AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Chronic obstructive pulmonary disease （COPD） is a chronic respiratory disease that poses a significant threat to global health， exhibiting high morbidity， disability and mortality rate， with its prevention and treatment situation becoming increasingly critical. The pathogenesis of COPD is complex， and the underlying cellular and molecular biological mechanisms remain incompletely elucidated. Programmed cell death （PCD） is the process wherein cells actively undergo demise to maintain internal environmental stability in response to certain signals or specific stimuli. Contemporary medical research indicates that the dysregulation of PCD patterns such as apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis is closely related to the onset and progression of COPD. Clarifying the molecular mechanisms of PCD in COPD may provide novel perspectives for in-depth understanding and prevention of the disease. Traditional Chinese medicine （TCM） is characterized by holistic regulation. In recent years， extensive research has been conducted in the TCM field focusing on modulating apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis for the treatment of COPD， yielding remarkable achievements. Therefore， this study systematically explored the molecular mechanism of PCD in COPD and reviewed the potential mechanisms and intervention status of TCM targeting PCD in COPD， aiming to provide insights and references for the clinical prevention， treatment and in-depth research of COPD.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Chronic obstructive pulmonary disease （COPD） is a chronic respiratory disease that poses a significant threat to global health， exhibiting high morbidity， disability and mortality rate， with its prevention and treatment situation becoming increasingly critical. The pathogenesis of COPD is complex， and the underlying cellular and molecular biological mechanisms remain incompletely elucidated. Programmed cell death （PCD） is the process wherein cells actively undergo demise to maintain internal environmental stability in response to certain signals or specific stimuli. Contemporary medical research indicates that the dysregulation of PCD patterns such as apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis is closely related to the onset and progression of COPD. Clarifying the molecular mechanisms of PCD in COPD may provide novel perspectives for in-depth understanding and prevention of the disease. Traditional Chinese medicine （TCM） is characterized by holistic regulation. In recent years， extensive research has been conducted in the TCM field focusing on modulating apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis for the treatment of COPD， yielding remarkable achievements. Therefore， this study systematically explored the molecular mechanism of PCD in COPD and reviewed the potential mechanisms and intervention status of TCM targeting PCD in COPD， aiming to provide insights and references for the clinical prevention， treatment and in-depth research of COPD.

Objective To evaluate the predictive value of different machine learning models constructed in a multicenter environment for potential organ donors and verify their clinical application feasibility. Methods The study included 2 000 inpatients admitted to five domestic tertiary hospitals from January 2020 to December 2023, who met the criteria for potential organ donation assessment. They were randomly divided into a training set and an internal validation set (7∶3). Another 300 similar patients admitted to the First Affiliated Hospital of Harbin Medical University from January 2024 to April 2025 were included as an external validation set. The area under the curve (AUC), sensitivity, specificity, accuracy and F1-score of three models were compared, and the consistency of the potential organ donor determination process was tested. Multivariate logistic regression analysis was used to identify predictive factors of potential organ donors. Decision curve analysis (DCA) was employed to verify the resource efficiency of each model, and the threshold interval and intervention balance point were assessed. Results Apart from age, there were no significant differences in other basic characteristics among the centers (all P>0.05). The consistency of the potential organ donor determination process among researchers in each center was good [all 95% confidence interval (CI) lower limits >0]. In the internal validation set, the XGBoost model had the best predictive performance (AUC=0.92, 95% CI 0.89-0.94) and the best calibration (P=0.441, Brier score 0.099). In the external validation set, the XGBoost model also had the best predictive performance (AUC=0.91, 95% CI 0.88-0.94), outperforming logistic regression and random forest models. Multivariate logistic regression showed that mechanical ventilation had the greatest impact (odds ratio=2.06, 95% CI 1.54-2.76, P<0.001). DCA indicated that the XGBoost model had the highest net benefit in the threshold interval of 0.2-0.6. The “treat all” strategy only had a slight advantage at extremely low thresholds. The recommended threshold interval, which balances intervention costs and clinical benefits, considers ≥50% positive predictive value (PPV) and ≤50 referrals per 100 high-risk patients. Conclusions The XGBoost model established in a multicenter environment is accurate and well-calibrated in predicting potential organ donors. Combined with DCA, it may effectively guide the timing of clinical interventions and resource allocation, providing new ideas for the assessment and management of organ donation after brain death.

Perimenopausal depression （PMD） is an affective disorder that occurs in women during the transition from sexual maturity to old age. It can induce various complications， such as insomnia and cognitive decline. The etiology of PMD is complex. Although multiple hypotheses have been proposed， there is still no unified theory that fully explains its pathogenesis. Research into its mechanisms relies heavily on animal experiments， and establishing reliable animal models is crucial for experimental studies. Appropriate animal models can better simulate human pathophysiological states， rapidly evaluate the efficacy and safety of drugs and intervention methods， grasp the essence of the disease， and uncover its intrinsic connections， thereby exploring more advanced intervention strategies. However， there is a lack of systematic review and summarization of literature related to model construction. Additionally， traditional Chinese medicine （TCM）， adhering to the principles of ''syndrome differentiation and treatment'' and ''holistic concept''， has shown significant efficacy in treating PMD. In recent years， research exploring and analyzing its therapeutic mechanisms has been increasing. Therefore， to gain a clearer and more comprehensive understanding of PMD animal modeling methods and the mechanisms of TCM， this paper reviewed Chinese and English literature on PMD animal models and mechanisms of TCM in PMD treatment. It summarized the construction methods of single-factor and multi-factor PMD models， and discussed the advantages and disadvantages of each modeling approach. Furthermore， it delved into the mechanisms of TCM intervention in PMD， revealing that TCM formulas primarily exert their effects by regulating the hypothalamic-pituitary-adrenal axis， hypothalamic-pituitary-ovarian axis， gut-brain axis， cell signaling pathways， neural circuits， hormone levels， and neurotransmitter levels. This review aims to provide a reference for future research in this field. In summary， by summarizing the progress in the methods for PMD animal model construction and the mechanisms of TCM， the paper seeks to offer new insights into the mechanistic research of TCM intervention in PMD.

Neurocritical care involves complex pathophysiological mechanisms, and its incidence is higher, injuries are more severe, and treatment is more challenging in high-altitude environments. This consensus, based on the latest domestic and international evidence-based medical data, establishes a standardized, goal-oriented framework for neurocritical care management applicable in high-altitude regions and nationwide. The consensus was developed following international standards for evidence quality assessment and underwent two rounds of Delphi expert consultation, resulting in 32 recommendation statements covering three parts: management systems, monitoring and assessment, and core strategies. Key updates include: advocating for the establishment of independent neurocritical care units and implementing precise tiered diagnosis and treatment based on the "Five Differences in Critical Care" concept; constructing a "trinity" multimodal brain monitoring system centered on cerebral blood flow, cerebral oxygenation, and brain function, emphasizing routine bedside transcranial Doppler ultrasound, cerebral oximetry, and continuous electroencephalography monitoring; shifting management strategies from mild hypothermia therapy to targeted temperature management, and defining the "446" target management pathway for the supercritical stage; emphasizing the assessment of static and dynamic cerebrovascular autoregulation functions through multimodal methods to achieve individualized optimal mean arterial pressure management; elevating cerebrospinal fluid management goals to the level of "glymphatic system" function maintenance; implementing a multidisciplinary collaborative, whole-process management model focusing on patients' long-term neurological functional outcomes; de-escalation criteria include multidimensional indicators such as recovery of brain structure, restoration of cerebrovascular autoregulation, improvement in cerebrospinal fluid dynamics, and reduction in biomarker levels; and integrating cutting-edge technologies like artificial intelligence into post-critical care management and rehabilitation planning. This consensus systematically integrates the entire process of neurocritical care management, reflecting the modern connotation of goal-oriented, dynamic, and multimodal integration in neurocritical care medicine. It aims to adapt to new trends such as deepening understanding of pathophysiological mechanisms, the integration of medicine and engineering, and the empowerment of artificial intelligence, thereby further advancing the discipline of critical care medicine.

With the rapid advancement of hemodynamic indices and monitoring technologies, their classification methods and application processes have become increasingly complex. Currently, no unified standard hasbeen established, making it difficult to fully meet the clinical requirements for hemodynamic management. To assist in hemodynamic monitoring assessment and therapeutic decision-making in critically ill patients, the Critical Hemodynamic Therapy Collaborative Group, in conjunction with the Critical Ultrasound Study Group, has jointly developed the Standard for the Application of Hemodynamic Monitoring Techniques in Critical Care. The first part of this standard systematically categorizes hemodynamic indicators into flow indicators, pressure and its derivative indicators, and tissue perfusion indicators, while elaborating on the clinical application of each. The second part establishes a standardized clinical implementation pathway for hemodynamic monitoring. It proposes a tiered monitoring strategy-comprising basic, advanced, indication-specific, and special scenario monitoring-tailored to different clinical settings. It emphasizes the central role of critical care ultrasound across all levels of monitoring and establishes hemodynamic assessment standards for organs such as the brain, kidneys, and gastrointestinal tract. This standard aims to provide a unified framework for clinical practice, teaching, training, and research in critical care medicine, thereby promoting standardized development within the discipline.

OBJECTIVE To investigate the effects of early continuous renal replacement therapy （CRRT） combined with nafamostat mesylate （NM） on clinical outcomes， safety， inflammatory reaction， and oxidative stress in patients with sepsis- associated acute kidney injury （SA-AKI）. METHODS Patients’ data were gathered from 153 cases admitted to the intensive care unit of the our hospital between January 2023 and January 2025， who initiated CRRT within 48 hours after being diagnosed with SA-AKI. These patients were divided into control group （75 cases） and observation group （78 cases） according to different anticoagulant drugs used during CRRT. After CRRT， control group was given sodium citrate， while observation group was given NM. The clinical outcomes [the duration of mechanical ventilation， length of stay in the intensive care unit （ICU）] as well as Acute Physiology and Chronic Health Evaluation Ⅱ （APACHE Ⅱ） score， Sequential Organ Failure Assessment （SOFA） score， renal function indexes [serum creatinine （Scr）， blood urea nitrogen （BUN）， cystatin C （CysC）]， inflammatory indexes [C-reactive protein （CRP）， procalcitonin （PCT）， interleukin-6 （IL-6）]， oxidative stress markers [malondialdehyde （MDA）， superoxide dismutase （SOD）， glutathione peroxidase （GSH-Px）] and the occurrence of adverse drug reactions before and after treatment were compared between the two groups. RESULTS After treatment， the observation group had significantly shorter mechanical ventilation duration and ICU length of stay compared to the control group （P＜0.05）. APACHE Ⅱ scores， SOFA scores， renal function indexes， inflammatory indexes and MDA levels of two groups were significantly lower than those before treatment within the same group （P＜0.05）， and the observation group were significantly lower than the control group （P＜0.05）. The levels of SOD and GSH-Px were significantly higher than those before treatment within the same group （P＜0.05）， and the observation group were significantly higher than the control group （P＜0.05）. There was no statistically significant difference in the overall incidence of adverse events between the two groups （P＞0.05）. CONCLUSIONS Compared with early CRRT combined with sodium citrate， early CRRT combined with NM can significantly improve renal function in patients with SA-AKI， alleviate the degree of inflammatory reaction and oxidative stress， shorten ICU stay length， and demonstrate favorable safety.