Objective: To explore the current status and progress of regional school health work to provide policy reference for school health improvement. Methods: Survey data on school health work in Tianjin from 2019, 2021 and 2023 was used. School health staff allocation and expenditure of the health administrative department, CDC and education department, as well as the annual implementation of health education, prevention and control of common diseases and infectious diseases, sports activities and food nutrition in primary and secondary schools were analyzed. Statistical analysis was conducted using KruskalWallis test, Chisquare test, and Fishers exact test. Results: The number of school health staff in the health commissions and education departments from 2019, 2021 and 2023 was relatively stable. Parttime staffs were often employed by health commissions while fulltime staffs were mainly employed by education departments. The number of school health staff at CDCs increased gradually (H=12.65, P<0.01). School health expenditure of administrative departments and schools in 2021 and 2023 increased significantly compared with that in 2019 (H=22.28, 23.75, P<0.05). More than 95% of schools set up clinics or health care rooms, and about 97% of schools had school health technicians or health teachers. More than 90% of schools had health education courses over 4 hours per semester. The rate of mental health education increased by year (86.87%, 89.91%, 96.30%, Z=2.40，P<0.05). Lack of courses regarded safety emergency and risk avoidance, growth and development, and adolescent health education. The provision rate of psychological counseling services (89.00%, 97.25%, 100.00%) and psychological problem prevention and control (56.12%, 71.56%, 81.48%) also increased by year (Z=3.83, 3.96, P<0.01). The implementation rates of prevention and control of poor vision, dental caries, overweight and obesity were all higher than 80%, and the prevention and control rate of abnormal spinal curvature showed an increasing trend (38.78%, 77.06%, 72.22%, Z=4.87, P<0.01). More than 90% of schools met the standard for physical education class hours, and the proportion of schools conducting at least 30 minutes of recess physical activities every day increased year by year (65.00%, 80.73%, 85.98%, Z=3.59, P<0.01). All schools did not have shops. Conclusions School health work in Tianjin is effective and constantly developing. It is necessary to continue to increase the investment of human resources and expenditure in school health, explore the approaches of cooccurrence and prevention of common diseases, and improve the school sports and nutrition environment.

Objective:To investigate the risk factors and cumulative risk of myopia in children and adolescents, providing a basis for identifying cumulative risk factors in preventing and controlling myopia.Methods:Baseline data from the mental and physical health cohort of children and adolescents established in Inner Mongolia Autonomous Region were used. A stratified random cluster sampling method was adopted to select 138 974 students from fourth to twelfth grade as participants. Distance visual exams, refractive assessments, and questionnaires were conducted on the included students. Logistic regression analysis was used to evaluate each risk factor's impact on myopia's prevalence. The number of risk factors was summed to form a cumulative risk score, and logistic regression analysis was conducted to examine the association between the cumulative risk score and the prevalence of myopia. Additionally, the association between the cumulative risk score of myopic students and their degree of refractivity was analyzed using a generalized estimating equation.Results:The study found a high prevalence of myopia among children and adolescents at baseline (70.2%). Girls exhibited a higher prevalence (74.8%) than boys (65.6%), urban areas (74.3%) surpassed suburban ones (68.6%), and the incidence was greater in high schools (80.3%) compared to middle schools (75.3%), which, in turn, was higher than in elementary schools (57.7%) (all P<0.05). Analysis of risk factors revealed that children and adolescents experiencing improper reading and writing distances ( OR=1.10, 95% CI: 1.07-1.13), excessive homework ( OR=1.09, 95% CI: 1.06-1.12), insufficient sleep ( OR=1.10, 95% CI: 1.07-1.13), having myopic father ( OR=1.98, 95% CI: 1.91-2.05), having myopic mother ( OR=2.04, 95% CI: 1.97-2.10), or using classroom chairs not matched to their height faced ( OR=1.04, 95% CI: 1.01-1.07) increased myopia risks. Additionally, the prevalence and significant odds ratio of myopia increased with the increase in cumulative risk score, with every additional unit of cumulative risk score increasing the right eye's refractive error by -0.10 D. Conclusion:The presence of multiple factors and their comprehensive score increases the prevalence of myopia in children and adolescents.

Abstract Spinal curvatures has emerged as the third major chronic condition seriously threatening the physical and mental health of Chinese children and adolescents, with significant regional differences. Its etiology is complex and diverse, and early prevention and treatment are feasible, whereas treatment in later stages entails considerable difficulty and economic burden. Currently, the prevention and control of student spinal curvatures has been elevated to a national health strategy. A series of policy documents have been successively issued, and it has greatly facilitated the institutionalization and normalization of national routine screening for student spinal curvatures. However, it is still inadequate considering current prevention and control system for spinal curvatures in children and adolescents. There is an urgent need to establish a closed loop model based on China s institutional advantages, comprising Initial Screening-Diagnosis-Treatment-Preventive Control-Followup Assessment, to strengthen the safeguarding of spinal health in children and adolescents.

Objective To study the effects of ultrasound-guided quadratus lumborum block(QLB)on intraoperative hemodynamics and opioid dosage in emergency patients with ectopic pregnancy.Methods A total of 70 patients with ectopic pregnancy undergoing laparoscopic surgery in Langfang People's Hospital from January 2021 to February 2024 were selected as subjects.According to the different anesthesia methods,the patients were divided into the control group and the study group,with 35 cases in each group.The control group was given general anesthesia,while the study group additionally added ultrasound-guided QLB.The intraoperative sedation effect,hemodynamics,postoperative pain,incidence of adverse reactions and opioid use at different times(admission,entry,intubation,skin incision,extubation,and discharge)were observed in the two groups.Results There were no statistically significant differences in the onset time of sedation,the rate of salvage sedation,the incidence of intraoperative body movements,the modified observer's assessment of alert/sedation(MOAA/S)at each time,and the hemodynamics at the time of admission,entry and intubation between the two groups.The mean arterial pressure(MAP),systolic blood pressure(SBP)and heart rate(HR)in the study group were significantly lower than those in the control group during skin incision,extubation and discharge[skin incision:MAP(mmHg,1 mmHg≈0.133 kPa)was 85.24±4.59 vs.96.95±4.68,SBP(mmHg)was 92.24±4.85 vs.99.49±5.13,HR(times/min)was 85.33±2.96 vs.94.51±2.92;extubation:MAP(mmHg)was 94.84±5.02 vs.102.05±5.13,SBP(mmHg)was 96.48±4.72 vs.105.03±5.07,HR(times/min)was 95.51±4.95 vs.102.49±5.87;discharge:MAP(mmHg)was 86.14±4.99 vs.93.71±5.25,SBP(mmHg)was 96.48±4.69 vs.104.37±5.02,HR(times/min)was 84.05±4.57 vs.90.51±4.86,all P<0.05]and pulse oxygen saturation(SpO2)was higher than those in the control group(skin incision:0.988 5±0.012 2 vs.0.965 4±0.012 3,extubation:0.974 7±0.012 4 vs.0.963 2±0.012 1,discharge:0.981 1±0.012 4 vs.0.970 3±0.012 3,all P<0.05).The resting numeric rating scale(NRS)scores and active NRS scores in the study group were lower than those in the control group at 3,6,12,and 24 hours after surgery,the random time was prolonged,the resting NRS and active NRS in the two groups gradually increased,reaching a peak at 24 hours after surgery,and the resting NRS and active NRS in the study group were significantly lower than those in the control group(resting NRS:3.86±0.82 vs.4.53±1.04,active NRS:4.26±1.05 vs.4.85±1.13,all P<0.05).The incidence of adverse reactions in the study group was lower than that in the control group[11.43%(4/35)vs.34.29%(12/35),P<0.05].The dosage of Sufentanil in 24 hours and 48 hours,the number of analgesic pump in 48 hours and the number of relief analgesia cases in the study group were lower than those in the control group[the dosage of Sufentanil in 24 hours(μg):23.28±4.02 vs.36.14±4.57,the dosage of Sufentanil in 48 hours(μg):41.61±4.82 vs.59.33±6.25,the number of analgesic pump in 48 hours(times):2.94±1.22 vs.6.15±1.71,the proportion of relief analgesia:8.57%(3/35)vs.28.57%(10/35),all P<0.05].Conclusion Ultrasound-guided QLB can reduce hemodynamic fluctuations,relieve postoperative pain,reduce adverse reactions and opioid use in emergency patients with ectopic pregnancy,demonstrating a positive impact.

Objective To observe the effect of quadratus lumborum block(QLB)anesthesia on intraoperative blood gas indexes and postoperative recovery in female uremic patients with peritoneal dialysis catheterization.Methods A total of 70 female uremic patients with peritoneal dialysis catheterization admitted to Langfang People's Hospital from January 2021 to December 2023 were selected as the research objects.According to the random number table method,they were divided into the control group and the study group,with 35 cases in each group.The control group was given conventional local infiltration anesthesia,whereas the study group was given QLB anesthesia.The changes of mean arterial pressure(MAP),heart rate(HR),blood gas indexes[pulse oxygen saturation(SpO2),arterial partial pressure of carbon dioxide(PaCO2)]and numeric rating scale(NRS)score,at different points pain factors[5-hydroxytryptamine(5-HT),substance P(SP),norepinephrine(NE)]before operation and 24 hours after operation,postoperative recovery(time to get out of bed for the first time,exhaust time,length of hospital stay)and adverse reactions were observed in the two groups.Results There was no significant difference in MAP,HR,blood gas index and NRS score between the two groups at the admission.The MAP,HR,PaCO2 in the study group were significantly lower than those in the control group during skin incision,rectus abdominis separation,catheterization,suture,and leaving the room,and SpO2 was significantly higher than that in the control group,and NRS score in the study group were significantly lower than those in the control group during skin incision,rectus abdominis separation,catheterization,suture(all P<0.05).There was no significant difference in the levels of 5-HT,SP and NE between the two groups before operation,but the levels of 5-HT,SP and NE at 24 hours after operation were significantly higher than those before operation,but the levels of 5-HT,SP and NE in the study group were lower than those in the control group.The first ambulation time,exhaust time and hospitalization time in the study group were significantly shorter than those in the control group(all P<0.05).The incidence of nausea and vomiting,constipation,pruritus,dizziness and other adverse reactions in the study group was significantly lower than that in the control group(all P<0.05).Conclusion QLB can reduce the fluctuation of intraoperative blood gas indexes in female uremic patients with peritoneal dialysis catheter,relieve postoperative pain,reduce the level of pain factors and reduce the occurrence of adverse reactions,and has a good effect on promoting postoperative recovery of patients.

Objective:To investigate the application value of antegrade splenic superior region dissection first in laparoscopic total gastrectomy of obesity gastric cancer.Methods:The retrospective and descriptive study was conducted. The clinicopathological data of 21 obesity patients with gastric cancer who underwent laparoscopic total gastrectomy in Renji Hospital of Shanghai Jiaotong University School of Medicine from July 2018 to October 2023 were collected. There were 16 males and 5 females, aged (58±13)years. All 21 patients underwent laparoscopic total gastrec-tomy with antegrade splenic superior region dissection first. Observation indicators: operation time, volume of intraoperative blood loss, laparotomy conversion, intraoperative splenic hemorrhage or gastric hemorrhage, lymph node dissection, time to postoperative first flatus, time to postoperative initial liquid food intake, duration of postoperative hospital stay, postoperative complication. Measure-ment data with normal distribution were represented as Mean± SD, and count data were expressed as absolute numbers. Results:All 21 patients underwent laparoscopic total gastrectomy success-fully, with the operation time of (283±47)minutes, time for splenogastric ligament and vascular manage-ment of (34±12)minutes, volume of intraoperative blood loss of (143±86)mL, and no laparotomy conversion. There was no intraoperative splenic hemorrhage or gastric haemorrhage. The total number of lymph node dissected in 21 patients was 375, with the number of lymph node dissected as (21±9)per case. Time to postoperative first flatus, time to postoperative initial liquid food intake and duration of postoperative hospital stay in 21 patients were (3.1±0.7)days, (4.0±0.8)days and (10.1±3.0)days, respectively. There were 2 patients with postoperative complications, including 1 case of incision infection and 1 case of lung infection. The 2 patients with postoperative com-plications were recovered and discharged after conservative treatment. There was no death during the postoperative 30 days.Conclusion:The application of antegrade splenic superior region dissec-tion first in laparoscopic total gastrectomy is safe and feasible, which can reduce surgical difficulty.

Objective: To explore the epidemiological trend of overweight and obesity, elevated blood pressure and their comorbidities in children and adolescents from Inner Mongolia Autonomous Region during 2016-2021, and to analyze its association with lifestyle, so as to provide reference for formulating prevention and control strategies of regional common comorbidities in schools. Methods: A total of 8 908, 8 222, 9 448, 127 068, 100 778, and 138 540 students aged 10-18 years in Inner Mongolia were selected by stratified random cluster sampling in September each year from 2016 to 2021. Physical examination and questionnaire survey were conducted on the included students. The prevalence trends of overweight，obesity, elevated blood pressure and their co-occurrence were analyzed. Logistic regression was used to compare the prevalence of elevated blood pressure in different body mass index (BMI) groups. After excluding individuals without lifestyle information in 2021, Logistic regression analysis was used on 136 374 subjects to analyze the association between overweight，obesity, elevated blood pressure and their co-occurrence and lifestyle factors. Results: During 2016 to 2021, the prevalence of comorbidity of overweight, obesity with elevated blood pressure among students in Inner Mongolia Autonomous Region were 5.04%，5.14%，4.99%，7.51%，7.60% and 9.45%， respectively . The prevalence of overweight and obesity was 26.94%, 28.07%, 29.62%, 34.19%, 36.71% and 37.53%, respectively. The prevalence of elevated blood pressure were 16.05%, 11.54%, 13.12%, 14.85%, 14.12% and 18.40%, respectively. Except for 2016, the risk of elevated blood pressure in overweight and obese people was higher than that in normal BMI group in other years, and there was a positive correlation between overweight and obesity and elevated blood pressure after gender and urban and rural areas ( P < 0.05 ). In 2021, the detection rate of comorbidity of overweight and obesity with elevated blood pressure among children and adolescents in urban areas was higher than that in suburban counties, and the reporting rate of healthy lifestyle was lower than that in suburban counties ( P <0.05).Skipping breakfast ( OR =1.11，95% CI =1.07-1.16) and non daily moderate and high intensity physical activity( OR =1.27，95% CI =1.20-1.34) were positively correlated with the co-occurrence of overweight，obesity and elevated blood pressure among children and adolescents in Inner Mongolia Autonomous Region. Non daily moderate and high intensity physical activity ≥60 min was positively correlated with elevated blood pressure ( OR =1.11，95% CI =1.07-1.16), and insufficient sleep was positively correlated with overweight，obesity ( OR =1.04, 95% CI =1.01-1.06)（ P ＜0.05）. Conclusion The prevalence of overweight，obesity, elevated blood pressure and their co-occurrence among children and adolescents in Inner Mongolia Autonomous Region is relatively high. Overweight/obesity is an important risk factor for elevated blood pressure, and unhealthy lifestyles are risk factors for co-occurrence of overweight，obesity and elevated blood pressure. Region specific lifestyle interventions are indispensable for the prevention and control of regional common comorbidities. Urban areas may be a key focus for lifestyle interventions.

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Objective:To evaluate the effect of different doses of compound sodium chloride injection combined with norepinephrine on prevention of hypotension after lumbar anesthesia in the patients undergoing caesarean section.Methods:A total of 150 patients with a singleton fetus, aged 18-45 yr, at ≥37 weeks of gestation, of American Society of Anesthesiologists Physical Status classification Ⅰ or Ⅱ, with height ≥150 cm, weighing ≤100 kg, with body mass index < 40 kg/m 2, scheduled for elective caesarean section under lumbar anesthesia, were divided into 3 groups ( n=50 each) by the random number table method: compound sodium chloride injection 4, 8 and 12 ml·kg -1·h -1 groups (group A, group B, group C). Compound sodium chloride injection 4 ml/kg was intravenously injected for liquid preload before lumbar anesthesia, and 0.5% hyperbaric bupivacaine 12.5 mg was injected to the subarachnoid space for lumbar anesthesia. Norepinephrine was intravenously injected at a dose of 6 μg immediately after intrathecal injection, followed by an infusion of 0.05 μg·kg -1·min -1, and infusion was stopped at 5 min after delivery. Compound sodium chloride injection was intravenously infused simultaneously at a rate of 4, 8 and 12 ml·kg -1·h -1 in A, B and C groups, respectively. The maximum diameter of inferior vena cava (IVCmax) and the minimum diameter of inferior vena cava (IVCmin) were measured by ultrasound, and inferior vena cava collapse index (IVC-CI) was calculated at 1 min before fluid preload (T 1), immediately after fluid preload (T 2), at 5 min after anesthesia (T 3), at 5 min after fetal delivery (T 4) and immediately before leaving the operating room (T 5). The incidence of intraoperative adverse events (hypotension, severe hypotension, bradycardia, hypertension, nausea, and vomiting) and neonatal outcomes (umbilical artery blood gas index and Apgar score at 1 and 5 min after birth) were recorded. Results:Compared with group A, IVCmin was significantly increased and IVC-CI was decreased at T 5 in group B, and IVCmin and IVCmax were significantly increased and IVC-CI was decreased at T 5 in group C ( P<0.05). There was no significant difference in IVCmax, IVCmin and IVC-CI at each time point between group B and group C ( P>0.05). There was no significant difference in the incidence of hypotension, severe hypotension, bradycardia, hypertension, nausea and vomiting among the three groups ( P>0.05). There was no significant difference in the results of blood gas analysis of the umbilical artery and Apgar score at each time point after birth among the three groups ( P>0.05). Conclusions:Compound sodium chloride injection 4, 8 and 12 ml·kg -1·h -1 combined with norepinephrine can effectively prevent the occurrence of hypotension after lumbar anesthesia in the patients undergoing caesarean section without increasing maternal and infant adverse events, and the effect of 8 and 12 ml·kg -1·h -1 for volume supplementation is better than that of 4 ml·kg -1·h -1.

Type 2 diabetes mellitus （T2DM） is a heterogeneous disease with insulin deficiency and insulin resistance （IR） as the main etiology and is often accompanied by complications. Volatile oil is a volatile oily liquid extracted from natural plants， which has many pharmacological effects such as regulating Qi， relieving pain， inhibiting bacteria， and reducing inflammation. In recent years， there have been numerous reports on the treatment of T2DM by natural plant volatile oil and its effective components， which has become one of the new directions in the treatment of T2DM. With natural plant essential oil and its active components as the starting point， this paper comprehensively analyzed and summarized the material basis， mechanism， and signaling pathways of essential oil in the treatment of T2DM and its complications in China and abroad in recent years， and focused on the inhibitory effect of essential oil and its active components， such as carvacrol， paeonol， and β-caryophylene， on IR to improve T2DM by protecting pancreatic β-cells， inhibiting α-glucosidase activity， regulating the abundance and diversity of intestinal microbiota， and regulating glucose transporter protein type4 （GLUT4）， adenylate 5′-monophosphate-activated protein kinase （AMPK）， phosphatidylinositol-3 kinase （PI3K）/protein kinase B （Akt） signaling pathways to provide some references for the volatile oil intervention in T2DM and the development of new green antidiabetic drugs.