1.Genotypic characteristics of thalassemia and evaluation of the effectiveness of blood routine screening in Sanya City
Xiujuan TIAN ; Meihua TAN ; Ting SUN ; Shiping CHEN ; Bo JIAO ; Chunrong HUANG ; Liting CHEN ; Dan XIE ; Ying YU
Chinese Journal of Endemiology 2023;42(9):710-715
Objective:To analyze the mutation types and distribution characteristics of thalassemia gene among high-risk populations in Sanya City, and to evaluate the effectiveness of blood routine screening, in order to provide scientific basis for formulating measures for prevention and control of thalassemia in Sanya City.Methods:Retrospective analysis was used to collect detection results and clinical data from high-risk individuals who completed genetic screening for thalassemia at Sanya Materal and Child Health Hospital from January 2019 to August 2021. Mutation types and distribution characteristics of thalassemia gene were analyzed, and the missed detection rate and sensitivity of blood routine indicators [mean corpuscular volume (MCV) and mean corpuscular hemoglobin (MCH)] were evaluated based on the results of genetic screening for thalassemia.Results:A total of 5 760 high-risk individuals were included in the screening results of thalassemia genes, and 3 868 samples of thalassemia gene mutations were detected, with a detection rate of 67.15%. Among them, there were 2 979 samples with α-thalassemia genetic mutations, with a detection rate of 51.72%; including 2 966 common genotype samples (99.56%), the main genotype was αα/-α 3.7 (20.14%, 600/2 979); 13 rare genotype samples (0.44%), 4 cases of αα/-- THAI, 3 cases of α CD40(AAG>AA-)α/αα, 2 cases of α PPα/αα, and 1 case of Fusion gene/αα, Fusion gene/α WSα, α WSα/α PPα, and α CD40(AAG>AA-)α/α WSα each. There were 340 samples with β-thalassemia gene mutations, with a detection rate of 5.90%; including 336 common genotype samples (98.82%). The β CD41/42/β N genotype was dominant (57.65%, 196/340); 4 rare genotype samples (1.18%), β CD5(-CT)/β N, β IVS-Ⅱ-2(-T)/β N, β IVS-Ⅱ-761(-T)/β N and β Initiation(ATG>AGG)/β N 1 case each. There were 549 samples of αβ-compound type thalassemia, with a detection rate of 9.53%. The α missing recombination β CD41/42 genotype was dominant (61.02%, 335/549). There were a total of 4 226 samples that could be traced back to MCV and MCH. Among them, 3 007 samples were found to have mutations in thalassemia genes through screening, 2 584 cases were found to have abnormalities in the combination of MCV and MCH indicators, and 423 samples were missed in blood routine screening, with a missed detection rate of 14.07% (423/3 007). The missed samples were mainly α static type, accounting for 89.13% (377/423) of the total missed samples. The screening sensitivity of MCV combined with MCH for α-, β- and αβ-compound type thalassemia was 82.65%, 98.07% and 98.15%, respectively. Conclusion:The types of genetic mutations in thalassemia in Sanya City are complex and diverse, and there are certain omissions in the blood routine screening of MCV combined with MCH.
2.Akinesia deformation sequence in a fetus suspected by prenatal ultrasound and confirmed after mid-term termination
Xinyao LUO ; Qiuyang GU ; Xinxiu LIU ; Jianhua LI ; Liyan HUANG ; Xiaohua HUANG ; Shengnan WU ; Jingping YANG ; Meihua TAN
Chinese Journal of Perinatal Medicine 2022;25(3):218-221
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.
3.A case of neonatal Cornelia de Lange syndrome caused by a novel variant of SMC1A gene.
Yanqing LI ; Yuanbai WANG ; Yuying JIANG ; Wanyu FU ; Meihua TAN ; Jianlong ZHUANG
Chinese Journal of Medical Genetics 2021;38(11):1132-1135
OBJECTIVE:
To explore the genetic etiology of a neonate with suggestive features of Cornelia de Lange Syndrome (CdLS).
METHODS:
Chromosome karyotyping, copy number variation sequencing (CNV-seq) and whole exome sequencing (WES) were carried out for the child. Meanwhile, peripheral venous blood samples were taken from his parents for verifying the suspected pathogenic variants detected in the child.
RESULTS:
The child has exhibited developmental delay, microcephaly, ptosis, micrognathia, and low ear setting, and was suspected as CdLS. No abnormality was found by karyotyping and CNV-seq analysis. WES has detected 5 heterogeneous variants and 1 hemizygous variant on the X chromosome. Combining the genetic pattern and result of family verification, a hemizygous C.3500T>C (p.ile1167thr) of the SMC1A gene was predicted to underlay the clinical manifestations of the patient. This variant was not recorded in the dbSNP and gnomAD database. PolyPhen2, Provean, SIFT all predicted the variant to be harmful, and PhastCons conservative prediction is was a conservative mutation. ACMG variant classification standard evidence supports are PM2, PP2, and PP3.
CONCLUSION
The novel c.3500T>C (p.Ile1167Thr) missense mutation of the SMC1A gene probably underlay the genetic etiology of CdLS in this child. Above results has enriched the mutation spectrum of CdLS type II, and facilitated clinical counseling for this family.
Cell Cycle Proteins/genetics*
;
Child
;
DNA Copy Number Variations
;
De Lange Syndrome/genetics*
;
Humans
;
Infant, Newborn
;
Mutation
;
Phenotype
;
Whole Exome Sequencing
4.Retrospective analysis and mining of data from 10 840 patients undergoing non-invasive prenatal screening.
Fang CHEN ; Meihua TAN ; Yanwen XU ; Bin ZHU ; Jia LI ; Kun LIN ; Mingqiao CHEN ; Lina ZENG
Chinese Journal of Medical Genetics 2020;37(10):1074-1078
OBJECTIVE:
To retrospectively analyze non-invasive prenatal screening (NIPS) data from two centers.
METHODS:
The NIPS results of 10 840 samples were analyzed, including 21/18/13 trisomies (T21/T18/T13), sex chromosome and other autosomal aneuploidies, and copy number variants (CNVs). The maternal age, gestational week, body mass index and concentration of free fetal DNA (cffDNA) were also analyzed.
RESULTS:
The average gestational age of the 10 840 pregnant women was (32.34±5.04) year old, and the average gestational week for NIPS was (17.60±3.55) week. The overall false positive rate for T21/T18/T13 was 0.11%, sensitivity was 100%, specificity was 99.89%, and positive predictive value was 81.5%. The positive predictive values for sex chromosome and other autosomal aneuploidies and CNVs were 56.67%, 11.76% and 83.33%, respectively. The incidence of T21/T18 in the elder women (35 years or elder) was 2.12 times(P<0.01) and 1.81 times (P> 0.05) that of young women. cffDNA was in proportion to gestational week (r = 0.207) and in inverse proportion to body mass index (r = -0.177). It has increased slowly before 15 weeks of gestation and thereafter at a rate of 0.5% per week after the 16th week.
CONCLUSION
The performance of NIPS in this study is by large close to the reported in the literature, and the results can provide a reference for further study.
5.Clinical and molecular characteristics of East Asian patients with von Hippel-Lindau syndrome
Wong MEIHUA ; Chu YINGHSIA ; Tan Ling HWEI ; Bessho HIDEHARU ; Ngeow JOANNE ; Tang TIFFANY ; Tan MINHAN
Chinese Journal of Cancer 2016;35(9):441-446
Background: Von Hippel–Lindau (VHL) syndrome is a dominantly inherited multisystem cancer syndrome caused by a heterozygous mutation in the VHL tumor suppressor gene. Previous studies suggested that similar populations of Caucasian and Japanese patients have similar genotype or phenotype characteristics. In this comprehensive study of East Asian patients, we investigated the genetic and clinical characteristics of patients with VHL syndrome. Methods: To create a registry of clinical characteristics and mutations reported in East Asian patients with VHL syndrome, we conducted a comprehensive review of English language and non?English language articles identi?fied through a literature search. Publications in Japanese or Chinese language were read by native speakers of the language, who then performed the data extraction. Results: Of 237 East Asian patients with VHL syndrome, 154 unique kindreds were identified for analysis. Analyzed by kindred, missense mutations were the most common (40.9%, 63/154), followed by large/complete deletions (32.5%, 50/154) and nonsense mutations (11.7%, 18/154). Compared with a previously reported study of both East Asian and non?East Asian patients, we found several key differences. First, missense and frameshift mutations in the VHL gene occurred less commonly in our population of East Asian patients (40.9% vs. 52.0%; P = 0.012 and 8.4% vs.13.0%; P < 0.001, respectively). Second, large/complete deletions were more common in our population of East Asian patients (32.5% vs. 10.5%; P < 0.001). Third, phenotypically, we observed that, in our population of East Asian patients with VHL syndrome, the incidence of retinal capillary hemangioblastoma was lower, whereas the incidence of renal cell carcinoma was higher. Conclusions: Evidence suggests that the genotypic and phenotypic characteristics of East Asian patients with VHL syndrome differ from other populations. This should be considered when making screening recommendations for VHL syndrome in Asia.
6.Identification of Risk Pathways and Functional Modules for Coronary Artery Disease Based on Genome-wide SNP Data
Zhao XIANG ; Luan YI-ZHAO ; Zuo XIAOYU ; Chen YE-DA ; Qin JIHENG ; Jin LV ; Tan YIQING ; Lin MEIHUA ; Zhang NAIZUN ; Liang YAN ; Rao SHAO-QI
Genomics, Proteomics & Bioinformatics 2016;14(6):349-357
Coronary artery disease (CAD) is a complex human disease, involving multiple genes and their nonlinear interactions, which often act in a modular fashion. Genome-wide single nucleotide polymorphism (SNP) profiling provides an effective technique to unravel these underlying genetic interplays or their functional involvements for CAD. This study aimed to identify the susceptible pathways and modules for CAD based on SNP omics. First, the Wellcome Trust Case Control Consortium (WTCCC) SNP datasets of CAD and control samples were used to assess the joint effect of multiple genetic variants at the pathway level, using logistic kernel machine regression model. Then, an expanded genetic network was constructed by integrating statistical gene–gene interactions involved in these susceptible pathways with their protein–protein interaction (PPI) knowledge. Finally, risk functional modules were identified by decomposition of the network. Of 276 KEGG pathways analyzed, 6 pathways were found to have a significant effect on CAD. Other than glycerolipid metabolism, glycosaminoglycan biosynthesis, and cardiac muscle contraction pathways, three pathways related to other diseases were also revealed, including Alzheimer’s disease, non-alcoholic fatty liver disease, and Huntington’s disease. A genetic epistatic network of 95 genes was further constructed using the abovementioned integrative approach. Of 10 functional modules derived from the network, 6 have been annotated to phospholipase C activity and cell adhesion molecule binding, which also have known functional involvement in Alzheimer’s disease. These findings indicate an overlap of the underlying molecular mechanisms between CAD and Alzheimer’s disease, thus providing new insights into the molecular basis for CAD and its molecular relationships with other diseases.
7.Treatment analysis of two-stage skin grafting with artificial dermis for perianal hidradenitis sup-purativa
Chunxiao HUANG ; Shixing CHEN ; Meihua TAN
Journal of Clinical Surgery 2015;(4):288-290
[ Abstract]Objective To investigate the effect of two-tage skin grafting with artificial dermis for perianal hidradenitis suppurativa. Methods A total of 20 cases diagnosed as perianal hidradenitis suppu-rativa in our hospital were selected from 2011 to 2013. In the first-stage operation,all diseased skin inclu-ding the superficial subcutaneous fatty tissue was excised,and normal deep subcutaneous fatty tissue was preserved. Then,artificial dermis was grafted to the preserved fatty tissue. After two weeks,split-hickness skin grafts were used for the skin defects as the second-tage operation. Graft success,recurrence and post-operative appearance were evaluated in these patients who were followed up for 9 to 28 months. Results Skin grafts of all 19 patients were successfully survived. The recurrence of hidradenitis suppurativa oc-curred in only one patient. This patient was treated with reoperation and the postoperative appearance was welly recovered. Conclusion Two-tage skin grafting with artificial dermis appears to be a good treatment option for perianal hidradenitis suppurativa.
8.Assessment of the American Joint Committee on Cancer 7th edition staging for localised prostate cancer in Asia treated with external beam radiotherapy.
Meihua WONG ; Connie YIP ; Huihua LI ; Terence TAN ; Ravindran KANESVARAN ; Balram CHOWBAY ; Puay Hoon TAN ; Min Han TAN ; Fuh Yong WONG
Annals of the Academy of Medicine, Singapore 2014;43(10):484-491
INTRODUCTIONMost international clinical practice guidelines for prostate cancer (PCa) are driven by data derived in a Western setting. However, tumour biology and clinical disease progression are likely to differ in the Asian population. We compare the performance of the revised American Joint Committee on Cancer (AJCC) prognostic groups with the commonly used D'Amico Risk Classification and conventional predictors for PCa, in a large cohort of Asian patients.
MATERIALS AND METHODSWe retrospectively reviewed data for 404 consecutive Singaporean patients receiving definitive radiotherapy at our centre between December 1996 and October 2006. The primary outcome was biochemical relapse-free survival (BRFS), defined using the Phoenix definition. The secondary outcome was overall survival (OS). Prognostic risk groups were defined using AJCC 7th edition (AJCC7) and 6th edition (AJCC6). Univariate analysis (UVA) and multivariate analysis (MVA) were performed for the following putative risk factors: age, Gleason score, prognostic grouping, tumour classification, radiation delivery technique, radiotherapy dose, hormonal therapy and initial PSA value.
RESULTSFor the cohort, median age was 69 years. Median follow-up was 66.3 months. Five-year BRFS rate was 84.3% with 71 biochemical relapses and 5-year OS rate was 89.1% with 54 deaths. The concordance-indices for BRFS prediction were 0.588, 0.550 and 0.567 for AJCC7, AJCC6 and D'Amico respectively. Initial PSA, T-stage and AJCC7 were prognostic for BRFS on UVA. Comparison of AJCC7 vs. D'Amico showed no statistical additional value of either classification system although D'Amico was superior when compared to AJCC6 in predicting BRFS. T-stage ≥3 and D'Amico were significant prognostic factors for BRFS on MVA.
CONCLUSIONIn our local, predominantly Chinese population, neither AJCC6 nor AJCC7 demonstrated a high predictive accuracy for BRFS although AJCC7 has a slightly better predictive ability than AJCC6.
Aged ; Aged, 80 and over ; Asia ; Humans ; Male ; Middle Aged ; Neoplasm Staging ; Practice Guidelines as Topic ; Prognosis ; Prostatic Neoplasms ; pathology ; radiotherapy ; Radiotherapy ; methods ; Retrospective Studies ; United States
9.Construction of personalized full-length fully human mammalian display antibody library for children with systemic lupus erythematosus.
Zhigang ZHOU ; Meihua ZHU ; Zhongkun LIANG ; Zhenrui CHEN ; Wei HE ; Changzheng LI ; Wanlong TAN ; Shibo JIANG ; Shuwen LIU ; Ye ZHOU ; Chen ZHOU
Journal of Southern Medical University 2012;32(8):1082-1087
OBJECTIVETo construct a personalized full-length fully human antibody mammalian display library for children with systemic lupus erythematosus (SLE).
METHODSThe total RNA was isolated from the PBMCs of SLE children. The heavy chain variable region and kappa light chain (VH and LCκ) of the antibody genes were amplified by RT-PCR and inserted into the pDGB-HC-TM vector separately to construct the heavy chain and light chain libraries. The library DNAs were transfected into 293T cells and the expression of full-length fully human antibody on the surface of 293T cells was analyzed by flow cytometry.
RESULTSUsing 0.8 µg total RNA as the template, the VH and LCκ were amplified and the full-length fully human antibody mammalian display library was constructed. The VH and LCκ gene libraries had a size of 9.4×10(4) and 8.4×10(4), respectively. Sequence analysis of 10 clones randomly selected from the VH and LCκ gene libraries each showed that 8 heavy chain clones and 7 light chain clones contained correct open reading frames, and flow cytometry demonstrated that all the 15 clones express full-length antibodies on 293T cell surfaces. 293T cells co-transfected with the VH and LCκ gene libraries expressed the full-length antibodies on the cell surface.
CONCLUSIONThe personalized full-length fully human antibody library for SLE children constructed allows display of the full-length antibodies on mammalian cell surfaces, thus providing a valuable platform for analyzing the autoantibodies, their etiological role, and their clinical implications in SLE.
Amino Acid Sequence ; Child ; Gene Library ; Genetic Vectors ; Humans ; Immunoglobulin Heavy Chains ; genetics ; Immunoglobulin kappa-Chains ; genetics ; Lupus Erythematosus, Systemic ; genetics ; immunology ; Membrane Proteins ; genetics
10.Human 14-3-3γ gene transfer may protect dopaminergic neurons in rat of Parkinson's disease
Xiaowu CHEN ; Zhibin CHEN ; Tan WANG ; Shurong WANG ; Meihua CAI ; Shenggang SUN
Chinese Journal of Geriatrics 2012;31(11):1022-1026
Objective To explore the effects of 14-3-3 γ gene on dopaminergic neurons of PD rat model.Methods 6 hydroxydopamine (6-OHDA) was injected into the corpus striatum of 60 SD rats to establish PD model.A week later,Ad/14-3-3 γ was injected into the corpus striatum of 16 rats,while PBS and Ad-LacZ were injected into the corpus striatum of 16 and 28 rats,respectively,as control.X-gal dyeing was utilized to examine the LacZ reporter gene expression in the corpus striatum at 3 day,2 week and 6 week.Real-time PCR was utilized to test the expression level of 14-3-3 γmRNA at 2 weeks after Ad/14-3-3 γ injection.Immunohistochemistry technique was used to detect TH positive neurons and fibers in the corpus striatum and substantial nigra.Western blotting was performed to check the expression of 14-3-3 γ in the corpus striatum at 2 weeks and caspase-3 at 6 veeks after Ad/14-3-3 γ injection.High performance liquid chromatography (HPLC) method was used to examine the contents of DA and DOPAC in the corpus striatum.The rats underwent rotational ethological examination at 1,2 and 6 weeks after the second injection.Results The expression of β-gal,which showed the successful LacZ gene transfection,was found in the corpus striatum of LacZ groups.The 14-3-3 γ mRNA and protein expression in the corpus striatum were significantly higher in the Ad/14-3-3 γ group than in the other two groups.The TH-positive cell ratio of substania nigra to contralateral area in the lesion side was 0.44±0.17 and the optical density (OD) of TH-positive fibers was 0.62±0.14 in the Ad/14-3-3 γ group,both higher than those in PBS group (0.16±0.13 and 0.36±0.15) and LacZ group (0.15±0.09 and 0.30±0.11) (all P<0.01).The contents of DA and DOPAC in the lesion sides of corpus striatum were increased in the Ad/14-3-3 γ group [(248± 116)ng/g and (752±177) ng/g] than in PBS group [(106±35) ng/g and (724±159) ng/g] and LacZ group [(136±49) ng/g and (765±163) ng/g] (P<0.01).The DA and DOPAC ratios of the lesion side of corpus striatum to the contralateral side were 0.37±0.14 and 0.38±0.17 in the Ad/14-3-3 γgroup,higher than those in PBS group (0.15±0.08 and 0.13±0.10,respectively) and LacZ group (0.19±0.11 and 0.16±0.09 (all P<0.01).The expression level of caspase-3 was decreased in Ad/14-3-3 γ group than in PBS and LacZ groups at 6 weeks after the second injection.The turns/min induced by apomorphine in Ad/14-3-3 γ group were 9.4 ± 2.5 at 1 week after the Ad/14-3-3 γinjection,and reduced to 4.6±2.2 at 6 weeks later.While in PBS and LacZ group,the turns were 14.5±4.9 and 13.8±3.5 at 1 week after the second injection,6 weeks later rised to 18.7±5.2 and 20.6± 6.7 respectively,significantly higher than those in Ad/14-3-3 γ group (all P<0.01).Conclusions 14-3-3γ gene transfer has a protective effect on the dopaminergic neurons and it may be a promising candidate gene for curing PD.

Result Analysis
Print
Save
E-mail