1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Mechanism of Electroacupuncture Alleviating Inflammatory Pain in Rats by Regulating ErbB Subtypes in the Spinal Dorsal Horn
Yuxin WU ; Shuxin TIAN ; Zhengyi LYU ; Dingru JI ; Xingzhen LI ; Yue DONG ; Binyu ZHAO ; Yi LIANG ; Jianqiao FANG
Journal of Traditional Chinese Medicine 2026;67(1):69-78
ObjectiveTo observe the changes in the levels of different subtypes of epidermal growth factor receptor (ErbB), namely ErbB1, ErbB2, ErbB3, and ErbB4, in the spinal dorsal horn of inflammatory pain model rats, and to explore their mechanism of mediating hyperalgesia as well as the intervention mechanism of electroacupuncture at "Zusanli (ST 36)" and "Kunlun (BL 60)". MethodsThe study was divided into five parts. In experiment 1, 14 Sprague Dawley (SD) rats were randomly divided into control and inflammatory pain group (7 rats each group) to observe the pain behavior and the protein expression of different ErbB receptor subtypes in the spinal dorsal horn. In experiment 2, 30 rats were randomly divided into control group 1, inflammatory pain group 1, and low-, medium-, and high-concentration TX1-85-1 groups, with 6 rats in each group, to observe the effect of inhibiting spinal ErbB3 on inflammatory pain. In experiment 3, 12 rats were randomly divided into control virus group and ErbB3 knockdown virus group, with 6 rats in each group, to observe the effect of knocking down ErbB3 in the spinal dorsal horn on inflammatory pain. In experiment 4, 44 rats were randomly divided into control group 2, inflammatory pain group 2, electroacupuncture group, and sham electroacupuncture group, with 11 rats in each group, to observe the effect of electroacupuncture. In experiment 5, 40 rats were randomly divided into control group 3, inflammatory pain group 3, electroacupuncture group 1, and electroacupuncture + NRG1 group, with 10 rats in each group, to observe the effect of activating ErbB3 on electroacupuncture. A rat model of inflammatory pain was established by subcutaneous injection of 100 μl of complete Freund's adjuvant into the sole of the unilateral hind foot of SD rats. Rats in the low-, medium-, and high-concentration TX1-85-1 groups were intrathecally injected with ErbB3 inhibitor TX1-85-1 on day 5 to day 7 after modeling. Rats in the ErbB3 knockdown virus group were injected with ErbB3 knockdown virus packaged with adenovirus vector-based short hairpin RNA (shRNA) into the spinal dorsal horn in situ 3 weeks before modeling. Rats in each electroacupuncture group received electroacupuncture at bilateral "Zusanli (ST 36)" and "Kunlun (BL 60)" from day 1 to day 7 after modeling, with dense-sparse waves at a frequency of 2 Hz/100 Hz and a current of 0.5-1.5 mA for 30 minutes once a day. Rats in the electroacupuncture + NRG1 group were intrathecally injected with ErbB3 ligand recombinant human neuregulin-1 (NRG1) after electroacupuncture intervention from day 5 to day 7 after modeling. The mechanical withdrawal threshold and thermal withdrawal latency of rats were measured on day 1, 3, 5, and 7 after modeling to evaluate behavior, and Western Blot was used to detect the protein and phosphorylation levels of each ErbB subtype in the spinal dorsal horn. ResultsCompared with the control group, rats in the inflammatory pain group showed decreased mechanical withdrawal threshold and thermal withdrawal latency of rats, and increased expression of phosphorylated ErbB3 (p-ErbB3) protein in the spinal dorsal horn on days 1, 3, 5, and 7 after modeling (P<0.01). On day 5 and day 7 after modeling, compared with the inflammatory pain group 1, the mecha-nical withdrawal threshold and thermal withdrawal latency of rats in the medium- and high-concentration TX1-85-1 groups increased, and the expression of p-ErbB3 protein decreased (P<0.05). On day 1, 3, 5, and 7 after modeling, compared with the control virus group, the mechanical withdrawal threshold and thermal withdrawal latency of rats in the ErbB3 knockdown virus group increased (P<0.05). On day 5 and day 7 after modeling, compared with the inflammatory pain group 2 and the sham electroacupuncture group, the mechanical withdrawal threshold and thermal withdrawal latency of rats in the electroacupuncture group increased, and the expression of p-ErbB3 protein decreased (P<0.05). On day 5 and day 7 after modeling, compared with the electroacupuncture + NRG1 group, the mechanical withdrawal threshold and thermal withdrawal latency of rats in the electroacupuncture group 1 increased (P<0.05). ConclusionThe p-ErbB3 in the spinal dorsal horn involved in hyperalgesia in rats with inflammatory pain, and electroacupuncture at "Zusanli (ST 36)" and "Kunlun (BL 60)" can alleviate inflammatory pain by inhibiting the expression of p-ErbB3 protein in the spinal dorsal horn of rats.
3.Epidemiological characteristics and influencing factors of severe fever with thrombocytopenia syndrome in Zhejiang Province
LÜ ; Jing ; XU Xinying ; QIAO Yingyi ; SHI Xinglong ; YUE Fang ; LIU Ying ; CHENG Chuanlong ; ZHANG Yuqi ; SUN Jimin ; LI Xiujun
Journal of Preventive Medicine 2026;38(1):10-14
Objective:
To analyze the epidemiological characteristics and influencing factors of severe fever with thrombocytopenia syndrome (SFTS) in Zhejiang Province from 2019 to 2023, so as to provide the reference for strengthening SFTS prevention and control.
Methods:
Data on laboratory-confirmed SFTS cases in Zhejiang Province from 2019 to 2023 were collected through the Infectious Disease Reporting Information System of Chinese Disease Prevention and Control Information System. Meteorological data, geographic environment and socioeconomic factors during the same period were collected from the fifth-generation European Centre for Medium-Range Weather Forecasts, Geospatial Data Cloud, and Zhejiang Statistical Yearbook, respectively. Descriptive epidemiological methods were used to analyze the epidemiological characteristics of SFTS from 2019 to 2023, and a Bayesian spatio-temporal model was constructed to analyze the influencing factors of SFTS incidence.
Results:
A total of 578 SFTS cases were reported in Zhejiang Province from 2019 to 2023, with an annual average incidence of 0.23/105. The peak period was from May to July, accounting for 52.60%. There were 309 males and 269 females, with a male-to-female ratio of 1.15∶1. The cases were mainly aged 50-<80 years, farmers, and in rural areas, accounting for 82.53%, 77.34%, and 75.43%, respectively. Taizhou City and Shaoxing City reported more SFTS cases, while Shaoxing City and Zhoushan City had higher annual average incidences of SFTS. The Bayesian spatio-temporal interaction model showed good goodness of fit. The results showed that mean temperature (RR=1.626, 95%CI: 1.111-2.378) and mean wind speed (RR=1.814, 95%CI: 1.321-2.492) were positively correlated with SFTS risk, while altitude (RR=0.432, 95%CI: 0.230-0.829) and population density (RR=0.443, 95%CI: 0.207-0.964) were negatively correlated with SFTS risk.
Conclusions
SFTS in Zhejiang Province peaks from May to July. Middle-aged and elderly people and farmers are high-risk populations. Taizhou City, Shaoxing City, and Zhoushan City are high-incidence areas. Mean temperature, mean wind speed, altitude, and population density can all affect the risk of SFTS incidence.
4.Proteomic Analysis of Danlou Tablet in Improving Platelet Function for Treating Coronary Heart Disease with Phlegm-stasis Intermingling Syndrome in Minipigs
Ziyan WANG ; Ying LI ; Aoao WANG ; Hongxu MENG ; Yue SHI ; Yanlei MA ; Guoyuan ZHANG ; Lei LI ; Jianxun LIU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(5):41-53
ObjectiveThis paper aims to observe the role of Danlou tablet in treating coronary heart disease (CHD) with phlegm-stasis intermingling syndrome in minipigs by improving platelet function and explore the potential pharmacological mechanism of Danlou tablet in regulating platelet function by using proteomics technology. MethodsThirty Bama minipigs were randomly divided into a normal control group (6 pigs) and a high-fat diet group (24 pigs). After 2 weeks of high-fat diet feeding, the high-fat diet group was randomly subdivided into a model group, an atorvastatin group (1 mg·kg-1), and Danlou tablet groups (0.6 g·kg-1 and 0.3 g·kg-1). All groups continued to receive a high-fat diet for 8 weeks after the procedure. The normal control group was given a regular diet, underwent only coronary angiography, and did not receive an interventional injury procedure. The model group and each administration group were fed a high-fat diet. Two weeks later, they underwent a coronary angiography injury procedure. After the procedure, drugs were mixed into the feed every morning for 8 consecutive weeks, with the minipigs maintained on a continuous high-fat diet during this period. Quantitative proteomics technology was further used to study platelet proteins, and differential proteins were obtained by screening. Bioinformatics analysis was performed to analyze key regulatory proteins and biological pathways involved in the therapeutic effect of Danlou tablet on CHD with phlegm-stasis intermingling syndrome. ResultsCompared with the normal control group, the model group showed a significant increase in total cholesterol (TC), triglyceride (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) of minipigs' serum (P<0.01), a significant shortening in prothrombin time of (PT) (P<0.01), a coagulation function index, and an increase in whole blood viscosity (P<0.01) and platelet aggregation rate (P<0.01). Moreover, the platelet morphology was altered, and the contents of endothelin-1 (ET-1) and nitric oxide (NO) were significantly increased (P<0.01). Hemodynamic parameters were obviously abnormal, including significantly decreased systolic blood pressure (SBP), diastolic blood pressure (DBP), mean arterial pressure (MAP), left ventricular systolic pressure (LVSP), and left ventricular maximal positive dp/dt (LV+dp/dtmax) (P<0.01). Left ventricular maximal negative dp/dt (LV-dp/dtmax) was significantly increased (P<0.01). Besides, there were myocardial cell hypertrophy, obvious edematous degeneration, massive interstitial inflammatory cell infiltration, high degree of fibrosis, and coronary endothelial atherosclerosis. TC and TG levels in minipigs' serum were significantly reduced in Danlou tablet groups with 0.6 g·kg-1 and 0.3 g·kg-1 (P<0.05, P<0.01), compared with those in the model group. LDL-C was decreased in the Danlou tablet group with 0.6 g·kg-1 (P<0.05). The whole blood viscosity under low and high shear conditions was significantly reduced in the Danlou tablet group with 0.6 g·kg-1 (P<0.05). In groups with all doses of Danlou tablet, maximum aggregation rate (MAR) and average aggregation rate (AAR) were significantly decreased (P<0.05, P<0.01), and platelets' morphological changes such as pseudopodia extension were reduced. ET-1 levels in the serum were significantly reduced. In the Danlou tablet group with 0.6 g·kg-1, NO level in the serum was reduced (P<0.05). In groups with all doses of Danlou tablet, DBP and MAP were significantly increased (P<0.05). In the Danlou tablet group with 0.6 g·kg-1, LVSP and LV+dp/dtmax were significantly increased (P<0.05, P<0.01), and LV-dp/dtmax was significantly decreased (P<0.05). In groups with all doses of Danlou tablet, edematous degeneration in myocardial tissue was milder, and coronary artery lesion degree was significantly alleviated. Compared with the normal control group, there were 94 differentially expressed proteins in the model group, including 81 up-regulated and 13 down-regulated proteins. Compared with the model group, the Danlou tablet group with 0.6 g·kg-1 showed 174 differentially expressed proteins, including 100 up-regulated and 74 down-regulated proteins. A total of 30 proteins were reversed after Danlou tablet intervention. Bioinformatics analysis revealed that its pharmacological mechanism may exert anti-platelet activation, aggregation, and adhesion effects through biological pathways such as regulation of actin cytoskeleton, platelet activation pathway, Fcγ receptor-mediated phagocytosis, as well as proteins such as growth factor receptor-bound protein 2 (GRB2), Ras-related C3 botulinum toxin substrate 2 (RAC2), RAC1, and heat shock protein 90 alpha family class A member 1 (HSP90AA1). ConclusionDanlou tablet can effectively reduce platelet activation and aggregation, exerting a good therapeutic effect on CHD with phlegm-stasis intermingling syndrome in minipigs. Its pharmacological mechanism may involve regulating biological pathways such as actin cytoskeleton and platelet activation pathway, as well as proteins like GRB2, RAC2, RAC1, and HSP90AA1, thereby exerting a pharmacological effect in anti-platelet activation, aggregation, and adhesion.
5.Relationship of gross motor skills and perceptual motor abilities with physical activity levels in preschoolers
LI Yameng, ZHU Xiaotong, SHAO Tianzeng, YUE Fengshan, REN Yiqi, REN Yuanchun
Chinese Journal of School Health 2026;47(1):104-108
Objective:
To analyze the relationship of gross motor skills and perceptual motor abilities with physical activity levels in preschool children in a Beijing kindergarten, so as to provide a reference for promoting the development of motor competence.
Methods:
From September 2018 to March 2021, preschoolers aged 4-5 years were selected using convenience sampling method from an urban kindergarten in Beijing. The Test of Gross Motor Development-Third Version(TGMD-3) was used to assess basic preschoolers s gross motor skills ( n =152). The Pictorial Scale of Perceived Movement Skill Competence(PMSC) was used to evaluate perceptual motor skills ( n =151). Accelerometers (Actigraph GT3X) were used to record physical activity levels ( n =52). Data were analyzed using one way analysis of variance (ANOVA) and Pearson correlation coefficients.
Results:
The mean scores for gross motor skills and perceptual motor abilities were (38.76±13.48) and (35.49±6.50), respectively. The moderate to vigorous physical activity(MVPA) level was(52.60±27.44) minutes per day. No statistically significant correlations were found between gross motor skills, perceptual motor abilities MVPA among boys, girls or the overall group ( r =-0.20 to 0.25, all P >0.05). However, Boys locomotor skills, overall children s locomotor skills, and boys gross motor skills were all positively correlated with MVPA( r =0.34-0.45, all P <0.05).
Conclusion
There is a correlation between locomotor skills and physical activity levels in 4 to 5-year-old children.
6.Action Mechanism of Huamoyan Granules in Treatment of Knee Osteoarthritis Based on TRPV1/p38 MAPK Pathway
Jin ZHANG ; Lili YANG ; Canwen ZHENG ; Jing KANG ; Yanlei MA ; Yue SHI ; Lei LI ; Hongxu MENG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(4):79-89
ObjectiveThis paper aims to observe the protective effect of Huamoyan granules on knee osteoarthritis (KOA) and explore whether its protective effect is oriented toward an anti-inflammatory direction by regulation of macrophage polarization, which can effectively inhibit the progression of pathological inflammatory response, reduce the release of inflammatory pain mediators, and downregulate the protein expression level of transient receptor potential vanilloid 1 (TRPV1), so as to provide experimental evidence for its clinical application and investigate its action mechanism. MethodsAfter adaptive feeding, Sprague-Dawley (SD) rats were randomly divided into six groups: sham group, model group, celecoxib group, and high, medium, and low-dose synovitis granule groups (9.6, 4.8, 2.4 g·kg-1). The administration dose of celecoxib capsules was 20 mg·kg-1. There were 10 rats in the sham group and 12 rats in the model group and each administration group. A KOA animal model was established by means of intra-articular injection of sodium iodoacetate into the knee joint. From the 10th day of the experiment, each administration group was given intragastric administration at a dose of 10 mL·kg-1 for 4 weeks. General conditions of rats in each group were assessed daily. The pressure pain threshold (PPT) to mechanical stimulation and joint diameter were recorded. X-ray examination was performed on the right knee joints of rats for imaging analysis. Enzyme linked immunosorbent assay (ELISA) was performed to detect the tumor necrosis factor-α (TNF-α), serum interleukin-1β (IL-1β), and other pro-inflammatory cytokines in rat serum samples, as well as the expression levels of neurogenic inflammatory mediators such as nerve growth factor (NGF) and calcitonin gene-related peptide (CGRP). Histopathological changes in the knee joint synovial tissues were examined by hematoxylineosin (HE) staining. Safranin O-fast green staining was performed to observe and evaluate the degree of knee cartilage lesions. Western blot was employed to quantitatively analyze TRPV1, p38 mitogen-activated protein kinase (p38 MAPK), and phosphorylated (p)-p38 MAPK in rat knee synovial tissues. Immunofluorescence (IF) was used to measure and assess M1/M2 macrophage polarization. ResultsCompared with those in the sham group, the circumference and joint diameter of the right knee were markedly enlarged in the model group (P<0.01), while PPTs of rats showed a significant reduction (P<0.01). The contents of IL-1β, TNF-α, CGRP, and NGF in rats' serum were significantly elevated (P<0.01), and the synovial Krenn score was increased (P<0.01). The Mankin score of cartilage tissue was increased (P<0.01), and the protein expressions of TRPV1 and p-p38 MAPK/p38 MAPK were significantly upregulated (P<0.01). The experimental intervention significantly reduced the proportion of pro-inflammatory M1 macrophages in the total macrophage population (P<0.01), and the percentage of M2 macrophages was decreased (P<0.01). The M1/M2 macrophage ratio was significantly elevated (P<0.01). Knee joint diameters of all dose groups of Huamoyan granules and the celecoxib group were reduced (P<0.01) compared with those of the model group, and the PPT recovery speeds in the high and medium-dose groups of Huamoyan granules were more obvious (P<0.05). The contents of IL-1β, CGRP, and NGF in the rats' serum in all administration groups were significantly reduced (P<0.05, P<0.01), and the content of TNF-α in rats' serum was significantly reduced (P<0.01). All dose groups of Huamoyan granules demonstrated significant reductions in both synovial Krenn score (P<0.05, P<0.01) and protein expression of TRPV1 and p-p38 MAPK/p38 MAPK in rats' synovial tissues (P<0.01). The percentage of M1 macrophages in the synovial tissues of the celecoxib group and all dose groups of Huamoyan granules was decreased (P<0.01). The percentage of M2 macrophages was increased (P<0.05), and the M1/M2 ratio was decreased (P<0.01). ConclusionHuamoyan granules can alleviate the inflammatory response of KOA, reduce the release of inflammatory pain mediators, and downregulate TRPV1 protein expression by regulating macrophage polarization. Its mechanism may be related to the TRPV1/p38 MAPK signaling pathway, thereby achieving the effect of improving peripheral pain hypersensitivity in KOA.
7.Expert Consensus on Clinical Application of Qidong Yixin Oral Liquid
Changkuan FU ; Xiaochang MA ; Mingjun ZHU ; Yue DENG ; Hongxu LIU ; Mingxue ZHANG ; Ying CHEN ; Yan ZHOU ; Ling ZHANG ; Jianhua FU ; Wei YANG ; Yu'er HU ; Ming CHEN ; Yanming XIE ; Yuanyuan LI
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(4):147-158
The prescription of Qidong Yixin oral liquid is derived from the experience of national medical master Ren Jixue in treating viral myocarditis (VMC). It has the functions of tonifying Qi, nourishing the heart,calming the mind, and relieving palpitations. It is used to treat VMC and angina pectoris of coronary heart disease caused by deficiency of both Qi and Yin. However,the understanding of its efficacy evidence, advantageous aspects, dosage and administration, and medication safety remains insufficient in clinical practice. Therefore,the development of the Expert Consensus on the Clinical Application of Qidong Yixin Oral Liquid (hereinafter referred to as consensus) was initiated. Consensus strictly followed the process and methods of the expert consensus on the clinical application of Chinese patent medicines of the China Association of Chinese Medicine,successively completing multiple tasks such as the consensus project initiation,determination of clinical problems,evidence search and evaluation,formation of recommendation opinions and consensus suggestions,solicitation of opinions,peer review, submission for review and release, and so on. Consensus formed a total of 10 recommendation opinions and 12 consensus suggestions,clarifying the clinical positioning,efficacy advantages,syndrome differentiation,dosage and administration,combination therapy,timing of medication,adverse reactions,contraindications, and precautions of Qidong Yixin oral liquid,indicating that it has good clinical advantages and safety in the treatment of VMC and angina pectoris of coronary heart disease,providing norms and references for physicians to safely and rationally apply Qidong Yixin oral liquid. Consensus was reviewed and approved for release by the Standardization Office of the China Association of Chinese Medicine on December 23, 2024. Standard number:GSCACM-376-2024.
8.Clinical comprehensive evaluation of 16 commonly used kinds of enteral nutrition preparations in Hebei province
Zhihan ZHANG ; Yue CHENG ; Lamei XU ; Qingsong LI ; Yuan GAO ; Congxin LI ; Shuqing GAO
China Pharmacy 2026;37(3):281-287
OBJECTIVE To comprehensively evaluate the 16 commonly used kinds of enteral nutrition preparations in Hebei province, aiming to provide a reference for the selection of drugs in medical institutions and clinical drug decision-making. METHODS Based on the Quick Guide for Drug Evaluation and Selection in Chinese Medical Institutions (the Second Edition), evaluation evidence was collected, and the included drugs were scored and evaluated from four dimensions of pharmaceutical characteristics, clinical characteristics, economy and other attributes. RESULTS & CONCLUSIONS The scores for Enteral nutritional emulsion (TPF-T), Enteral nutritional emulsion (TPF-D), Enteral nutritional emulsion (TPF), Enteral nutritional emulsion (TPF-HE), Enteral nutritional emulsion (TP), Enteral nutritional emulsion (SP), Enteral nutritional suspension (TPF) (1.5 kcal/mL, 1 kcal=4.184 kJ), Enteral nutritional suspension (TPF) (1.0 kcal/mL), Intact protein enteral nutrition (powder), Enteral nutritional suspension (TPF-DM), Enteral nutritional suspension (TPF-MCT), Enteral nutritional suspension (SP), Short- peptide enteral nutrition, Enteral nutritional powder (TP), Enteral nutritional suspension (TPF-D) and Enteral nutritional suspension (TPF-FOS) were 82.9, 84.1, 84.1, 86.1, 78.4, 79.1, 82.6, 82.3, 82.4, 80.2, 83.0, 82.4, 82.1, 85.7, 76.0, 82.4 points, respectively. All medications scored above 70 points. In practice, appropriate drugs can be selected according to clinical requirements and patient needs.
9.A Review of Methods for Establishing and Evaluating Animal Models of Stroke
Yunrong YANG ; Wenyu WU ; Yue TAN ; Guofeng YAN ; Yao LI ; Jin LU
Laboratory Animal and Comparative Medicine 2026;46(1):94-106
Stroke is one of the leading causes of disability and mortality worldwide. Research into its mechanisms and the development of therapeutic strategies heavily rely on animal models that accurately replicate the pathological features of human disease. An ideal animal model for stroke should not only reproduce the neurological deficits and pathological changes observed in clinical patients but also demonstrate good reproducibility and translational value. This review focuses on the preparation and evaluation methods of ischemic stroke animal models. Firstly, it elaborates on the selection criteria, advantages, and disadvantages of experimental animals, including rodents (rats, mice) and non-rodents (non-human primates, miniature pigs, rabbits, zebrafish). Secondly, it provides a detailed overview of the modeling principles, key procedures, and application scopes for ischemic stroke models and hemorrhagic stroke models. Furthermore, the review summarizes advances in the applications of emerging technologies—including gene editing [e.g., clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene editing], multimodal imaging (e.g., two-photon microscopy, photoacoustic imaging), artificial intelligence, optogenetics, 3D bioprinting, organoid models, and multi-omics–in model optimization, precise assessment, and mechanistic investigation. Finally, based on a systematic analysis of relevant domestic and international literature from 2019 to 2024, this review discusses model selection strategies based on research objectives, a multidimensional evaluation system encompassing behavioral, imaging, and molecular pathological assessments, and envisions future directions involving technological integration to achieve model precision and individualization. This article aims to provide a comprehensive methodological reference to help researchers select appropriate animal models of stroke according to specific scientific questions.
10.Anti-tumor Mechanism of Traditional Chinese Medicine with Effect of Softening Hardness and Dissipating Mass: A Review
Yue HU ; Linfeng WANG ; Yue LI ; Rui LIU ; Baojin HUA
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(1):276-286
The global burden of malignant tumors keeps increasing, and the increased morbidity and mortality make malignant tumors one of the major challenges to global health. Currently, malignant tumors are mainly managed by surgical resection, radiotherapy, chemotherapy, targeted therapy, and immunotherapy, which, however, usually cause serious adverse reactions, such as tissue damage, immune function inhibition, and multidrug resistance, affecting the prognosis and quality of life of the patients. Traditional Chinese medicine with low toxic and side effects and multi-target, multi-system, and multi-pathway therapeutic effects has shown positive therapeutic potential in cancer treatment. In particular, the traditional Chinese medicine with the effects of softening hardness and dissipating mass, which contains a variety of active ingredients, have shown strong inhibitory effects on tumor cells. Such medicine can not only directly attack tumor cells and inhibit their proliferation and invasion but also exert therapeutic effects by inducing apoptosis, blocking tumor-related signaling pathways, and inhibiting tumor angiogenesis. In addition, traditional Chinese medicine can improve the overall efficacy of cancer treatment by regulating the immune status of the body and reversing the drug resistance of tumor cells. Traditional Chinese medicine can exert the anti-tumor effect by regulating intracellular signaling pathways, which is one of the research hotspots in this field. Signaling pathways such as signal transducer and activator of transcription 3 (STAT3), phosphatidylinositol 3-kinase (PI3K)/protein kinase B (Akt)/mammalian target of rapamycin (mTOR), and mitogen-activated protein kinase (MAPK) play a key role in the formation and development of tumors. Traditional Chinese medicine can regulate the growth, apoptosis, and metabolic process of tumor cells by affecting the activity of these signaling pathways, thus exerting the therapeutic effects on tumors. Based on these mechanisms, a large number of experimental studies and clinical trials have proved that traditional Chinese medicine has broad prospects in anti-tumor treatment. To further verify these research results and provide a basis for the clinical application of traditional Chinese medicine and the development of new drugs, a systematic review and integrated analysis of the research reports on the anti-tumor effect of traditional Chinese medicine was carried out to summarize the anti-tumor mechanisms of traditional Chinese medicine. This review is expected to promote the wide application of traditional Chinese medicine in anti-tumor treatment worldwide and bring more hope and possibility to cancer patients.


Result Analysis
Print
Save
E-mail