OBJECTIVE Ulcerative colitis （UC）， as a common and refractory disease of the digestive system， has always been a hot and difficult point in medical research. Traditional Chinese medicine has the advantages of good efficacy， high safety and not easy to relapse after drug withdrawal in the treatment of UC， but the mechanism has not been fully elucidated. Metabonomics looks for potential biomarkers and metabolic pathways from the point of view of the endogenous dynamic metabolism of the whole body， which is helpful to evaluate the efficacy of drugs and explore related mechanisms. Metabolomics studies on the treatment of UC with traditional Chinese medicine have shown that traditional Chinese medicine formulas， single herbs and herbs monomers act on various related pathways such as amino acid metabolism， lipid metabolism and energy metabolism by regulating endogenous metabolites in the body， thereby inhibiting immune inflammatory reactions， improving oxidative stress， reducing intestinal sensitivity， regulating intestinal microbiota， repairing intestinal mucosal damage， and restoring normal metabolic activity in the body. However， further screening and validation of relevant metabolic markers are needed.

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Objective:A retrospective analysis was performed on clinical characteristics and deoxyguanosine kinase DGUOK gene mutations in a family with hepatocerebral mitochondrial DNA depletion syndrome (MTDPS). Methods:The clinical data, treatment process and gene detection results of a child with MTDPS in the second hospital of Hebei Medical University in April 2019 were analyzed and summarized.Results:Proband was a girl.From the first week of infantile, she suffered from recurrent hypoglycemia, hyperlactic acid, progressive cholestatic liver dysfunction, coagulopathy, difficult feeding, slow growth of body mass, microcephaly, hypotonia, and gradul intermittent binocular tremors, and eventually failed to thrive.Gene testing identified two compound heterozygous mutations c. 42-c.43insTTCA(p.F15fs129X)/c.808-1(IVS6)G>A in DGUOK gene.The former was a frame-shift mutation resulted in truncated protein and the later was a splicing mutation resulted in abnormal splicing.Each parent was a heterozygous carrier, and there were no mutations in the two sites with her elder sister. Conclusions:Both mutations were first reported worldwide. DGUOK gene mutations with MTDPS are important causes of infant liver failure.When hypoglycemia, hyperlactic acidemia and liver dysfunction occur in newborn and infant, MTDPS related gene DGUOK gene sequencing screening should be considered for early definitive diagnosis, or, when acute liver failure happen in infant and childhood, neuromuscular involvement is insufficient.

Objective:To investigate clinical characteristics and ABCB11 gene mutations in probands suffering from progressive familial intrahepatic cholestasis type 2(PFIC2). Methods:The clinical data involving manifestations and laboratory examinations of 2 probands with PFIC2 admitted to Pediatric Digestive and liver Clinic in Second Hospital of Hebei Medical University during January 2017 to December 2018 were retrospectively analyzed.Target capture high-throughput sequencing, genome-wide gene copy number variation(CNV) detection and validation were performed on probands and their parental DNA.Results:The age of onset for the 2 probands ranged from 2 to 5 months, and they had hepatosplenomegaly, severe cholestasis, pruritus, and binding bilirubin/ total bilirubin (proband 1: 51.8%-77.5%, proband 2: 47.1%-66.5%). Bile acid and aminotransferase[mainly aspartate transaminase (AST)] increased, but γ-glutamyltransferase(GGT) remained normal.Compound heterozygous mutations of ABCBll gene were discovered in proband 1: single strand deletion/c.3213+ 5G>A splicing mutation, and deletion mutation were spontaneous mutation.A total of 2.256 Mb(chr2 2q24.3q31.1)was missing, whereas splicing mutation was originated from her father.Polymorphisms with Val444Ala(T1331C)and Ala1028Ala(A3084G)were proved in proband 1.Compound heterozygous mutations of ABCB11 gene were revealed in proband 2: c.1483A>G(p.R495G)/c.2594C>T(p.A865V), and both parents were heterozygous carriers.Single-strand 2.256 Mb deletion in proband 1 and 2 mutations in proband 2 were unreported new mutations worldwide. Conclusions:In clinical work, children with cholestasis, elevated bile acid and transaminase(mainly AST), but normal GGT, should be detected for PFIC genes as soon as possible.

Objective To explore the effects of PDCA-based self-management intervention model on health behavior and medication adherence in aged patients with percutaneous coronary intervention (PCI). Methods Totally 130 aged patients treated by PCI were randomly divided into the intervention group and the control group with 65 patients. The patients in the control group received routine health education, and the patients in the intervention group received PDCA-based self-management intervention model. All patients were investigated with Coronary Heart Disease Self-Management Behavior Scale (CSMS) and Health Promoting Lifestyle Profile (HPLP) and Medication Compliance Scale (MMAS-8) 3 months and 6 months after discharge. Results Six months after discharge, the score of self-management and healthy behavior and medication adherence were 96.98 ± 14.12, 131.86 ± 16.53, 7.18 ± 0.69 respectively in the intervention group, and the score of them were 86.04 ± 11.78, 105.33 ± 10.97, 5.69 ± 1.29 respectively in the control group, and the difference was statistically significant (t=10.981, 10.793, 7.438, P<0.05 or 0.01). Conclusions PDCA-based self-management intervention model is a patient-centered, problem-oriented, dynamic and interactive health education intervention. It may be helpful in improving PCI patients′ health behavior and medication adherence after discharge. And it may establish lasting self-management skills, and is worthy of application and promotion.

Objective To investigate clinical effects of Deanxit in non-erosive gastroesophageal re-flux disease ( NERD) with anxiety and depression.Methods A total of 76 patients diagnosed NERD with anxiety and depression by endoscopy and hospital anxiety and depression scale ( HAD) were randomly divid-ed into regular treatment group and Deanxit treatment group.Clinical efficacy, symptom score, and anxiety and depression score were observed after one week, four weeks, and eight weeks.Results Deanxit signifi-cantly increased the clinical efficacy after one week ( P <0.01) and remission rate after one week ( P <0.05), four and eight weeks ( P <0.01).It improved symptoms, depression, and anxiety, which showed significant differences ( P <0.01) compared to control group after one week, four and eight weeks adminis-tration.Conclusions Deanxit can be applied in NERD with anxiety and depression treatment, which has quick effect and high remission rate, and improve patient's reflux symptoms and anxiety depression.

OBJECTIVETo assess the association of vitamin D receptor (VDR) gene Fok I and Bsm I polymorphisms with dyslipidemia in elderly male patients with type 2 diabetes of Han nationality.

METHODSA total of 328 elderly male residents of Han nationality in Beijing, including 237 type 2 diabetic patients and 91 healthy control subjects, were enrolled in this study. The diabetic patients were divided into non-dyslipidemia group (DO group, n=134) and dyslipidemia group (DH group, n=103). All the participants were genotyped for Fok I and Bsm I polymorphisms in VDR gene using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and DNA sequencing technology, and the results were compared with their clinical characteristics.

RESULTSFor Fok I, the frequency of F allele was significantly higher in the diabetic patients than in the control group (Χ(2)=3.873, P=0.049, OR=1.439, 95% CI: 1.001-2.071). In the dominant model, the frequency of FF genotype was significantly higher in the diabetic group (Χ(2)=5.057, P=0.025, OR=1.756, 95% CI: 1.072-2.875) as well as in DH group (Χ(2)=6.168, P=0.013, OR=2.06, 95% CI: 1.161-3.663) than in the control group. There was no significant differences in the genotype frequency or allele distribution in other paired groups (P>0.05). Compared with Ff + ff genotype, FF genotype was associated with a significantly decreased average diastolic blood pressure (P=0.039) but significantly increased postprandial blood glucose (P=0.035), triglycerides (P=0.049) and uric acid (P=0.031). No significant difference was detected in genotype frequency or allele distribution of Bsm I polymorphisms between the groups (P>0.05); serum creatinine levels were significantly higher in bb genotype than in BB + Bb genotype group (P=0.011).

CONCLUSIONVDR gene Fok I polymorphisms may be a risk factor for dyslipidemia in elderly male patients with type 2 diabetes among Chinese Han population, where Bsm I polymorphisms are not associated with diabetic dyslipdiemia.

Aged ; Alleles ; Blood Glucose ; Blood Pressure ; Case-Control Studies ; Diabetes Mellitus, Type 2 ; genetics ; Dyslipidemias ; genetics ; Ethnic Groups ; Genotype ; Humans ; Male ; Polymerase Chain Reaction ; Polymorphism, Restriction Fragment Length ; Receptors, Calcitriol ; genetics ; Risk Factors ; Triglycerides ; blood

Objective To assess the association of vitamin D receptor (VDR) gene Fok I and Bsm I polymorphisms with dyslipidemia in elderly male patients with type 2 diabetes of Han nationality. Methods A total of 328 elderly male residents of Han nationality in Beijing, including 237 type 2 diabetic patients and 91 healthy control subjects, were enrolled in this study. The diabetic patients were divided into non-dyslipidemia group (DO group, n=134) and dyslipidemia group (DH group, n=103). All the participants were genotyped for Fok I and Bsm I polymorphisms in VDR gene using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and DNA sequencing technology, and the results were compared with their clinical characteristics. Results For Fok I, the frequency of F allele was significantly higher in the diabetic patients than in the control group (χ2=3.873, P=0.049, OR=1.439, 95%CI:1.001-2.071). In the dominant model, the frequency of FF genotype was significantly higher in the diabetic group (χ2=5.057, P=0.025, OR=1.756, 95%CI:1.072-2.875) as well as in DH group (χ2=6.168, P=0.013, OR=2.06, 95%CI:1.161-3.663) than in the control group. There was no significant differences in the genotype frequency or allele distribution in other paired groups (P>0.05). Compared with Ff + ff genotype, FF genotype was associated with a significantly decreased average diastolic blood pressure (P=0.039) but significantly increased postprandial blood glucose (P=0.035), triglycerides (P=0.049) and uric acid (P=0.031). No significant difference was detected in genotype frequency or allele distribution of Bsm I polymorphisms between the groups (P>0.05); serum creatinine levels were significantly higher in bb genotype than in BB + Bb genotype group (P=0.011). Conclusion VDR gene Fok I polymorphisms may be a risk factor for dyslipidemia in elderly male patients with type 2 diabetes among Chinese Han population, where Bsm I polymorphisms are not associated with diabetic dyslipdiemia.

Objective To assess the association of vitamin D receptor (VDR) gene Fok I and Bsm I polymorphisms with dyslipidemia in elderly male patients with type 2 diabetes of Han nationality. Methods A total of 328 elderly male residents of Han nationality in Beijing, including 237 type 2 diabetic patients and 91 healthy control subjects, were enrolled in this study. The diabetic patients were divided into non-dyslipidemia group (DO group, n=134) and dyslipidemia group (DH group, n=103). All the participants were genotyped for Fok I and Bsm I polymorphisms in VDR gene using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and DNA sequencing technology, and the results were compared with their clinical characteristics. Results For Fok I, the frequency of F allele was significantly higher in the diabetic patients than in the control group (χ2=3.873, P=0.049, OR=1.439, 95%CI:1.001-2.071). In the dominant model, the frequency of FF genotype was significantly higher in the diabetic group (χ2=5.057, P=0.025, OR=1.756, 95%CI:1.072-2.875) as well as in DH group (χ2=6.168, P=0.013, OR=2.06, 95%CI:1.161-3.663) than in the control group. There was no significant differences in the genotype frequency or allele distribution in other paired groups (P>0.05). Compared with Ff + ff genotype, FF genotype was associated with a significantly decreased average diastolic blood pressure (P=0.039) but significantly increased postprandial blood glucose (P=0.035), triglycerides (P=0.049) and uric acid (P=0.031). No significant difference was detected in genotype frequency or allele distribution of Bsm I polymorphisms between the groups (P>0.05); serum creatinine levels were significantly higher in bb genotype than in BB + Bb genotype group (P=0.011). Conclusion VDR gene Fok I polymorphisms may be a risk factor for dyslipidemia in elderly male patients with type 2 diabetes among Chinese Han population, where Bsm I polymorphisms are not associated with diabetic dyslipdiemia.