ObjectiveTo elucidate the critical role of rehabilitation medical records (including electronic records) in rehabilitation medicine's clinical practice and management, comprehensively analyzed the structure, core content and data standards of rehabilitation medical records, to develop a standardized medical record data architecture and core dataset suitable for rehabilitation medicine and to explore the application of rehabilitation data in performance evaluation and payment. MethodsBased on the regulatory documents Basic Specifications for Medical Record Writing and Basic Specifications for Electronic Medical Records (Trial) issued by National Health Commission of China, and referencing the World Health Organization (WHO) Family of International Classifications (WHO-FICs) classifications, International Classification of Diseases (ICD-10/ICD-11), International Classification of Functioning, Disability and Health (ICF), and International Classification of Health Interventions (ICHI Beta-3), this study constructed the data architecture, core content and data standards for rehabilitation medical records. Furthermore, it explored the application of rehabilitation record summary sheets (home page) data in rehabilitation medical statistics and payment methods, including Diagnosis-related Groups (DRG), Diagnosis-Intervention Packet (DIP) and Case Mix Index. ResultsThis study proposed a systematic standard framework for rehabilitation medical records, covering key components such as patient demographics, rehabilitation diagnosis, functional assessment, rehabilitation treatment prescriptions, progress evaluations and discharge summaries. The research analyzed the systematic application methods and data standards of ICD-10/ICD-11, ICF and ICHI Beta-3 in the fields of medical record terminology, coding and assessment. Constructing a standardized data structure and data standards for rehabilitation medical records can significantly improve the quality of data reporting based on the medical record summary sheet, thereby enhancing the quality control of rehabilitation services, effectively supporting the optimization of rehabilitation medical insurance payment mechanisms, and contributing to the establishment of rehabilitation medical performance evaluation and payment based on DRG and DIP. ConclusionStructured rehabilitation records and data standardization are crucial tools for quality control in rehabilitation. Systematically applying the three reference classifications of the WHO-FICs, and aligning with national medical record and electronic health record specifications, facilitate the development of a standardized rehabilitation record architecture and core dataset. Standardizing rehabilitation care pathways based on the ICF methodology, and developing ICF- and ICD-11-based rehabilitation assessment tools, auxiliary diagnostic and therapeutic systems, and supporting terminology and coding systems, can effectively enhance the quality of rehabilitation records and enable interoperability and sharing of rehabilitation data with other medical data, ultimately improving the quality and safety of rehabilitation services.

ObjectiveTo explore the data standard system of electronic medical records in the field of rehabilitation, focusing on the terminology and coding standards, data structure, and key content categories of rehabilitation electronic medical records. MethodsBased on the Administrative Norms for the Application of Electronic Medical Records issued by the National Health Commission of China, the electronic medical record standard architecture issued by the International Organization for Standardization and Health Level Seven (HL7), the framework of the World Health Organization Family of International Classifications (WHO-FICs), Basic Architecture and Data Standards of Electronic Medical Records, Basic Data Set of Electronic Medical Records, and Specifications for Sharing Documents of Electronic Medical Records, the study constructed and organized the data structure, content, and data standards of rehabilitation electronic medical records. ResultsThe data structure of rehabilitation electronic medical records should strictly follow the structure of electronic medical records, including four levels (clinical document, document section, data set and data element) and four major content areas (basic information, diagnostic information, intervention information and cost information). Rehabilitation electronic medical records further integrated information related to rehabilitation needs and characteristics, emphasizing rehabilitation treatment, into clinical information. By fully applying the WHO-FICs reference classifications, rehabilitation electronic medical records could establish a standardized framework, diagnostic criteria, functional description tools, coding tools and terminology index tools for the coding, indexing, functional description, and analysis and interpretation of diseases and health problems. The study elaborated on the data structure and content categories of rehabilitation electronic medical records in four major categories, refined the granularity of reporting rehabilitation content in electronic medical records, and provided detailed data reporting guidance for rehabilitation electronic medical records. ConclusionThe standardization of rehabilitation electronic medical records is significant for improving the quality of rehabilitation medical services and promoting the rehabilitation process of patients. The development of rehabilitation electronic medical records must be based on the national and international standards. Under the general electronic medical records data structure and standards, a rehabilitation electronic medical records data system should be constructed which incorporates core data such as disease diagnosis, functional description and assessment, and rehabilitation interventions. The standardized rehabilitation electronic medical records scheme constructed in this study can support the improvement of standardization of rehabilitation electronic medical records data information.

ObjectiveTo analyze the data structure and standards of rehabilitation outpatient medical records, to provide data support for improving the quality of rehabilitation outpatient care and developing medical insurance payment policies. MethodsBased on the normative documents issued by the National Health Commission, Basic Standards for Medical Record Writing and Standards for Electronic Medical Record Sharing Documents, in accordance with the Quality Management Regulations for Outpatient (Emergency) Diagnosis and Treatment Information Pages (Trial), reference to the framework of the World Health Organization Family of International Classifications (WHO-FICs), the data framework and content of rehabilitation outpatient medical records were determined, and the data standards were discussed. ResultsThis study constructed a data framework for rehabilitation outpatient medical records, including four main components: patient basic information, visit process information, diagnosis and treatment information, and cost information. Three major reference classifications of WHO-FICs, International Classification of Diseases, International Classification of Functioning, Disability and Health, and International Classification of Health Interventions,were used to establish diagnostic standards and standardized terminology, as well as coding disease diagnosis, functional description, functional assessment, and rehabilitation interventions, to improve the quality of data reporting, and level of quality control in rehabilitation. ConclusionThe structuring and standardization of rehabilitation outpatient medical records are the foundation for sharing of rehabilitation data. The using of the three major classifications of WHO-FICs is valuable for the terminology and coding of disease diagnosis, functional description and assessment, and intervention in rehabilitation outpatient medical records, which is significant for sharing and interconnectivity of rehabilitation outpatient data, as well as for optimizing the quality and safety of rehabilitation medical services.

ObjectiveTo explore the standardization of inpatient rehabilitation medical record summary sheet, encompassing its structure, content and data standards, to enhance the standardization level of inpatient rehabilitation medical record summary sheet, improve data reporting quality, and provide accurate data support for medical insurance payment, hospital performance evaluation, and rehabilitation discipline evaluation. MethodsBased on the relevant specifications of the National Health Commission's Basic Norms for Medical Record Writing, Specifications for Sharing Documents of Electronic Medical Records, and Quality Management and Control Indicators for Inpatient Medical Record Summary Sheet (2016 Edition), this study analyzed the structure and content of the inpatient rehabilitation medical record summary sheet. The study systematically applied the three major reference classifications of the World Health Organization Family of International Classifications, International Classification of Diseases (ICD-10/ICD-11, ICD-9-CM-3), International Classification of Functioning, Disability and Health (ICF), and International Classification of Health Interventions (ICHI Beta-3), for disease diagnosis, functional description and assessment, and rehabilitation intervention, forming a standardized terminology system and coding methods. ResultsThe inpatient rehabilitation medical record summary sheet covered four major sections: inpatient information, hospitalization information, diagnosis and treatment information, and cost information. ICD-10/ICD-11 were the standards and coding tools for admission and discharge diagnoses in the inpatient rehabilitation medical record summary sheet. The three functional assessment tools recommended by ICD-11, the 36-item version of World Health Organization Disability Assessment Schedule 2.0, Brief Model Disability Survey and Generic Functioning domains, as well as ICF, were used for rehabilitation functioning assessment and the coding of outcomes. ICHI Beta-3 and ICD-9-CM-3 were used for coding surgical procedures and operations in the medical record summary sheet, and also for coding rehabilitation intervention items. ConclusionThe inpatient rehabilitation medical record summary sheet is a summary of the relevant content of the rehabilitation medical record and a tool for reporting inpatient rehabilitation data. It needs to be refined and optimized according to the characteristics of rehabilitation, with necessary data supplemented. The application of ICD-11/ICD-10, ICF and ICHI Beta-3/ICD-9-CM-3 classification standards would comprehensively promote the accuracy of inpatient diagnosis of diseases and functions. Based on ICD-11 and ICF, relevant functional assessment result data would be added, and ICHI Beta-3/ICD-9-CM-3 should be used to code rehabilitation interventions. Improving the quality of rehabilitation medical records and inpatient rehabilitation medical record summary sheet is an important part of rehabilitation quality control, and also lays an evidence-based data foundation for the analysis and application of inpatient rehabilitation medical record summary sheet.

Neurofibromatosis type 1 (NF1) presents with a diverse range of symptoms that can affect the skin, bones, eyes, central nervous system, and other organs. This article reports the diagnosis and treatment process of a patient with NF1 complicated by bilateral severe-to-profound sensorineural hearing loss. Genetic testing revealed a heterozygous variant of NF1 NM_ 000267.3: c.4054_ 4058del(p.Ser1352LeufsTer20, supporting the diagnosis of NF1. After thorough evaluation, a right cochlear implantation was performed, yielding satisfactory postoperative results. This case suggests that NF1 patients may exhibit phenotypic heterogeneity and atypicality, providing a reference for clinicians in the diagnosis and treatment of such patients.

In recent years, the number of lung surgeries has increased year by year, and the number of patients with postoperative cough has also increased gradually. Chronic cough after lung surgery seriously affects patients' quality of life and surgical outcome, and has become one of the clinical problems that clinicians need to solve. However, there is currently no guideline or consensus for the treatment of chronic cough after lung surgery in China, and there is no standardized treatment method. Therefore, we searched databases such as PubMed, Web of Science, CNKI, and Wanfang databases ect. from 2000 to 2023 to collected relevant literatures and research data, and produced the first expert consensus on chronic cough after lung surgery in China by Delphi method. We gave 11 recommendations from five perspectives including timing of chronic cough treatment, risk factors (surgical method, lymph node dissection method, anesthesia method), prevention methods (preoperative, intraoperative, postoperative), and treatment methods (etiological treatment, cough suppressive drug treatment, traditional Chinese medicine treatment, and postoperative physical therapy). We hope that this consensus can improve the standardization and effectiveness of chronic cough treatment after lung surgery, provide reference for clinical doctors, and ultimately improve the quality of life of patients with chronic cough after lung surgery.

Objective To explore the effects of small incision in situ release on surgical indications,nerve conduction velocity and upper limb function in patients with carpal tunnel syndrome(CTS).Methods A total of 100 CTS patients admitted to our hospital from January 2018 to January 2022 were selected,they were randomly divided into the control group(50 cases,treated with traditional carpal tunnel release)and the observation group(50 cases,treated with small incision in situ release),the clinical data of CTS patients were collected and surgical indications,nerve conduction velocity,upper limb function and the incidence of complications were compared between the two groups.Results The total effective rate was 98.00％in the observation group and 84.00％in the control group(P＜0.05).In the observation group,the length of incision was(1.65±0.29)cm,the time of opening and closing incision was(4.85±1.02)min,the hospitalization time was(3.24±0.62)d,the intraoperative blood loss was(17.88±3.53)mL,and the VAS score was(3.03±0.56)points one day after operation.The control group were(4.02±0.81)cm,(10.06±2.28)min,(7.11±1.34)d,(24.37±5.27)ml,(4.04± 0.89)points,the differences were statistically significant(P＜0.05).After treatment,The thumle-wrist sensory conduction velocity of CTS patients in the study group was(46.05±8.39)m/s,the middle finger-wrist sensory conduction velocity was(45.05±8.95)m/s,the thenar muscles-wrist motor conduction velocity was(53.94±11.47)m/s,the FIM ADL score was(34.38±7.22)points,and FMA The upper limb score was(34.23±7.25)points,and the control group was(41.86±8.22)m/s,(40.88±8.28)m/s,(49.05±10.01)m/s,(27.81±6.01)points,(41.05±9.19)points.The difference between the two groups was statistically significant(P＜0.05).The total incidence of complications was 4.00％in the observation group and 20.00％in the control group(P＜0.05).Conclusion Small incision in situ release is effective in the treatment of CTS patients,which can improve the surgical indications and nerve conduction velocity,help patients recover upper limb function,and reduce the incidence of postoperative complications.

Fecal microbiota transplantation(FMT)is a therapeutic approach that targets intestinal microorganisms by transplanting fecal microorganisms from healthy individuals into the gastrointestinal tract of diseased individuals,thus restoring the recipient's disordered gastrointestinal microbiota by restructuring the intestinal flora.However,the mechanism of action and adverse effects of FMT in different diseases have not yet been clarified,thus limiting its wide clinical application.Its use still relies on in-depth preclinical studies;however,highly inconsistent or incomplete experimental details provided in current reports,coupled with a lack of authoritative standards and recommendations,seriously affect the interpretation of the study findings and replication of the experimental procedures,as well as hindering the clinical translation of the result.We therefore review and discuss the key steps of recipient selection and graft sample collection,storage,graft material preparation,and grafting route,with the aim of improving the utilization of experimental animals,consumables,and labor,and providing method ological recommendations and references to achieve replicability and standardization of preclinical FMT studies.

Schimke immuno-osseous dysplasia (SIOD)caused by SMARCAL1 gene mutations is a rare genetic disorder characterized by multi-system involvement, including T-cell dysfunction, skeletal dysplasia, disproportionate short stature, nephrotic syndrome, and kidney failure. This multidisciplinary consultation involved a 9-year-old boy with intrauterine growth retardation, presenting with short stature, T-cell lymphopenia, proteinuria, and degenerative bone and joint disease. Treatment primarily focused on symptomatic and supportive care. Through the multidisciplinary rare disease consultation, holistic support was provided to the patient, offering comprehensive care from various specialtiesx.We also aim to use this case report to enhance clinicians′ under-standing of SIOD and improve the management and treatment of rare diseases.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.