ObjectiveTo investigate the effect of quercetin on acute gouty arthritis （GA） in rats by inhibiting the reactive oxygen species （ROS）/NOD-like receptor protein 3 （NLRP3）/interleukin-1β （IL-1β） signaling pathway. MethodsSixty SPF-grade male SD rats were randomized into normal， model， colchicine （0.3 mg·kg^-1）， and low-， medium-， and high-dose （25， 50， 100 mg·kg^-1， respectively） quercetin groups （n=10）. The rats in the dosing groups were administrated with the corresponding drugs （10 mL·kg^-1） by gavage once a day for one week. An equal volume of normal saline was given by gavage to rats in normal and model groups. One hour after drug administration on day 5， an acute GA model was established in other groups except the control group via intra-articular injection of monosodium urate （MSU） suspension into the right posterior ankle joint cavity. The joint swelling and gait were scored at the time points of 6， 12， 24， 48 h after modeling. Histopathological alterations in the ankle joint tissue from each group were assessed by hematoxylin-eosin （HE） staining. Malondialdehyde （MDA）， xanthine oxidase （XOD）， and total superoxide dismutase （T-SOD） assay kits were used to assess the levels of MDA， XOD， and T-SOD in the serum. The levels of tumor interleukin-6 （IL-6）， necrosis factor-α （TNF-α）， and IL-1β in the rat serum， as well as ROS in the ankle joint tissue， were measured by enzyme-linked immunosorbent assay （ELISA）. Western blot was performed to determine the protein levels of NLRP3， thioredoxin-interacting protein （TXNIP）， apoptosis-associated speck-like protein containing a CARD domain （ASC）， precursor cysteinyl aspartate-specific proteinase-1 （pro-Caspase-1）， cleaved Caspase-1 （Caspase-1 p20）， and IL-1β in the ankle joint tissue. Real-time PCR was employed to assess the mRNA levels of TXNIP， NLRP3， ASC， IL-1β， and TNF-α in the ankle joint tissue. ResultsCompared with the normal group， the model group exhibited decreased spontaneous activity， mental fatigue， increased ankle joint swelling and gait scores （P<0.01）， aggravated synovial tissue edema and inflammatory cell infiltration （P<0.01）， elevated levels of XOD， MDA， TNF-α， IL-1β， and IL-6 in the serum and ROS in the joint tissue （P<0.01）， a declined level of T-SOD （P<0.01）， up-regulated protein levels of NLRP3， TXNIP， ASC， pro-Caspase-1， Caspase-1 p20， and IL-1β in the ankle joint tissue （P<0.01）， and up-regulated mRNA levels of NLRP3， TXNIP， ASC， IL-1β， and TNF-α in the ankle joint tissue （P<0.01）. Compared with the model group， the medium- and high-dose quercetin groups showed improved general conditions， decreased gait scores （P<0.05， P<0.01）， reduced joint swelling （P<0.01）， alleviated synovial tissue edema and inflammatory cell infiltration （P<0.05， P<0.01）， lowered levels of XOD， MDA， TNF-α， IL-1β， and IL-6 in the serum and ROS in the joint tissue （P<0.01）， increased levels of T-SOD （P<0.01）， down-regulated protein levels of TXNIP， NLRP3， ASC， pro-Caspase-1， Caspase-1 p20， and IL-1β in the ankle joint tissue （P<0.05， P<0.01）， and down-regulated mRNA levels of TXNIP， NLRP3， ASC， IL-1β， and TNF-α in the ankle joint tissue （P<0.01）. Low-dose quercetin also ameliorated some of the above parameters （P<0.05， P<0.01）. ConclusionQuercetin exerts anti-GA effects by blocking the ROS/NLRP3/IL-1β signaling pathway， downregulating NLRP3 inflammasome activation， and inhibiting the production of pro-inflammatory cytokines including TNF-α， IL-1β， and IL-6.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Chronic obstructive pulmonary disease （COPD） is a chronic respiratory disease that poses a significant threat to global health， exhibiting high morbidity， disability and mortality rate， with its prevention and treatment situation becoming increasingly critical. The pathogenesis of COPD is complex， and the underlying cellular and molecular biological mechanisms remain incompletely elucidated. Programmed cell death （PCD） is the process wherein cells actively undergo demise to maintain internal environmental stability in response to certain signals or specific stimuli. Contemporary medical research indicates that the dysregulation of PCD patterns such as apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis is closely related to the onset and progression of COPD. Clarifying the molecular mechanisms of PCD in COPD may provide novel perspectives for in-depth understanding and prevention of the disease. Traditional Chinese medicine （TCM） is characterized by holistic regulation. In recent years， extensive research has been conducted in the TCM field focusing on modulating apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis for the treatment of COPD， yielding remarkable achievements. Therefore， this study systematically explored the molecular mechanism of PCD in COPD and reviewed the potential mechanisms and intervention status of TCM targeting PCD in COPD， aiming to provide insights and references for the clinical prevention， treatment and in-depth research of COPD.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Chronic obstructive pulmonary disease （COPD） is a chronic respiratory disease that poses a significant threat to global health， exhibiting high morbidity， disability and mortality rate， with its prevention and treatment situation becoming increasingly critical. The pathogenesis of COPD is complex， and the underlying cellular and molecular biological mechanisms remain incompletely elucidated. Programmed cell death （PCD） is the process wherein cells actively undergo demise to maintain internal environmental stability in response to certain signals or specific stimuli. Contemporary medical research indicates that the dysregulation of PCD patterns such as apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis is closely related to the onset and progression of COPD. Clarifying the molecular mechanisms of PCD in COPD may provide novel perspectives for in-depth understanding and prevention of the disease. Traditional Chinese medicine （TCM） is characterized by holistic regulation. In recent years， extensive research has been conducted in the TCM field focusing on modulating apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis for the treatment of COPD， yielding remarkable achievements. Therefore， this study systematically explored the molecular mechanism of PCD in COPD and reviewed the potential mechanisms and intervention status of TCM targeting PCD in COPD， aiming to provide insights and references for the clinical prevention， treatment and in-depth research of COPD.

Objective To evaluate the predictive value of different machine learning models constructed in a multicenter environment for potential organ donors and verify their clinical application feasibility. Methods The study included 2 000 inpatients admitted to five domestic tertiary hospitals from January 2020 to December 2023, who met the criteria for potential organ donation assessment. They were randomly divided into a training set and an internal validation set (7∶3). Another 300 similar patients admitted to the First Affiliated Hospital of Harbin Medical University from January 2024 to April 2025 were included as an external validation set. The area under the curve (AUC), sensitivity, specificity, accuracy and F1-score of three models were compared, and the consistency of the potential organ donor determination process was tested. Multivariate logistic regression analysis was used to identify predictive factors of potential organ donors. Decision curve analysis (DCA) was employed to verify the resource efficiency of each model, and the threshold interval and intervention balance point were assessed. Results Apart from age, there were no significant differences in other basic characteristics among the centers (all P>0.05). The consistency of the potential organ donor determination process among researchers in each center was good [all 95% confidence interval (CI) lower limits >0]. In the internal validation set, the XGBoost model had the best predictive performance (AUC=0.92, 95% CI 0.89-0.94) and the best calibration (P=0.441, Brier score 0.099). In the external validation set, the XGBoost model also had the best predictive performance (AUC=0.91, 95% CI 0.88-0.94), outperforming logistic regression and random forest models. Multivariate logistic regression showed that mechanical ventilation had the greatest impact (odds ratio=2.06, 95% CI 1.54-2.76, P<0.001). DCA indicated that the XGBoost model had the highest net benefit in the threshold interval of 0.2-0.6. The “treat all” strategy only had a slight advantage at extremely low thresholds. The recommended threshold interval, which balances intervention costs and clinical benefits, considers ≥50% positive predictive value (PPV) and ≤50 referrals per 100 high-risk patients. Conclusions The XGBoost model established in a multicenter environment is accurate and well-calibrated in predicting potential organ donors. Combined with DCA, it may effectively guide the timing of clinical interventions and resource allocation, providing new ideas for the assessment and management of organ donation after brain death.

Obesity is a multi-factorial disease involving genetics, individual behavior, socio-economic status, and environmental factors, and has become a global public health issue. The food environment, as an external factor amenable to direct intervention, affects the development of obesity by shaping individual food acquisition and consumption behaviors. The food environment refers to the physical and social environment where food is accessible, and can be assessed from dimensions such as availability, accessibility, and affordability through geographic information system spatial analysis, field surveys, commercial databases, and questionnaires. Studies indicate that the food environment can influence obesity through the spatial shaping effects of dietary structure and sociobehavioral pathways. A healthy food environment is negatively correlated with the risk of obesity, whereas an unhealthy food environment is positively correlated with the risk of obesity. This paper reviews studies related to the correlation between the food environment and obesity, covering the prevalence of obesity, the definition and assessment methods of the food environment, and the mechanisms by which the food environment affects obesity. It summarizes food environment intervention strategies centered on urban planning, policies and regulations, and community education to provide a reference for obesity prevention and control.

Objective: To conduct a scoping review on the types, construction methods and predictive performance of health literacy prediction models based on machine learning methods, so as to provide the reference for the improvement and application of such models. Methods: Publications on health literacy prediction models conducted using machine learning methods were retrieved from CNKI, Wanfang Data, VIP, PubMed and Web of Science from inception to May 1, 2024. The quality of literature was assessed using the Prediction Model Risk of Bias ASsessment Tool. Basic characteristics, modeling methods, data sources, missing value handling, predictors and predictive performance were reviewed. Results: A total of 524 publications were retrieved, and 22 publications between 2007 and 2024 were finally enrolled. Totally 48 health literacy prediction models were involved, and 25 had a high risk of bias (52.08%), with major issues focusing on missing value handling, predictor selection and model evaluation methods. Modeling methods included regression models, tree-based machine learning methods, support vector machines and neural network models. Predictors primarily encompassed factors at four aspects: individual, interpersonal, organizational and society/policy aspects, with age, educational level, economic status, health status and internet use appearing frequently. Internal validation was conducted in 14 publications, and external validation was conducted in 4 publications. Forty-two models reported the areas under the receiver operating characteristic curve, which ranged from 0.52 to 0.983, indicating good discrimination. Conclusion Health literacy prediction models based on machine learning methods perform well, but have deficiencies in risk of bias, data processing and validation.

Objective To investigate the acceptance and satisfaction of tuberculosis prevention and control personnel in Beijing with the patient management system, and to provide a basis for further improving the patient management model. Methods A survey was conducted on the current usage, satisfaction, willingness to use and system improvement opinions of the patient management system among medical staff involved in the supervision and medication management of pulmonary tuberculosis patients in Beijing. Results A total of 360 medical staff participated in the survey. ^“Patient management^” was the function with the largest number of users, accounting for 96.94%. The proportion of users of each module who believed that the module's design met actual work needs was over 90%. About 94.44% of respondents believed that patient management systems facilitated the transfer and sharing of information between institutions. And 90.83% of respondents thought that the patient management system was easy to operate, and 89.17% of respondents believed that patient management systems reduced workload. About 97.50% of respondents were satisfied with the overall use of the patient management system. The results of the influencing factor analysis showed that those with 3 or less modules designed to meet actual work were less satisfied than those with more than 3 modules, and the difference was statistically significant (P=0.001). Respondents put forward suggestions for improvement on the optimization of operational details such as system response speed, interface design, system login and query statistics. Conclusion Medical staff involved in the follow-up management of pulmonary tuberculosis patients are highly satisfied with their work using the patient management system. During the promotion and use, it is still necessary to continuously optimize the system functions according to work needs so that the system can truly facilitate work.