1.Humanistic Care for the Prevention of Perioperative Hypothermia in the Elderly
Na LI ; Liyan ZHAO ; Lina WU ; Xiongtao LIU ; Ru GU ; Wei PENG ; Xiali SHI ; Dan LEI ; Jing ZHANG ; Weiling LUO
Chinese Medical Ethics 2024;35(3):350-352
The intervention and prevention of perioperative hypothermia is not only reflected in the technical level, but also reveals the important role of humanistic care in the whole intervention work. If perioperative patients have hypothermia, it is likely to cause a series of complications such as postoperative shivering, which seriously threatens the life safety of patients. Prevention and intervention was based on a comprehensive understanding of the causes and hazards of hypothermia, especially the impact on the lives of the elderly. Effective supervision was implemented in the whole process of operation, such as dynamic monitoring of vital signs including body temperature, followed by room temperature regulation, body temperature protection and preoperative and postoperative psychological nursing. At this time, the sense of responsibility, good humanistic care of medical staff are of positive significance to effectively prevent and reduce the probability of perioperative hypothermia and accelerate the postoperative rehabilitation of patients.
2.The effect of silica in soil on the extraction of biological evidence DNA at the crime scene using the silica bead method
Lu LU ; Zehua GAO ; Tianquan WU ; Liyan YU ; Shenbing GU ; Dongtao JIA
Chinese Journal of Forensic Medicine 2024;39(1):112-114
Objective To study the effect of silica in soil on the extraction of biological evidence DNA at the crime scene using the silica bead method.Methods Mud suspension and diluted blood were mixed to prepare biological samples mixed with dust and soil,which is to simulate biological evidence at the crime scene.Cell lysis was performed using heating lysis and guanidine salt chemical lysis,respectively.DNA was extracted using the silica bead method,amplified by PCR using Identifiler Plus kit and detected by capillary electrophoresis.The electrophoresis results were compared.Using mud suspension instead of silica beads to extract diluted blood DNA to validate the effect of silica in soil on the extraction of biological evidence DNA at crime scene using silica beads method.Results The complete STR loci were obtained after the extraction and amplification of 4 μL,20 μL dilute blood mixed with mud and lysed with heating cracking,whoes average peak heights arel 969.7±376.9 RFU and 9 706.7±349.8 RFU.For the 4 μL dilute blood mixed with mud guanidine salt chemical lysis,it cannot obtain complete STR loci after extraction and amplification.20 μL dilute blood mixed with mud guanidine salt was chemically cleaved and amplified to obtain complete STR loci with an average peak height of 1 899.8±801.3 RFU.After extraction and amplification by mud suspension instead of silica beads to extract 20 μL diluted blood DNA,complete STR loci were obtained.Conclusion Silicon dioxide in soil can bind to DNA in the presence of guanidine salts,leading to a decrease in the efficiency of recovering on-site biological evidence DNA using the silicon bead method.
3.Repeatability of Pentacam HR in measuring corneal topographic parameters of keratoconus patients
Qing WANG ; Kaili YANG ; Liyan XU ; Yuwei GU ; Qi FAN ; Shengwei REN ; Dongqing ZHAO
Chinese Journal of Experimental Ophthalmology 2024;42(9):835-846
Objective:To investigate the repeatability of corneal topographic parameters with the Pentacam HR in patients with keratoconus of different severity.Methods:A diagnostic test study was performed.A total of 120 eyes from 98 patients with subclinical keratoconus or keratoconus were enrolled at Henan Eye Hospital from January 2019 to March 2022.The patients were divided into subclinical keratoconus group, mild keratoconus group, moderate keratoconus group and severe keratoconus group, with 30 eyes in each group.An additional 30 eyes of 30 subjects undergoing refractive surgery were selected as a control group.Three consecutive Pentacam HR measurements were performed by the same clinician.The recordings included a total of 53 parameters in anterior corneal surface, posterior corneal surface, thickness, composite index, and corneal densitometry.The within-subject standard deviation (Sw), repeatability limit ( r) and tolerance index (TI) were calculated to evaluate the repeatability of the parameters between different groups.This study adhered to the Declaration of Helsinki and was approved by the Ethics Committee of Henan Eye Hospital (No.HNEECKY-2019[5]).All subjects were informed of the purpose and significance of the study and signed an informed consent form before enrollment. Results:Compared with the control group, the TI of the subclinical, mild, moderate and severe keratoconus groups were 54.71%(29/53), 66.04%(35/53), 90.57%(48/53) and 94.34%(50/53), respectively, higher than 0.31.The steep keratometry (Ks), the maximum keratometry (Kmax) of the anterior corneal surface, the anterior corneal radius of curvature, the flat keratometry (Kf) of the posterior corneal surface, the posterior corneal radius of curvature (PRC), the thinnest corneal thickness (TCT), the average densitometry for the anterior 120 μm in the 0-2 mm area (A.0-2 mm), average densitometry for the anterior 120 μm in the 2-6 mm area (A.2-6 mm), average densitometry for the central tissue in the 0-2 mm area (C.2-6 mm), average densitometry for the total cornea in the 0-2 mm area (T.0-2 mm) and average densitometry for the total cornea in the 2-6 mm area (T.2-6 mm) showed good repeatability in the subclinical and mild keratoconus groups (TI<0.31).Kmax Zonal Mean 3 mm, posterior corneal surface mean keratometry, central keratoconus index showed good repeatability in subclinical, mild and moderate keratoconus groups.Kmax Zonal Mean 4 mm and Kmax Zonal Mean 5 mm showed good repeatability in all groups (TI<0.31).Conclusions:For patients with subclinical and mild keratoconus, Kf of the posterior corneal surface, PRC and TCT are recommended to monitor disease progression.To monitor the condition of patients with moderate and severe keratoconus, we may focus on the detection of Kmax Zonal Mean 4 mm and Kmax Zonal Mean 5 mm.
4.Application effects of enhanced heat preservation strategies in the operation room for patients with cervical spinal cord injuries
Ru GU ; Liyan ZHAO ; Yanzhen LI ; Na LI ; Kaili FAN ; Jialong WANG ; Qianru WANG ; Hong WANG ; Miao WANG ; Shuixia LI
Chinese Journal of Trauma 2024;40(11):1022-1027
Objective:To compare the effects of enhanced heat preservation strategies and conventional heat preservation strategies in the operation room on body temperature, coagulation function, and myocardial injury in patients with cervical spinal cord injuries.Methods:A retrospective cohort study was conducted to analyze the clinical data of 160 patients with cervical spinal cord injuries admitted to Second Affiliated Hospital of Xi′an Jiaotong University and Affiliated Honghui Hospital of Xi′an Jiaotong University from February to October 2022, including 82 males and 78 females, aged 38-64 years [(50.6±8.7)years]. Injured segments included C 3 in 19 patients, C 4 in 33, C 5 in 39, C 6 in 38, and C 7 in 31. According to American Spinal Injury Association (ASIA) classification, 10 patients were classified into grade A, 83 grade B, 39 grade C, and 28 grade D. All the patients underwent cervical laminoplasty, decompression and bone graft fusion surgery. According to different heat preservation strategies intraoperatively, the patients were divided into conventional heat preservation group ( n=80) and enhanced heat preservation group ( n=80). The body temperature changes before surgery, at 2 hours during surgery, immediately after surgery, at 2 and 24 hours after surgery were compared between the two groups. The changes of coagulation function before surgery and at 4 hours after surgery were compared between the two groups, including the prothrombin time (PT), thrombin time (TT), and activated partial thromboplastin time (APTT). The incidence of myocardial injury and the number of patients with myocardial injury measured by the indicators of cardiac troponin I (cTnI) and high-sensitivity cardiac troponin T (hs-cTnT) at 48 hours after surgery. Before surgery and at 14 days after surgery, ASIA classification was used to evaluate the neurological functions, including sensory and motor functions between the two groups. The incidence of cardiovascular events at 12 months after surgery were compared between the two groups. Results:A total of 145 patients were followed up for 12-18 months [(15.7±1.6)months]. At 12 months after operation, there were 7 patients in the enhanced heat preservation group were lost to follow-up, compared to 8 patients in the conventional heat preserration group. There was no statistically significant difference in body temperature between the two groups before surgery or at 24 hours after surgery ( P>0.05). At 2 hours during surgery, immediately after surgery and at 2 hours after surgery, the body temperature was (36.90±0.12)℃, (37.00±0.06)℃, and (37.16±0.06)℃ in the enhanced heat preservation group, which were significantly higher than those in the conventional heat preservation group [(36.56±0.03)℃, (36.74±0.08)℃, and (36.84±0.08)℃] ( P<0.01). The serum levels of PT, TT and APTT were not significantly different between the two groups before surgery ( P>0.05), while they were (13.1±1.2)seconds, (19.2±1.1)seconds, and (36.2±3.3)seconds in the enhanced heat preservation group at 4 hours after surgery, which were significantly lower than those in the conventional heat preservation group [(14.3±1.0)seconds, (20.2±1.1)seconds, and (38.7±3.4)seconds] ( P<0.01). The incidence of myocardial injury in the enhanced heat preservation group was 5.0% (4/80) at 48 hours after surgery, which was lower than 12.5% (12/80) in the conventional heat preservation group ( P<0.05). With cTnI as the indicator of myocardial injury, there were 2 patients [2.6%(2/76)] with myocardial injury in the enhanced heat preservation group, which was much lower than 8 patients [11.8%(8/68)] in the conventional heat preservation group ( P<0.05). With hs-cTnT as the indicator of myocardial injury, 8 patients [10.5%(8/76)] in the enhanced heat preservation group experienced myocardial injury, similar with 10 patients [14.7%(10/68)] in the conventional heat preservation group ( P>0.05). There were no statistically significant differences in the ASIA scores of the sensory and motor functions between the two groups before surgery and at 14 days after surgery ( P>0.05). The incidence of cardiovascular events at 12 months after surgery in the conventional heat preservation group was 27.8% (20/72), which was significantly higher than 9.6% (7/73) in the enhanced heat preservation group ( P<0.01). Conclusion:For patients with cervical spinal cord injuries, compared with conventional heat preservation strategies, the enhanced heat preservation strategies in the operating room can improve the patients′ core body temperature and coagulation function, and significantly reduce the incidence of myocardial injury and cardiovascular events.
5.Late-stage cascade of oxidation reactions during the biosynthesis of oxalicine B in Penicillium oxalicum.
Tao ZHANG ; Guowei GU ; Guodong LIU ; Jinhua SU ; Zhilai ZHAN ; Jianyuan ZHAO ; Jinxiu QIAN ; Guowei CAI ; Shan CEN ; Dewu ZHANG ; Liyan YU
Acta Pharmaceutica Sinica B 2023;13(1):256-270
Oxalicine B ( 1) is an α-pyrone meroterpenoid with a unique bispirocyclic ring system derived from Penicillium oxalicum. The biosynthetic pathway of 15-deoxyoxalicine B ( 4) was preliminarily reported in Penicillium canescens, however, the genetic base and biochemical characterization of tailoring reactions for oxalicine B ( 1) has remained enigmatic. In this study, we characterized three oxygenases from the metabolic pathway of oxalicine B ( 1), including a cytochrome P450 hydroxylase OxaL, a hydroxylating Fe(II)/α-KG-dependent dioxygenase OxaK, and a multifunctional cytochrome P450 OxaB. Intriguingly, OxaK can catalyze various multicyclic intermediates or shunt products of oxalicines with impressive substrate promiscuity. OxaB was further proven via biochemical assays to have the ability to convert 15-hydroxdecaturin A ( 3) to 1 with a spiro-lactone core skeleton through oxidative rearrangement. We also solved the mystery of OxaL that controls C-15 hydroxylation. Chemical investigation of the wild-type strain and deletants enabled us to identify 10 metabolites including three new compounds, and the isolated compounds displayed potent anti-influenza A virus bioactivities exhibiting IC50 values in the range of 4.0-19.9 μmol/L. Our studies have allowed us to propose a late-stage biosynthetic pathway for oxalicine B ( 1) and create downstream derivatizations of oxalicines by employing enzymatic strategies.
6.Effect of Sanhuang Tangshenkang on Wnt/β-catenin Signaling Pathway in Bone Tissue of Diabetic Rats
Liya SUN ; Liyan GU ; Bei LIU ; Jiaxi WANG ; Yinan FENG ; Yue XI
Chinese Journal of Experimental Traditional Medical Formulae 2023;29(18):69-77
ObjectiveTo observe the effect of Sanhuang Tangshenkang on the Wnt/β-catenin signaling pathway in the bone tissue of diabetic rats. MethodA high-sugar and high-fat diet was administered for 4 weeks, along with intraperitoneal injection of freshly prepared 2% streptozotocin (pH 4.5) at 30 mg·kg-1 body weight to induce a diabetes model in rats. The rats with diabetes were randomly divided into model group, low- and high-dose Sanhuang Tangshenkang groups (12.8, 38.4 g·kg-1), and Gushukang group (1.8 g·kg-1) according to the blood glucose level. Rats of the same age were fed on a regular diet and assigned to the control group. After 12 weeks of respective treatments with drugs or physiological saline, the fasting blood glucose (FBG) levels of the rats were measured using an automated biochemical analyzer. Enzyme-linked immunosorbent assay (ELISA) was used to detect fasting serum insulin (FINS), bone-specific alkaline phosphatase (BALP), and tartrate-resistant acid phosphatase (TRAP) levels. Micro-computed tomography (Micro-CT) was used to scan the femurs of rats to observe bone tissue microstructure and measure bone mineral density (BMD). Hematoxylin-eosin (HE) staining and safranin O/fast green staining were performed to observe pathological changes in the femoral bone tissue. Immunohistochemistry (IHC) and Western blot were used to detect the expression of Wnt3a, low-density lipoprotein receptor-related protein 5 (LRP-5), and β-catenin proteins. ResultCompared with the control group, the model group showed a significant increase in FBG, FINS, and TRAP levels (P<0.01), a significant decrease in BALP level (P<0.01), a significant decrease in BMD (P<0.01), and disorganized, elongated, and sparse bone trabecular structures with fractures and increased lipid droplets. Additionally, the expression of Wnt3a, LRP-5, and β-catenin proteins decreased (P<0.05, P<0.01). Compared with the model group, the low- and high-dose Sanhuang Tangshenkang groups showed a reduction in FBG and an increase in BALP (P<0.05). The low-dose Sanhuang Tangshenkang group also exhibited a decrease in FINS (P<0.05). All treatment groups showed a significant decrease in TRAP (P<0.01), varying degrees of improvement in BMD (P<0.05, P<0.01)), increased and denser bone trabeculae with more regular arrangements and reduced lipid droplets, and improved bone microstructure morphology. The average optical density values of Wnt3a, LRP-5, and β-catenin proteins were significantly increased in all drug-treated groups (P<0.05, P<0.01), and the expression of Wnt3a, LRP-5, and β-catenin proteins was elevated (P<0.05, P<0.01). ConclusionSanhuang Tangshenkang may regulate the imbalance of the Wnt/β-catenin signaling pathway by increasing the expression of Wnt3a, LRP-5, and β-catenin proteins in bone tissue, which may promote bone formation, reduce bone resorption, and lower blood glucose levels, thereby achieving the effect of preventing and treating diabetic osteoporosis.
7.Clinical features of keratoconus and influencing factors of disease severity
Meng ZHU ; Kaili YANG ; Liyan XU ; Qi FAN ; Yuwei GU ; Qing WANG ; Shanshan YIN ; Chenjiu PANG ; Dongqing ZHAO ; Shengwei REN
Chinese Journal of Experimental Ophthalmology 2023;41(5):484-492
Objective:To investigate the clinical characteristics of patients with keratoconus, and to explore the factors influencing keratoconus severity.Methods:A cross-sectional study was performed.A total of 908 patients (1 476 eyes) with primary keratoconus were enrolled in Henan Eye Hospital from January 2019 to December 2021.The medical history data of patients were collected by face-to-face questionnaire survey.Refractive parameters were measured by subjective optometry.Intraocular pressure (IOP) was measured by a non-contact tonometer, and corrected IOP was calculated by Dresden formula.Corneal topography parameters was obtained using Pentacam HR.The subgroup analysis of clinical characteristics of all patients was performed by age (<21 years, 21~<31 years, ≥31 years) and gender.Disease severity was graded based on steep keratometry (Ks), namely mild (Ks<48 D), moderate (48 D≤Ks<55 D) and severe (Ks≥55 D). The influencing factors of disease severity in keratoconus were analyzed by ordered Logistic regression.This study adhered to the Declaration of Helsinki.The study protocol was approved by the Ethics Committee of Henan Eye Hospital (No.HNEECKY-2019[5]). All subjects or guardians were informed of the purpose and significance of the study and written informed consent was obtained.Results:Of the 908 patients, 622 were with bilateral keratoconus and 286 were with unilateral keratoconus.The median age of onset was 20(17, 26) years, and the median age of diagnosis was 21(18, 27) years.The ratio of males to females was 3.05∶1.There were 9.80%(89/908) of the patients having a history of allergy, 25.55%(232/908) having a history of other systemic diseases, and 1.98%(18/908) having a family history of keratoconus.Of the 1 476 affected eyes, 27.57%(407/1 476) were diagnosed as severe keratoconus, and 61.94%(568/917) had a history of eye rubbing.The medians of sphericity, cylindricity, IOP, corrected IOP, Ks, thinnest corneal thickness (TCT), anterior corneal surface elevation (AE) and posterior corneal surface elevation (PE) were -4.00(-7.00, -1.75)D, -3.50(-6.00, -1.50)D, 12.00(10.30, 13.80)mmHg, 15.40(13.60, 17.00)mmHg, 49.85(46.40, 54.90)D, 460.00(425.00, 490.00)μm, 21.00(13.00, 34.75)μm, 51.00(33.00, 75.00)μm, respectively.The spherical refraction, IOP and corrected IOP were lower and the cylindrical refraction was higher in patients at age <21 years than in patients at age 21~<31 years, and the TCT of patients at age <21 years was higher than that at age ≥31 years, and the differences were statistically significant (all at P<0.05). Compared with female patients, male patients had younger onset age, lower spherical refraction, IOP and corrected IOP, as well as higher cylindrical refraction, AE and PE, showing statistically significant differences (all at P<0.05). The spherical refraction and IOP of male patients were lower than those of female patients at age <21 years, and the cylindrical refraction was higher in males than in females among the patients at age 21~<31 years, and the differences were statistically significant (both at P<0.05). Among the patients with onset age <21 years and diagnosis age <21 years, the ratio of males to females in patients with severe keratoconus was higher than those with mild and moderate disease, and the difference was statistically significant (both at P<0.05). Older age of onset was a protective factor for disease severity in keratoconus (odds ratio=0.981, 95% confidence interval: 0.963~0.999). Conclusions:The younger the onset age of keratoconus patients, the more severe the disease.Among the patients with severe keratoconus, there were more male patients, and males have a younger onset age and severer conditions.It is suggested that early screening of keratoconus in children and adolescents should be strengthened in clinical work, and more active prevention and treatment measures should be taken for younger patients, especially males.
8.Akinesia deformation sequence in a fetus suspected by prenatal ultrasound and confirmed after mid-term termination
Xinyao LUO ; Qiuyang GU ; Xinxiu LIU ; Jianhua LI ; Liyan HUANG ; Xiaohua HUANG ; Shengnan WU ; Jingping YANG ; Meihua TAN
Chinese Journal of Perinatal Medicine 2022;25(3):218-221
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.
9.Humanistic Care for the Prevention of Perioperative Hypothermia in the Elderly
Na LI ; Liyan ZHAO ; Lina WU ; Xiongtao LIU ; Ru GU ; Wei PENG ; Xiali SHI ; Dan LEI ; Jing ZHANG ; Weiling LUO
Chinese Medical Ethics 2022;35(3):350-352
The intervention and prevention of perioperative hypothermia is not only reflected in the technical level, but also reveals the important role of humanistic care in the whole intervention work. If perioperative patients have hypothermia, it is likely to cause a series of complications such as postoperative shivering, which seriously threatens the life safety of patients. Prevention and intervention was based on a comprehensive understanding of the causes and hazards of hypothermia, especially the impact on the lives of the elderly. Effective supervision was implemented in the whole process of operation, such as dynamic monitoring of vital signs including body temperature, followed by room temperature regulation, body temperature protection and preoperative and postoperative psychological nursing. At this time, the sense of responsibility, good humanistic care of medical staff are of positive significance to effectively prevent and reduce the probability of perioperative hypothermia and accelerate the postoperative rehabilitation of patients.
10.Treatment and prognosis of severe hyperbilirubinemia in full-term infants meeting exchange transfusion criteria: a multicenter retrospective study
Ling LI ; Meihua PIAO ; Wei GUO ; Jingqun WANG ; Shuxia GENG ; Mei YANG ; Xin HE ; Shufen ZHAI ; Lili PING ; Baoli TIAN ; Lixia LIANG ; Fang LIU ; Shaoguang LYU ; Xueai FAN ; Liyuan HUI ; Liyan LIU ; Xiaohong GU ; Xiaojiao WANG ; Jing KANG
Chinese Journal of Perinatal Medicine 2021;24(6):454-460
Objective:To investigate the prognosis of severe hyperbilirubinemia in full-term infants who met the exchange transfusion criteria and were treated by blood exchange transfusion and phototherapy.Methods:A total of 168 full-term infants with severe hyperbilirubinemia who met the criteria for exchange transfusion and were hospitalized in the Neonatology Department of seven tertiary hospitals in Hebei Province from June 2017 to December 2018 were retrospectively included. According to the treatment protocol, they were divided into two groups: exchange transfusion group (38 cases) and phototherapy group (130 cases). Two independent sample t-test and Chi-square test were used to compare the clinical manifestations and follow-up results between the two groups. Multivariate logistic regression was used to analyze the risk factors for poor prognosis. Results:Neonatal severe hyperbilirubinemia in the exchange transfusion and phototherapy group were both mainly caused by hemolytic disease [42.1%(16/38) and 29.2%(38/130)], sepsis [28.9%(11/38) and 11.5%(15/130)] and early-onset breastfeeding jaundice [15.8%(6/38) and 11.5%(15/130)]. Total serum bilirubin level on admission in the exchange transfusion group was significantly higher than that in the phototherapy group [(531.7±141.3) vs (440.0±67.4) μmol/L, t=3.870, P<0.001]. Moreover, the percentage of patients with mild, moderate and severe acute bilirubin encephalopathy in the exchange transfusion group were higher than those in the phototherapy group [15.8%(6/38) vs 3.8%(5/130), 7.9%(3/38) vs 0.8%(1/130), 13.2%(5/38) vs 0.0%(0/130); χ2=29.119, P<0.001]. Among the 168 patients, 135 were followed up to 18-36 months of age and 12 showed poor prognosis (developmental retardation or hearing impairment) with four in the exchange transfusion group (12.9%, 4/31) and eight in the phototherapy group (7.7%, 8/104). Multivariate logistic regression analysis showed that for full-term infants with severe hyperbilirubinemia who met the exchange transfusion criteria, phototherapy alone without blood exchange transfusion as well as severe ABE were risk factors for poor prognosis ( OR=14.407, 95% CI: 1.101-88.528, P=0.042; OR=16.561, 95% CI: 4.042-67.850, P<0.001). Conclusions:Full-term infants who have severe hyperbilirubinemia and meet the exchange transfusion criteria should be actively treated with blood exchange transfusion, especially for those with severe ABE, so as to improve the prognosis.

Result Analysis
Print
Save
E-mail