) analysis indicated that the Rad-score and age were key contributors to the model’s predictions, enhancing clinical interpretability. Conclusion Radiomics, combined with clinical variables, provides a valuable predictive tool for assessing the risk of postoperative progression in cervical OPLL, supporting more personalized treatment strategies. Prospective, multicenter validation is needed to confirm the utility of the model in broader clinical settings.

Objective: This study investigates the potential of radiomics to predict postoperative progression of ossification of the posterior longitudinal ligament (OPLL) after posterior cervical spine surgery. Methods: This retrospective study included 473 patients diagnosed with OPLL at Peking University Third Hospital between October 2006 and September 2022. Patients underwent posterior spinal surgery and had at least 2 computed tomography (CT) examinations spaced at least 1 year apart. OPLL progression was defined as an annual growth rate exceeding 7.5%. Radiomic features were extracted from preoperative CT images of the OPLL lesions, followed by feature selection using correlation coefficient analysis and least absolute shrinkage and selection operator, and dimensionality reduction using principal component analysis. Univariable analysis identified significant clinical variables for constructing the clinical model. Logistic regression models, including the Rad-score model, clinical model, and combined model, were developed to predict OPLL progression. Results: Of the 473 patients, 191 (40.4%) experienced OPLL progression. On the testing set, the combined model, which incorporated the Rad-score and clinical variables (area under the receiver operating characteristic curve [AUC] = 0.751), outperformed both the radiomics-only model (AUC = 0.693) and the clinical model (AUC = 0.620). Calibration curves demonstrated good agreement between predicted probabilities and observed outcomes, and decision curve analysis confirmed the clinical utility of the combined model. SHAP (SHapley Additive exPlanations) analysis indicated that the Rad-score and age were key contributors to the model’s predictions, enhancing clinical interpretability. Conclusion Radiomics, combined with clinical variables, provides a valuable predictive tool for assessing the risk of postoperative progression in cervical OPLL, supporting more personalized treatment strategies. Prospective, multicenter validation is needed to confirm the utility of the model in broader clinical settings.

Objective To investigate the expression of Cyclin F in clear cell renal cell carcinoma (ccRCC), its clinicopathological characteristics, and its effect on the biological behavior of renal cancer cell lines Methods RT-qPCR and Western blot were used to detect the mRNA and protein expression of Cyclin F in fresh ccRCC specimens. Immunohistochemistry assay was performed to detect the expression of Cyclin F protein in 80 paraffin samples. CCK-8 assay, scratch assay, and flow cytometry were conducted to determine the effects of Cyclin F overexpression on the proliferation, migration, and apoptosis of renal cancer cell lines. Results The expression of Cyclin F in cancer tissues was higher than that in adjacent tissues at the mRNA level (P<0.0285). The expression of Cyclin Fprotein in cancer tissues was lower than that in adjacent tissues (P<0.001). The analysis of clinicopathological parameters showed that the low expression of Cyclin F was correlated with WHO/ISUP grade, Ki67 index, and age (P=0.041, 0.047, 0.008,). In vitro experiments confirmed that overexpression of Cyclin F promoted the proliferation (P<0.001) and migratory ability (24 h P=0.003, 48 h P=0.0058) of the RCC 786-O cell line, while inhibiting apoptosis (P=0.0019). Conclusion The low expression of Cyclin F protein in ccRCC tissuesis associated with high ISUP grade, high Ki67 index, oldage, and prognosis of patients.

Guided by the theories of yin-yang and collateral disease， this paper identifies the dysregulation of yang qi ascent and descent as the core pathomechanism of hypertension. Based on clinical experience， a treatment approach centered on the method of raising yang and promoting descent was proposed. Clinically， three major syndrome types were identified. Firstly， deficiency of zong qi （ancestral qi） with blood stasis， obstruction of phlegm-turbidity and blood stasis， and hyperactivity of liver yang. Corresponding empirical formulation， Yizong Huoxue Decoction （益宗活血汤） was applied to tonify zong qi， invigorate blood， and raise yang. Secondly， Lizong Huoxue Decoction （理宗活血汤） was used to resolve phlegm， promote yang qi circulation， and regulate qi and blood. Thirdly， Qinggan Tongluo Decoction （清肝通络饮） was used to clear the liver， dredge collaterals， and subdue hyperactive yang. For special types such as non-dipper hypertension， time-specific syndrome differentiation and treatment can be applied based on a thorough understanding of the underlying pathomechanism， aiming to provide new insights into clinical diagnosis and treatment of hypertension.

Objective To explore the construction of α-1,3-galactosyltransferase (GGTA1) gene-knockout (GTKO) Diannan miniature pigs and the kidney xenotransplantation from pigs to rhesus macaques, and to assess the effectiveness of GTKO pigs. Methods The GTKO Diannan miniature pigs were constructed using the CRISPR/Cas9 gene-editing system and somatic cell cloning technology. The phenotype of GTKO pigs was verified through polymerase chain reaction, Sanger sequencing and immunofluorescence staining. Flow cytometry was used to detect antigen-antibody (IgM) binding and complement-dependent cytotoxicity. Kidney xenotransplantation was performed from GTKO pigs to rhesus macaques. The humoral immunity, cellular immunity, coagulation and physiological indicators of the recipient monkeys were monitored. The function and pathological changes of the transplanted kidneys were analyzed using ultrasonography, hematoxylin-eosin staining, immunohistochemical staining and immunofluorescence staining. Results Single-guide RNA (sgRNA) targeting exon 4 of the GGTA1 gene in Diannan miniature pigs was designed. The pGL3-GGTA1-sgRNA1-GFP vector was transfected into fetal fibroblasts of Diannan miniature pigs. After puromycin selection, two cell clones, C59# and C89#, were identified as GGTA1 gene-knockout clones. These clones were expanded to form cell lines, which were used as donor cells for somatic cell nuclear transfer. The reconstructed embryos were transferred into the oviducts of trihybrid surrogate sows, resulting in 13 fetal pigs. Among them, fetuses F04 and F11 exhibited biallelic mutations in the GGTA1 gene, and F04 had a normal karyotype. Using this GTKO fetal pig for recloning and transferring the reconstructed embryos into the oviducts of trihybrid surrogate sows, seven surviving piglets were obtained, all of which did not express α-Gal epitope. The binding of IgM from the serum of rhesus monkey 20# to GTKO pig PBMC was reduced, and the survival rate of GTKO pig PBMC in the complement-dependent cytotoxicity assay was higher than that of wild-type pig. GTKO pig kidneys were harvested and perfused until completely white. After the left kidney of the recipient monkey was removed, the pig kidney was heterotopically transplanted. Following vascular anastomosis and blood flow restoration, the pig kidney rapidly turned pink without hyperacute rejection (HAR). Urine appeared in the ureter 6 minutes later, indicating successful kidney transplantation. The right kidney of the recipient was then removed. Seven days after transplantation, the transplanted kidney had good blood flow, the recipient monkey's serum creatinine level was stable, and serum potassium and cystatin C levels were effectively controlled, although they increased 10 days after transplantation. Seven days after transplantation, the levels of white blood cells, lymphocytes, monocytes and eosinophils in the recipient monkey increased, while platelet count and fibrinogen levels decreased. The activated partial thromboplastin time, thrombin time and prothrombin time remained relatively stable but later showed an upward trend. The recipient monkey survived for 10 days. At autopsy, the transplanted kidney was found to be congested, swollen and necrotic, with a small amount of IgG deposition in the renal tissue, and a large amount of IgM, complement C3c and C4d deposition, as well as CD68⁺ macrophage infiltration. Conclusions The kidneys of GTKO Diannan miniature pigs may maintain normal renal function for a certain period in rhesus macaques and effectively overcome HAR, confirming the effectiveness of GTKO pigs for xenotransplantation.

Objective To analyze the prevalence status of cardiometabolic risk factor (CMRF) and its aggregation among workers engaged in new forms of employment. Methods A total of 5 429 new employment workers (including couriers, online food delivery workers, and ride hailing drivers) who underwent health medical examinations at a tertiary hospital in Beijing City were selected as the research subjects using the judgment sampling method. Data on waist circumference, blood pressure, blood glucose, and blood lipid levels were collected to analyze their CMRF [central obesity, elevated blood pressure, elevated blood glucose, elevated triglycerides, and reduced high-density lipoprotein cholesterol (HDL-C)] and their aggregation (with ≥ 2 of the above 5 risk factors) status. Results The detection rates of central obesity, elevated blood pressure, elevated blood glucose, elevated triglycerides, and reduced HDL-C were 61.2%, 38.2%, 29.5%, 40.9% and 22.6%, respectively. The detection rates of CMRF aggregation was 57.8%. The result of multivariable logistic regression analysis showed that male, age ≥45 years, smoking, overweight, and obesity were risk factors for CMRF aggregation (all P<0.05). Conclusion The detection rate of CMRF and its aggregation among workers with new forms of employment in Beijing City is relatively high. Targeted prevention and control efforts should be strengthened for high-risk populations, especially males, workers aged ≥45 years, smokers, and those who are overweight or obese.

To summarise the clinical experience of Professor TONG Xiaolin in treating prediabetes combined with overweight or obesity using the method of relieving depression and reducing turbidity. It is believed that prediabetes belongs to the category of "spleen-heat syndrome" in traditional Chinese medicine， and its core pathogenesis is center fullness with internal heat， while obesity is the initiating factor for exacerbating center fullness and internal heat， therefore， it is of great significance to reduce the risk of diabetes by interrupting the transformation between overweight， obesity and glucose metabolism abnormality. It is proposed that the main pathogenesis of prediabetes combined with overweight or obesity is qi depression and turbidity obstruction in middle jiao， with qi depression as the root and turbidity obstruction as the cause， forming a treatment idea with the method of relieving depression and reducing turbidity as the core. In clinic， Dahuang Huanglian Xiexin Decoction （大黄黄连泻心汤） is used as the basic prescription， with a primary focus on directing the turbid downward， supplemented by regulating qi， which embodies the concept of "promoting movement through descent， then figuring out the root of spleen-heat syndrome. Furthermore， the treatment is flexibly modified based on the patient's deficiency-excess syndrome to ensure individualized therapy.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Objective: To explore the relationship between sleep quality and executive function among middle school students, so as to provide theoretical support for the promotion of adolescents physical and mental health development. Methods: From September to December 2023, 5 713 junior and senior high school students aged 13 to 18 were selected by stratified cluster random sampling method from Shanghai, Suzhou, Taiyuan, Wuyuan, Xingyi, and Urumqi. Pittsburgh Sleep Quality Index was used to conduct sleep quality survey. And conduct executive function was tested on middle school students, including inhibitory function, refresh function and conversion function tests. Spearman correlation and linear regression were used to analyze the relationship between sleep quality and executive function of middle school students. Results: The total Pittsburgh Sleep Quality Index (PSQI) score of boys was [4.0(2.0,6.0)] and that of girls was [5.0(3.0,6.0)], and the difference was statistically significant ( Z=-10.90, P < 0.01 ). The total PSQI score of boys was positively correlated with both 2-back reaction time and conversion function of executive function ( r =0.04, 0.04); the total PSQI score of girls was negatively correlated with 2-back reaction time ( r =-0.04) ( P <0.05). After controlling for variables such as mental health, physical activity and nutritional status,linear regression analyses showed that PSQI total score of middle school students was positively correlated with the inhibitory function and the conversion function response time [ B (95% CI )=1.28(0.21-2.34), 7.62(2.34-12.90), P <0.05]; the associations of total PSQI scores among middle school students with both 2-back and 1-back response time were not statistically significant [ B (95% CI )=-5.88(-16.14-4.37), 8.05( -3.39 -19.50), P >0.05]. Conclusion Positive correlations are observed on sleep quality with inhibitory and conversion functions of executive function among middle school students.